ID: 1188468553

View in Genome Browser
Species Human (GRCh38)
Location X:30510898-30510920
Sequence CCTTAACAACACAAAGAACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188468549_1188468553 6 Left 1188468549 X:30510869-30510891 CCATGGTTTTAAAACAGCTCCCG No data
Right 1188468553 X:30510898-30510920 CCTTAACAACACAAAGAACAAGG No data
1188468548_1188468553 20 Left 1188468548 X:30510855-30510877 CCTTCTATCTATCTCCATGGTTT No data
Right 1188468553 X:30510898-30510920 CCTTAACAACACAAAGAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188468553 Original CRISPR CCTTAACAACACAAAGAACA AGG Intergenic
No off target data available for this crispr