ID: 1188473868

View in Genome Browser
Species Human (GRCh38)
Location X:30569345-30569367
Sequence GTGTGGGTATGTAGGGGAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 507
Summary {0: 1, 1: 0, 2: 2, 3: 46, 4: 458}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188473863_1188473868 -7 Left 1188473863 X:30569329-30569351 CCAAAAGTAACTCTGAGTGTGGG 0: 1
1: 0
2: 0
3: 6
4: 132
Right 1188473868 X:30569345-30569367 GTGTGGGTATGTAGGGGAAATGG 0: 1
1: 0
2: 2
3: 46
4: 458
1188473857_1188473868 26 Left 1188473857 X:30569296-30569318 CCCCCAGACATGGAAGTGAAGGA 0: 1
1: 0
2: 6
3: 48
4: 294
Right 1188473868 X:30569345-30569367 GTGTGGGTATGTAGGGGAAATGG 0: 1
1: 0
2: 2
3: 46
4: 458
1188473860_1188473868 23 Left 1188473860 X:30569299-30569321 CCAGACATGGAAGTGAAGGAGAG 0: 1
1: 1
2: 0
3: 24
4: 269
Right 1188473868 X:30569345-30569367 GTGTGGGTATGTAGGGGAAATGG 0: 1
1: 0
2: 2
3: 46
4: 458
1188473859_1188473868 24 Left 1188473859 X:30569298-30569320 CCCAGACATGGAAGTGAAGGAGA 0: 1
1: 0
2: 1
3: 37
4: 362
Right 1188473868 X:30569345-30569367 GTGTGGGTATGTAGGGGAAATGG 0: 1
1: 0
2: 2
3: 46
4: 458
1188473858_1188473868 25 Left 1188473858 X:30569297-30569319 CCCCAGACATGGAAGTGAAGGAG 0: 1
1: 1
2: 3
3: 32
4: 294
Right 1188473868 X:30569345-30569367 GTGTGGGTATGTAGGGGAAATGG 0: 1
1: 0
2: 2
3: 46
4: 458

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188473868 Original CRISPR GTGTGGGTATGTAGGGGAAA TGG Intronic
901435143 1:9242972-9242994 GTGTGTGTATTTAGGGGTGAGGG + Intronic
902098205 1:13963793-13963815 GTGTGTGTGTGTAGGGGTAGTGG + Intergenic
902156606 1:14492628-14492650 GTGTGGTTATGTAGGGCCTAGGG - Intergenic
902615138 1:17619467-17619489 GTGGGGGTCTGCAGGGGAAGGGG + Intronic
903157902 1:21461086-21461108 GTGTGGGAATGTAGAGCAACTGG + Intronic
904837960 1:33350931-33350953 GTGTGGGCATGTTAGGGAACAGG - Intronic
905120587 1:35678830-35678852 GTGTGGGCCTGTAGGGGAGTGGG - Intergenic
905585491 1:39114112-39114134 GTGGGGGTGTGTAGGGGCAGGGG - Intronic
905851543 1:41278564-41278586 GTGTGTGTATGTGTAGGAAAGGG - Intergenic
908340985 1:63178948-63178970 GTTTGGGGACTTAGGGGAAAAGG + Intergenic
909516417 1:76512245-76512267 GTGTGGGTTTGAAGGAGAAATGG - Intronic
910170319 1:84370187-84370209 GTGTGTGTGTGTAGGGGAATGGG - Intronic
910451552 1:87351754-87351776 GTGTGGGTGGGTAGGGCAGAGGG - Intergenic
910628654 1:89335328-89335350 GTGTTGCTAGGTAGGGGTAATGG - Intergenic
911140171 1:94492713-94492735 GTGAGGGTAAGTAGGAGAAAGGG - Intronic
913397242 1:118385497-118385519 GGATGGGCATGTGGGGGAAAAGG + Intergenic
913602479 1:120435199-120435221 GTGTGGGAATGTAGAGCAACTGG + Intergenic
913991702 1:143619060-143619082 GTGTGGGAATGTAGAGCAATGGG - Intergenic
914190581 1:145406574-145406596 GTGTGGGAATGTAGAGCAACTGG - Intergenic
914363651 1:146958831-146958853 GTGTGGGAATGTAGAGCAACTGG + Intronic
914434154 1:147645417-147645439 GTGGGTGAGTGTAGGGGAAAAGG + Exonic
914488024 1:148128295-148128317 GTGTGGGAATGTAGAGCAACTGG - Intronic
914588387 1:149083448-149083470 GTGTGGGAATGTAGAGCAACTGG - Intronic
914837822 1:151222787-151222809 ATGTGGGTATGTTGGGGGATGGG + Intronic
916382945 1:164233486-164233508 GTGGGGGGATGTGGGGGCAAGGG - Intergenic
916404139 1:164481134-164481156 GTGTGGGTATGTAAGGGCTTGGG - Intergenic
916598795 1:166272438-166272460 GTGTGGGTGTGAAGGGGCATTGG + Intergenic
916657955 1:166894221-166894243 TTATGTGTATGTAGGGGGAAGGG - Intergenic
917672488 1:177286106-177286128 GTGTGGGGATGGAGGAGAGAAGG + Intergenic
917762881 1:178182855-178182877 GGGTGGGTAGGTGGGGGAAATGG + Intronic
917857774 1:179115549-179115571 GTGTGGATATGTTGAGTAAAAGG - Intronic
918093362 1:181315982-181316004 GTGTGTGTATGTTGGGGTAGTGG + Intergenic
