ID: 1188472423

View in Genome Browser
Species Human (GRCh38)
Location X:30555361-30555383
Sequence CTGTTAACTTACATGGCAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188472414_1188472423 22 Left 1188472414 X:30555316-30555338 CCCCCTTTGCAAATGTCTACGTC No data
Right 1188472423 X:30555361-30555383 CTGTTAACTTACATGGCAAAAGG No data
1188472416_1188472423 20 Left 1188472416 X:30555318-30555340 CCCTTTGCAAATGTCTACGTCCT No data
Right 1188472423 X:30555361-30555383 CTGTTAACTTACATGGCAAAAGG No data
1188472415_1188472423 21 Left 1188472415 X:30555317-30555339 CCCCTTTGCAAATGTCTACGTCC No data
Right 1188472423 X:30555361-30555383 CTGTTAACTTACATGGCAAAAGG No data
1188472420_1188472423 -6 Left 1188472420 X:30555344-30555366 CCGCGGAGCCTGTGAAACTGTTA No data
Right 1188472423 X:30555361-30555383 CTGTTAACTTACATGGCAAAAGG No data
1188472419_1188472423 0 Left 1188472419 X:30555338-30555360 CCTAATCCGCGGAGCCTGTGAAA No data
Right 1188472423 X:30555361-30555383 CTGTTAACTTACATGGCAAAAGG No data
1188472417_1188472423 19 Left 1188472417 X:30555319-30555341 CCTTTGCAAATGTCTACGTCCTA No data
Right 1188472423 X:30555361-30555383 CTGTTAACTTACATGGCAAAAGG No data
1188472413_1188472423 26 Left 1188472413 X:30555312-30555334 CCTTCCCCCTTTGCAAATGTCTA No data
Right 1188472423 X:30555361-30555383 CTGTTAACTTACATGGCAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188472423 Original CRISPR CTGTTAACTTACATGGCAAA AGG Intergenic
No off target data available for this crispr