919353448 1:196490560-196490582 GTGTGTGTATGTGAGAGAAATGG - Intronic
919742534 1:200989576-200989598 GTGTGTGTATGTGGGGGTAGGGG - Intronic
920091920 1:203460460-203460482 GTGTGGGTATGCTGGACAAAGGG + Intergenic
920293248 1:204939076-204939098 GTGTGTGTGTGTAGGGGGATTGG + Intronic
920795231 1:209130593-209130615 GTGTGTGTATGAAAGGAAAAGGG - Intergenic
922420693 1:225459497-225459519 GTGTGTGTGTGTTGGGGGAAGGG + Intergenic
922987281 1:229875511-229875533 GTGTGTGTGTGTAGGGGGAAGGG - Intergenic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
1064547947 10:16469495-16469517 CTGTGAGAATGAAGGGGAAAAGG + Intronic
1067917529 10:50417171-50417193 GTTTGGGGAAGTAGGGGACAGGG - Intronic
1068018307 10:51545875-51545897 GGGTGGGGGTGTAGGGGGAAGGG - Intronic
1068620669 10:59177348-59177370 GTGTGTGTGTGTTGGGGGAAGGG - Intronic
1069325112 10:67224245-67224267 GGGTTGGCATGTGGGGGAAACGG - Intronic
1069522034 10:69129950-69129972 TTGTGGCTATGTAGGGCACAAGG - Intronic
1070584984 10:77757579-77757601 GTGTGACTTTGTAGGTGAAATGG - Intergenic
1071164632 10:82791133-82791155 GTGGGGGCAGGAAGGGGAAAAGG - Intronic
1071203747 10:83251090-83251112 ATTTGGGTTTGTAGGGGACAAGG + Intergenic
1073035804 10:100563433-100563455 GTGTGTGGATGTAGGGGTGAGGG - Intergenic
1073195469 10:101687344-101687366 GTGTGGGTTGGAAGGGGGAATGG - Intronic
1074791181 10:116889136-116889158 GTGTGTGTCTGTAGGTGAAGGGG + Intronic
1074856293 10:117476520-117476542 GTGTGGGTGTGTGGGTGGAAGGG + Intergenic
1076108866 10:127845997-127846019 GTTTGGGTATGTTGGGGACATGG - Intergenic
1078004020 11:7518913-7518935 CTGAGGGTTTGAAGGGGAAAGGG + Intronic
1078184532 11:9040495-9040517 GCGTGGGTACGCAGGAGAAAGGG + Intronic
1078184547 11:9040555-9040577 GCATGGGTACGTAGGAGAAAGGG + Intronic
1078184578 11:9040675-9040697 GTGTGGGTACGCAGGAGAAAGGG + Intronic
1078551042 11:12280866-12280888 GTGTGGGTGTGTTGGGGCATGGG + Intronic
1079478162 11:20853245-20853267 GTGTGGGAAAGGAGAGGAAAAGG + Intronic
1079619949 11:22541869-22541891 GTGTGAATATCTGGGGGAAAGGG + Intergenic
1079711289 11:23685411-23685433 AGGTGGGGAAGTAGGGGAAAGGG + Intergenic
1080439613 11:32279841-32279863 GTGGGGGTATAGAGGAGAAAAGG + Intergenic
1081611799 11:44567383-44567405 GTGTGTGTATGTAGGGCAGGGGG + Intronic
1081634643 11:44712719-44712741 GTGGGGGTCTGTAGAGGAATGGG + Intergenic
1082565813 11:54676804-54676826 GTGGGGGAAGGGAGGGGAAAGGG - Intergenic
1083180801 11:60983594-60983616 GTTGGGGTATTTAGGAGAAAGGG - Intronic
1083257172 11:61503797-61503819 ATGTGTGTGTGTTGGGGAAAGGG - Intergenic
1083268503 11:61558557-61558579 GTGTGTGTTTGTTGGGGAACAGG + Intronic
1083281352 11:61629056-61629078 GTGAGGGTGTGTGGAGGAAAGGG + Intergenic
1083391505 11:62354643-62354665 GTGTGGATATGCTGGAGAAAGGG + Intronic
1083870337 11:65483825-65483847 GTGTGTGTGTGTAGTAGAAACGG + Intergenic
1083932942 11:65855830-65855852 GTGTGGGTTTGGAGGGGGAGGGG - Intronic
1084862113 11:72025884-72025906 TTGTGGGTGGGTAGGGAAAATGG - Intronic
1085610703 11:77945970-77945992 CTGTGGCTATGTAGGGAAATGGG - Intronic
1086944930 11:92835723-92835745 GTCTGTGTGTGTAGGGGGAAAGG - Intronic
1088013025 11:105026183-105026205 GTGTGGGAAGGTTGAGGAAAGGG - Exonic
1088389158 11:109294684-109294706 GTGTGGGTATGTGTGTGAGAGGG + Intergenic
1089087170 11:115830434-115830456 GTGAGGGTTTCTAGGGGATAGGG + Intergenic
1089325371 11:117653188-117653210 GGGTGTGTGTGTAGGGGAAATGG + Intronic
1090613793 11:128496516-128496538 GTGTTGGTCTGAAGGGGTAAAGG - Intronic
1091129888 11:133136865-133136887 GTGTGTGTGTGTTGGGGAAGGGG + Intronic
1091206865 11:133827653-133827675 GTGAGTGTCTGTAGGGGAAATGG - Intergenic
1091271846 11:134319768-134319790 GTGTGTGTATGTAGGAGTAGGGG + Intergenic
1091300504 11:134504160-134504182 GTGTGGGTGGGGTGGGGAAAGGG + Intergenic
1091475999 12:773333-773355 GAGTGGGTAGGAAGTGGAAAAGG - Intronic
1092011384 12:5115571-5115593 ATGTGGGTGTGTATGGAAAAGGG + Intergenic
1092188417 12:6499075-6499097 GTGTGGATATGTTGGACAAAGGG + Intronic
1092574996 12:9772442-9772464 GTGTGTGTTTGTTGGGGCAAAGG + Intergenic
1093385231 12:18544987-18545009 TTGTGGTTATGTATGGAAAATGG - Intronic
1094003048 12:25717029-25717051 GGATGGGTGTGTAGGGGAAATGG + Intergenic
1094842902 12:34349388-34349410 GGGTGGGTGTGGAGGGGACAAGG + Intergenic
1095963582 12:47851467-47851489 GTGTGGGTGTGTGGGGGCACAGG - Intronic
1096079088 12:48822110-48822132 GTGTGTGTGTATAGGGGAAGGGG - Intronic
1096251797 12:50038189-50038211 GTCTGGGTATATAGGGGAAGGGG + Intergenic
1097087894 12:56482276-56482298 GTGTGGGCATGATGGGGAATAGG - Intronic
1097124548 12:56763471-56763493 GTGTGTGTGTGTAGGGGATATGG + Intronic
1098863311 12:75733620-75733642 CTGTTGGAAAGTAGGGGAAACGG + Intergenic
1099861353 12:88228811-88228833 TTGAGGGTTTGAAGGGGAAAGGG - Intergenic
1100042109 12:90332465-90332487 GTGTGTGTATGTGTCGGAAAAGG - Intergenic
1100465608 12:94842121-94842143 GTGTGTGTGTGTAGGGGGACTGG - Intergenic
1100535319 12:95503438-95503460 GTGAGGGAGTGGAGGGGAAAGGG + Intronic
1100728349 12:97434819-97434841 GTGTGTGTGTGCAGGGGAAGGGG - Intergenic
1101383555 12:104235685-104235707 GTGTGGTTCTGTTGAGGAAAGGG + Intronic
1102784512 12:115593388-115593410 CTGTGGGGATTCAGGGGAAAGGG - Intergenic
1102948516 12:117011383-117011405 GGGTGGGTATCTAGGGGTGAAGG - Intronic
1102994907 12:117341658-117341680 GGGCAGGTATGTAGGGGCAAGGG - Intronic
1103130511 12:118464451-118464473 CTTTGGGGATGCAGGGGAAAGGG - Intergenic
1103948772 12:124540795-124540817 GGGTGGATATGGAGGGGAATGGG + Intronic
1104135827 12:125937325-125937347 CTTTGGGTACTTAGGGGAAAGGG - Intergenic
1104337678 12:127915340-127915362 GTGTGGGAGGGAAGGGGAAAAGG - Intergenic
1104636237 12:130439527-130439549 GTGTGGGTCTGTAGGGGTGTCGG + Intronic
1106219985 13:27738293-27738315 GTGTGTGTGTGTTGGGGAAGAGG + Intergenic
1106287039 13:28326947-28326969 GTGTCAGGAAGTAGGGGAAAGGG + Intronic
1107141052 13:36999106-36999128 TTGGGGGAATCTAGGGGAAAAGG + Intronic
1107379880 13:39845399-39845421 GTGTGGATCTGTAGGGAAAATGG + Intergenic
1107383530 13:39882567-39882589 GAGTGGGTCTGCAGGGCAAAGGG + Intergenic
1109444719 13:62419771-62419793 GGGTGGGGGTGTACGGGAAAAGG + Intergenic
1111542237 13:89684293-89684315 GTGTGTGTCTGTGGGGGAAGGGG + Intergenic
1112330474 13:98473647-98473669 GTGTGGGTATGTGGGGGGTGGGG + Intronic
1112439334 13:99414493-99414515 GTTTGGGTATGTAGGGTGAGTGG - Intergenic
1113675206 13:112202301-112202323 GCGTCGGCATGAAGGGGAAAGGG + Intergenic
1114039826 14:18667412-18667434 GTGTGTGTTTGTGGGGGTAAGGG + Intergenic
1114558691 14:23576689-23576711 GTGCGGGTAAACAGGGGAAACGG + Intronic
1114883331 14:26814056-26814078 GTGTCTGTATGTAGGCCAAAAGG - Intergenic
1115586443 14:34818699-34818721 GTGTGGATATGTAAGACAAATGG - Intronic
1115913961 14:38288764-38288786 GGGTGGGTAAGTAGGGCAATGGG + Intergenic
1116844727 14:49854620-49854642 GACTTGGGATGTAGGGGAAATGG + Intergenic
1117157515 14:52955424-52955446 GTGGGGGGAGGTGGGGGAAAAGG - Intergenic
1117417475 14:55510493-55510515 GTGTGTGTGTGTAGGGGATGGGG - Intergenic
1117983348 14:61363566-61363588 GAATGGGTATGTAGGGGCCAAGG + Intronic
1120015707 14:79470986-79471008 GTGTGTGTGTGTTGGGGAGAAGG + Intronic
1120353263 14:83392046-83392068 GTGTGTGTATGGATGTGAAAGGG + Intergenic
1120711952 14:87801876-87801898 GTGTGTGGATGTAGGGGACAAGG - Intergenic
1121628877 14:95408304-95408326 GTGTGTGTGTGTTGGGAAAATGG - Intronic
1122663016 14:103310506-103310528 ATGTGGGTATGTATGGGGCAGGG - Intergenic
1124035828 15:26052936-26052958 GTGTGAGGATGTAGGGTGAAAGG - Intergenic
1124474984 15:30025558-30025580 TTGTGGGTAGGTAGGGGAAAGGG - Intergenic
1124667399 15:31605182-31605204 GTGTGGGTGTGCAGGGGGAATGG + Intronic
1124861431 15:33445650-33445672 GTGTGTGTTGGTGGGGGAAAGGG - Intronic
1126977014 15:54194687-54194709 GAGTGGGTATGAAGTTGAAATGG + Intronic
1127281769 15:57499062-57499084 GTGTGGGGATGGATTGGAAAGGG + Intronic
1127303689 15:57681956-57681978 ATGTGGGAAGTTAGGGGAAAGGG + Intronic
1127341545 15:58049996-58050018 GTGTGGGTCTTGAGGGGGAAGGG + Intronic
1128162570 15:65433872-65433894 CTGTGGGTATTTGGTGGAAATGG + Intergenic
1128531729 15:68455886-68455908 GTGTGTGTGTGTATGTGAAATGG + Intergenic
1128571168 15:68734128-68734150 GTGTGTGTGTGTAAGAGAAAGGG + Intergenic
1129083076 15:73058583-73058605 GTGTGTGTATGTGGGGGTCAGGG + Intronic
1130298275 15:82662427-82662449 GTGAGGGTGAGTGGGGGAAAGGG - Intronic
1130559229 15:84945469-84945491 GTTTGGATGTGGAGGGGAAACGG - Exonic
1131263071 15:90899414-90899436 GTGTGAAGATGGAGGGGAAAAGG + Intergenic
1131360175 15:91783761-91783783 GTGGGGGTATTTAGGGGCCAAGG - Intergenic
1131650166 15:94389315-94389337 GGGTGGGCATGGAGGGGAAGTGG + Intronic
1131750992 15:95508023-95508045 CTGTGAGTATGTAGAGGAACTGG - Intergenic
1132000476 15:98174427-98174449 GCGGGGGAATGTAGGAGAAATGG - Intergenic
1132024424 15:98392747-98392769 GTGTAGGCATGAAGGAGAAAAGG - Intergenic
1132345731 15:101107680-101107702 GTGGGGGTATGTGGGGGGAATGG - Intergenic
1132763189 16:1520932-1520954 GGGTGGGTATGGAGGGGACAAGG + Intronic
1133031772 16:3014451-3014473 GGGTGGGGATGTTGGGGAGAGGG - Exonic
1133844866 16:9444339-9444361 ACTTGGTTATGTAGGGGAAAAGG + Intergenic
1135004205 16:18803471-18803493 CTGTGGGTCTTTCGGGGAAAGGG + Intergenic
1135173621 16:20208851-20208873 GGGTGGGTATTGAGGGGACAGGG + Intergenic
1137024706 16:35460902-35460924 GTGTGTGTGTGTTGGGGAGAGGG + Intergenic
1138565894 16:57832647-57832669 GTGTGTGTGTGTTGGGGAAAGGG - Intronic
1138916200 16:61467619-61467641 CTGTATGTATTTAGGGGAAATGG + Intergenic
1139663036 16:68435207-68435229 GTGAGGGTAGGTTGGGGGAAAGG + Intronic
1140104162 16:71944013-71944035 TTTTGGGTATGGAGAGGAAATGG - Exonic
1141007103 16:80362869-80362891 GTGTGTGTATGTGGGGGTGAGGG + Intergenic
1141855396 16:86677732-86677754 GTGTGGGGATGGCGGGGAGAGGG - Intergenic
1142698666 17:1646889-1646911 GAGTTTGTATGTTGGGGAAAGGG - Exonic
1143173933 17:4945833-4945855 GTGTGTGTATGGGGAGGAAAGGG + Exonic
1143866480 17:9927276-9927298 GTGTGTGTATGTAGTAGAGATGG - Intronic
1144713477 17:17418704-17418726 GTATGGGAAGGTTGGGGAAAGGG - Intergenic
1145063924 17:19749198-19749220 GTGGGTGGATGTAGGGGAAGGGG - Intergenic
1146419934 17:32674157-32674179 GTGTGGGGGTGGAGTGGAAACGG + Intronic
1146665279 17:34698122-34698144 GTGTGTGTGTGTTGGGGAAAGGG - Intergenic
1147190380 17:38734969-38734991 GTGTGTGTATGTGTGGAAAATGG - Exonic
1148507070 17:48135897-48135919 ATGTGGGGATTTTGGGGAAATGG + Intronic
1149177349 17:53889178-53889200 GTGTGGGTATGCTGGACAAAGGG + Intergenic
1149345014 17:55725959-55725981 AAGTGTGTATGTAGGGGAATGGG + Intronic
1149345353 17:55728794-55728816 GTGTGTGTGTGTAGGGGGTAGGG + Intronic
1149660148 17:58330598-58330620 GTTTGGGTATGTAGGGGGGCAGG + Intergenic
1151498994 17:74476967-74476989 GTGTGTGTATGTGGGGAAATTGG + Intronic
1151703421 17:75754907-75754929 GTGTGTGTATGTTGGAGAATGGG - Intronic
1152301098 17:79495605-79495627 GGGTGGGGAGGTGGGGGAAAGGG + Intronic
1152897217 17:82919395-82919417 GTGTAGGTTGGTAGGGAAAACGG + Intronic
1152987512 18:334183-334205 ATGTGTGTATGTATGGGACAGGG - Intronic
1154406901 18:14100667-14100689 GAGTGGGTATGGTGGGGAGAAGG + Intronic
1155075577 18:22351189-22351211 GTGTGTGTGTGTTGGGGGAAGGG + Intergenic
1155167104 18:23240349-23240371 CTGTGTGTGTGTAGGGGGAAGGG - Intronic
1155373137 18:25125645-25125667 GTGTGTGTATGTATGTGTAATGG + Intronic
1155838818 18:30622560-30622582 GTGTGTGTGTGTAGGGGGCAGGG + Intergenic
1155930533 18:31702861-31702883 GAGTGGATATGGAGGGGAAATGG + Intergenic
1157785831 18:50481807-50481829 GTGTGGATATTTAGAGGAAAAGG + Intergenic
1159289679 18:66399997-66400019 GAGTGTGTATGTAGGCAAAAAGG + Intergenic
1159755559 18:72359699-72359721 GTGTTGGTAGGTAGGTGCAATGG - Intergenic
1160401890 18:78617446-78617468 GTGTGTGTGTGTGTGGGAAAAGG - Intergenic
1160999105 19:1900386-1900408 GGGTGGGTATGTAAAAGAAAGGG + Intergenic
1161347162 19:3774193-3774215 GTGTGGGTATGGAGGTGCAAGGG + Intergenic
1161545603 19:4878371-4878393 GTGTGACTGTGTTGGGGAAAAGG - Intergenic
1163288864 19:16365627-16365649 CTGTGGGTTTGCAGGGGATAGGG + Intronic
1163856769 19:19708501-19708523 GTGTGGGTTTGGATGGGAAACGG + Intergenic
1166424794 19:42668098-42668120 GTGTGTGTGTGTTGGGAAAAGGG - Intronic
1166633049 19:44424856-44424878 GAGTGGGTTGGTAGGGGAGATGG - Intronic
1167615370 19:50530099-50530121 CTGTGGGGATGGAGAGGAAATGG - Intronic
1168292872 19:55365636-55365658 GGGTGGGGACGGAGGGGAAAGGG - Exonic
925055185 2:851802-851824 GTGTGTGTGTGTAGGGGCAAGGG + Intergenic
925059174 2:878024-878046 GTGTGTGTGTGTAGGGGCAGGGG - Intergenic
925059194 2:878165-878187 GTGTGTGTGTGTAGGGGTGAGGG - Intergenic
925059207 2:878211-878233 GTGTGTGTGTGTAGGGGTGAGGG - Intergenic
925467764 2:4124671-4124693 GTGTGTGTGTGTAAGAGAAATGG + Intergenic
926096897 2:10087221-10087243 GTGTGTGTGTTTAGGGGAGAGGG - Intergenic
926781225 2:16473940-16473962 GTGTGTGTATACAAGGGAAATGG + Intergenic
927668655 2:25050434-25050456 GTGTGGGGGTGCAGGGGTAAGGG + Intronic
927750992 2:25670923-25670945 GTGTGGATATGCTGGAGAAAGGG - Intronic
928111844 2:28516895-28516917 GCGTGTGTATGGAGGGGAGAGGG + Intronic
930836357 2:55797962-55797984 CTTTGGGGATGTAGGGGAAAGGG + Intergenic
931092053 2:58896704-58896726 GTGTGGGTGTGGAGGGAAATGGG - Intergenic
931486838 2:62702463-62702485 CTGTTGGTTGGTAGGGGAAATGG + Intronic
931516578 2:63053736-63053758 GTGTGTGTGTGCAGGGGAGAGGG + Intronic
931969445 2:67569365-67569387 GTGTGTGTGTGTTGGGGAATGGG + Intergenic
932332449 2:70905476-70905498 GTGTGTGTTTGTGGGGGTAAGGG - Intronic
932429233 2:71664086-71664108 GAGTGTGTGTGTAGGGGGAAGGG - Intronic
933762788 2:85684735-85684757 GTGTGTGTGTGTAGTGGAATGGG + Intergenic
933816263 2:86071252-86071274 GTGTGTGTGTCTATGGGAAAGGG + Intronic
934663327 2:96154522-96154544 CAGTGGGTACGTAGAGGAAAAGG - Intergenic
935151291 2:100439127-100439149 GTGTGTGTGTGTAAGAGAAAGGG + Intergenic
935510070 2:103960652-103960674 GTGTGTGTGTGTTGGGGATAGGG + Intergenic
935796438 2:106645642-106645664 GGGTGGGAAGGGAGGGGAAAAGG + Intergenic
936075703 2:109400609-109400631 GTGTGGGTGTGTATGTGGAAGGG - Intronic
936562358 2:113552096-113552118 GGGTGGGCATGGAGGGGAGAGGG - Intergenic
936777098 2:115986750-115986772 GTGTGGGTGTGGTGGGGGAAAGG + Intergenic
938241201 2:129743537-129743559 GTGTGTGTGTGTAGGGGGAGTGG - Intergenic
938408754 2:131046797-131046819 GTGTGTGTGTGTAGCGGAAAAGG + Exonic
938768797 2:134482383-134482405 GTGTTGGTCTTTAGGGGAAAGGG - Intronic
939496906 2:142935794-142935816 CTGAGGGTATGAAGGGGGAAGGG + Intronic
939602918 2:144216040-144216062 GTCTGGGGAAGTTGGGGAAAAGG - Intronic
939631488 2:144531291-144531313 GTGTGGGATTGGAGGGGAAAGGG - Intergenic
940122596 2:150283350-150283372 GTGTGGGAATGGAAGGGCAATGG - Intergenic
940501161 2:154495172-154495194 GTGACGGTTTGTAGGGGCAAAGG + Intergenic
940617398 2:156066379-156066401 GTGTGTTTGTGTAGTGGAAAGGG - Intergenic
940651324 2:156443804-156443826 AGGTGGGTAAGTAGGGGGAAGGG - Intronic
941125063 2:161575367-161575389 ATTTGGGTTTGTTGGGGAAATGG + Intronic
941268960 2:163401277-163401299 GTGTTGGTATGGAGGGTAGAAGG - Intergenic
941580272 2:167288528-167288550 GTGTGTGTGTGTCGGGGAAGGGG - Intergenic
943702906 2:191005827-191005849 GTCTGGGGATGTCAGGGAAAGGG - Intronic
944580124 2:201125219-201125241 GTGTGGCTGTGTAGAGGAGATGG + Intronic
946034067 2:216727884-216727906 GTGTGAATATGTAGTGGAAGTGG + Intergenic
946092625 2:217243499-217243521 GTGTGTGTGTGTTGGGGAAAGGG - Intergenic
946519973 2:220453821-220453843 CTGTGCTGATGTAGGGGAAAGGG + Intergenic
946738262 2:222776086-222776108 GTGTGTGTGTGTATGGGGAAGGG - Intergenic
947508905 2:230732772-230732794 GTGTGTGCCTGTAGGAGAAATGG + Intronic
947609559 2:231515253-231515275 GTGTGTGTTTTTAGGGGATAGGG + Intergenic
948126460 2:235567797-235567819 GTCTGGGCCTGTAGGGGAAGTGG + Intronic
1169549452 20:6687341-6687363 GTGGAGGTAGGTAGGGAAAATGG + Intergenic
1169837522 20:9897070-9897092 GGGTGGTTTTGTAGGGGACAAGG - Intergenic
1170316289 20:15044470-15044492 GAGTGGGTCTGGAGGGCAAATGG - Intronic
1172050128 20:32110638-32110660 GTGTGGCCATGTTGGGGAATGGG - Intronic
1172579407 20:36034996-36035018 GTGTGTGTGTGCTGGGGAAAGGG - Intergenic
1173215915 20:41083299-41083321 ATGTGGGTATGTTTGGGAGAAGG - Intronic
1174329226 20:49804604-49804626 GAGTTGGGATGCAGGGGAAAAGG + Intergenic
1175259912 20:57667801-57667823 GTGGGGGTAGGTAGGGGAGAGGG - Intronic
1175792165 20:61746525-61746547 GTGTGGGGAAGGAGTGGAAAAGG + Intronic
1175972272 20:62692658-62692680 GTGTGTGTGTGTAGAGGAAGAGG + Intergenic
1177012687 21:15747685-15747707 GTGTGGATATGTTGGACAAAGGG + Intronic
1177805836 21:25873835-25873857 ATGTTTGTATGTAGGGGACAGGG + Intergenic
1178356978 21:31917681-31917703 GTGTGTGTATGTTTGGGAATGGG - Intronic
1179107710 21:38418291-38418313 GTGTGTGTGTGTCTGGGAAAGGG + Intronic
1180704929 22:17803507-17803529 GTGTGTGTATTTAGGGGACCAGG + Intronic
1181305761 22:21916467-21916489 GGGTGGGGATGGAGGTGAAAGGG - Intergenic
1182266345 22:29118765-29118787 GTGTATGAATGTATGGGAAAAGG - Intronic
1182623304 22:31629576-31629598 GTATGGGTGTGTAGGTGCAAGGG + Intronic
1182970728 22:34573618-34573640 CTATGGGGATTTAGGGGAAAAGG - Intergenic
1183357927 22:37369380-37369402 GTCTGGGTAGGTCTGGGAAAAGG - Exonic
1183841680 22:40502985-40503007 GTGTGGGTGTATTGGGGAAGGGG - Intronic
1183959992 22:41405739-41405761 GTGTGTGTGGGTTGGGGAAAAGG + Intergenic
1184266581 22:43350181-43350203 GTGTGGGTATGAAGCAGTAAGGG + Intergenic
1184420774 22:44381760-44381782 GTGTGGGGAGGAAGGGGAAGGGG + Intergenic
1185193391 22:49452873-49452895 GTGTGGGTAGGTAGAGGAACAGG + Intronic
1185275972 22:49950369-49950391 GTGGGGGGATGTGGGGGACAGGG + Intergenic
950116971 3:10457214-10457236 GTGTGGGTGTGTAGGGTGTATGG + Intronic
950729138 3:14941546-14941568 GTGGGGGGATGGAGGGGCAATGG + Intergenic
951051817 3:18102193-18102215 GTGTGGTTAGCTAGTGGAAAAGG - Intronic
951488019 3:23235756-23235778 GTTTGAGTCTGTTGGGGAAATGG + Intronic
951681830 3:25302911-25302933 TTGTGTGTATGTAAGAGAAAGGG + Intronic
952845610 3:37685562-37685584 GGGTTGGTAGGTGGGGGAAAGGG + Intronic
952966507 3:38624198-38624220 GTGTGTGTGTGTAAGGGAGAAGG - Intronic
953025269 3:39141525-39141547 GTGTGGGTGTGTAGGAAGAAGGG + Intergenic
953358624 3:42275741-42275763 GTGTGGGGGTCTAGGGGAATGGG + Intergenic
954149516 3:48650459-48650481 GGGTGAGTATGTGGGGGGAAAGG - Exonic
956808593 3:72842204-72842226 CTGTGTATTTGTAGGGGAAATGG - Intronic
960367880 3:116795813-116795835 GGTGGGGTATGTATGGGAAATGG - Intronic
961951822 3:130757506-130757528 GTGTGTGTGTGTCGGGGAGAGGG - Intergenic
962038530 3:131680827-131680849 CTGTGGGGACGCAGGGGAAAGGG - Intronic
962679039 3:137779996-137780018 GTGGTGGGATGAAGGGGAAATGG + Intergenic
962733724 3:138305524-138305546 GTGTGTGTGTGTTGGGGAATAGG - Intronic
964085925 3:152818164-152818186 TTGTGTGTATGTGGGGGACAGGG - Intergenic
964259243 3:154816027-154816049 ATGGGGGTATGTTGGGCAAAGGG + Intergenic
964290506 3:155174370-155174392 GTGTGTGTGTGAAGGGTAAATGG + Intronic
964659637 3:159106087-159106109 ATGTGTGTATGTAGGAGAAGAGG + Intronic
964836926 3:160949287-160949309 GTGTGTGTATTTCTGGGAAAAGG + Intronic
964944818 3:162208099-162208121 GTGTGGATATTATGGGGAAAAGG - Intergenic
966656132 3:182360515-182360537 GTGTGTGTGTGTAGGGGGAAAGG + Intergenic
966704114 3:182892191-182892213 GTGAGGGAATCTTGGGGAAAGGG - Intronic
967592610 3:191296240-191296262 GTGTGTGTAAGTTGGGGAAGGGG - Intronic
968173673 3:196530064-196530086 CTTTGGGTATTCAGGGGAAAGGG - Intergenic
969599149 4:8165640-8165662 GTGTGGGCATGGAAGGGATAAGG + Intergenic
970636801 4:18020427-18020449 GGGTGGGAGTGTAGGGGAAGAGG - Intronic
971054312 4:22895628-22895650 GTGTGTGTGTGTAAGGGAACTGG + Intergenic
971357042 4:25904479-25904501 GTGTGGGTATAGATGGGGAATGG + Intronic
972181476 4:36472150-36472172 GTGTGGGTGTGTGGAGGAAAGGG + Intergenic
972249165 4:37281040-37281062 GAGTGGGTCTGGAGGGGCAAAGG + Intronic
972303614 4:37810394-37810416 GTGTGGTTATGTATGAGAATAGG + Intergenic
972685216 4:41346014-41346036 CTCTGGGTATGTGGGGGGAAGGG - Intergenic
972723928 4:41729180-41729202 GTGTGGGTAAGTGGGGGAAGAGG - Intergenic
973129813 4:46636504-46636526 GAGTGTGTATGTTGGGGATAGGG - Intergenic
973845756 4:54911507-54911529 GTGTGGGTATGGTGGAGAAGGGG - Intergenic
973970203 4:56205562-56205584 GTGTGTGTGTGTTGGGGAGAAGG + Intronic
974152058 4:58022836-58022858 GTGTGTGTAGCTAGGGGGAAGGG + Intergenic
975222971 4:71835110-71835132 GTGTGGAGAAGTAGGAGAAAAGG - Intergenic
975915094 4:79315339-79315361 GTGTGGATATATGGGAGAAATGG - Intronic
975997111 4:80328497-80328519 GTGTGGGTAGGTAGGGGTGGGGG + Intronic
977202303 4:94131411-94131433 GTGTGGATATGCTGGGGAAAGGG + Intergenic
977286538 4:95114633-95114655 GTGTGTGTGTCTAGGGGAAAAGG - Intronic
980046587 4:127996081-127996103 GTGTGGATGAGTAGAGGAAAAGG + Intronic
980689914 4:136281686-136281708 TTGTAGGTAAATAGGGGAAAAGG - Intergenic
981978726 4:150765491-150765513 CTATGAGTGTGTAGGGGAAAGGG + Intronic
983207170 4:164922687-164922709 GGCTGATTATGTAGGGGAAATGG - Intergenic
983310666 4:166057120-166057142 ATGTGTGTATGTATGTGAAATGG - Intronic
983804183 4:171973075-171973097 GTGTGTGTATGTTGGGGAGGAGG - Intronic
984049982 4:174853877-174853899 GTGTGGGTATGCTGGACAAAAGG + Intronic
984482194 4:180319620-180319642 GTGTGGGTATGTATGTGTACTGG + Intergenic
985484507 5:140863-140885 GTGGGGGTGTGCAGGGGAGAGGG - Intronic
985484554 5:140990-141012 GTGGGGGTGTGCAGGGGAGAGGG - Intronic
985497872 5:219711-219733 GTGGGGCTTTTTAGGGGAAATGG + Intronic
985532070 5:439702-439724 GTGTGCGTGTGCAGGGGGAAGGG + Intergenic
985674121 5:1221541-1221563 GAGTTGGGAGGTAGGGGAAAGGG + Intronic
990370445 5:55113103-55113125 GTGTGGGTGTGTAAAGGAAAAGG + Intronic
990505257 5:56437670-56437692 CTTTGGGGATTTAGGGGAAAAGG + Intergenic
990849695 5:60188594-60188616 GAGTGGAGATGGAGGGGAAATGG + Intronic
990854560 5:60249254-60249276 GTGTGGGCATGAGAGGGAAATGG - Intronic
991044804 5:62211428-62211450 GTGTGTGTTTGTATGGGAGAGGG - Intergenic
992234220 5:74692589-74692611 GTGTGGTTATCTAATGGAAAAGG + Intronic
993566311 5:89480153-89480175 GTGTGTGTGTGAAGGGGAAGAGG - Intergenic
993640924 5:90404364-90404386 GTGTTTGTATATAGTGGAAATGG - Intronic
994407968 5:99369535-99369557 GTGTGTGTATTTAGGTAAAAGGG + Intergenic
994497043 5:100526035-100526057 CTTTGGAGATGTAGGGGAAAGGG + Intergenic
994987664 5:106958559-106958581 GTGGAGGGATGAAGGGGAAAGGG - Intergenic
995245046 5:109925485-109925507 GTGTGTGTATGTGGAGGGAATGG + Intergenic
995340881 5:111057833-111057855 GTGTGGGTATGGTGGACAAAGGG + Intergenic
996422138 5:123274363-123274385 GACTGGGTATGTAGGGGTATGGG - Intergenic
996555850 5:124778253-124778275 GTTTGGCTATGAAGGGGAAGAGG + Intergenic
997085859 5:130797643-130797665 GTGTGGGTATGTATGGGTGTGGG - Intergenic
998103297 5:139451803-139451825 GGGTGGGTGTGTAGGGTATAGGG + Intronic
998176038 5:139902693-139902715 GGATGTGTATGTAGGGGGAATGG + Intronic
998391208 5:141788150-141788172 GTGTGGGGGTGTAGAGGGAAAGG - Intergenic
999782271 5:154858828-154858850 TTGGGGGTCTGTAGGGGGAAGGG + Intronic
999816218 5:155178964-155178986 GTGTGGCTATGTAGGAAATATGG - Intergenic
999881138 5:155865427-155865449 ATATAGGTATGTAGTGGAAAGGG + Intergenic
1000057240 5:157618298-157618320 GTGTGGGACTCTAAGGGAAATGG - Intergenic
1000143462 5:158429632-158429654 GTGTGTGTGTGTAGGGGAGGAGG - Intergenic
1000371253 5:160538864-160538886 GTGTGGGAATGAGTGGGAAAGGG - Intergenic
1001106613 5:168859972-168859994 GTGTGGATAGGTAGGGAAAGAGG - Intronic
1001428847 5:171643896-171643918 GTGTGTGTGTGTAGGGGGAGAGG + Intergenic
1001569233 5:172719238-172719260 GTGGGGCTATGGTGGGGAAAAGG + Intergenic
1001738451 5:174027855-174027877 GTGTGTGTTTGTAGGGAAAGGGG + Intergenic
1002089740 5:176797562-176797584 GTGTGCGGGTGTAGGGGAACGGG - Intergenic
1003007949 6:2398773-2398795 GTGTAGGTAAGTAGGGGATGGGG + Intergenic
1003364202 6:5457090-5457112 GTGGACATATGTAGGGGAAAGGG - Intronic
1003864687 6:10352052-10352074 GGGTGTGTGTGTATGGGAAAGGG + Intergenic
1004009058 6:11663909-11663931 GTGTGTGTGTGTAGGGGAGGCGG + Intergenic
1007574954 6:42919335-42919357 TTGTGAGGATGTAGGGGTAAAGG - Intronic
1007909467 6:45499047-45499069 GTGTGGGTATGGAGGAGAGTGGG + Intronic
1008023512 6:46607454-46607476 GTGTGTGTGTGTAGGGGGAAGGG - Intronic
1008157327 6:48032456-48032478 GTGTGTTTATGTAGTGGGAAGGG + Intronic
1008191844 6:48468283-48468305 GTGTGGGGATGGAGGAGAAGTGG + Intergenic
1008321932 6:50125011-50125033 GTGTGGCAATGTGGAGGAAAGGG - Intergenic
1010020839 6:71158232-71158254 GTGTGTGTATGTAGGGGGAGGGG + Intergenic
1010207970 6:73339826-73339848 GTGTGTGTGTGTAGGGGTAGGGG - Intergenic
1010307437 6:74341671-74341693 GTGTGTGTCTGTATGTGAAATGG + Intergenic
1010839365 6:80630007-80630029 GTGGGGGTATAGAGGGGAAGTGG + Intergenic
1011227586 6:85124832-85124854 GTGTGGGTAAGAAGGGCAATGGG + Intergenic
1011614915 6:89189060-89189082 GTGTGTGTGTGTTGGGCAAAGGG + Intronic
1011877639 6:91980806-91980828 TTGTGTGTCTGTATGGGAAAGGG - Intergenic
1011879347 6:92004836-92004858 GTGTGGGTCTGAACAGGAAAGGG - Intergenic
1012324192 6:97894326-97894348 GTGAGGGTAGGCAGGAGAAATGG + Intergenic
1012793417 6:103730332-103730354 GTGTGTGTGTGTAGGGGGAGAGG - Intergenic
1012932300 6:105329900-105329922 GTGTGGAGATGGAGGGGAAATGG + Intronic
1014899834 6:126949292-126949314 GTGTGTGTGTGTAGTGAAAAGGG + Intergenic
1014957382 6:127637655-127637677 GTGTGGGAATGGTGGGGACAGGG + Intergenic
1015275249 6:131377394-131377416 GTGTGTGTTTGTCGGGTAAAGGG + Intergenic
1015280038 6:131423258-131423280 GTGTGTGTGTGTAAGGGAACAGG - Intergenic
1015461463 6:133496476-133496498 GGGTGGTCATGTAGGGGAAATGG - Intronic
1016013380 6:139161044-139161066 GTGTGTGTGTGTCGGGGACAGGG + Intronic
1016329699 6:142944410-142944432 GTGTGGGTGTGTGGGGGAGGGGG - Intronic
1017279051 6:152604188-152604210 GTGTGTGTATGTAGTGGTATTGG + Intronic
1018099051 6:160420336-160420358 GTTTGGGTGAGTAGGGGGAAAGG - Intronic
1018541793 6:164888702-164888724 GTTTGTGTGTGTAGGGGAAAGGG - Intergenic
1018702302 6:166436724-166436746 GGGTGGGTTTGCATGGGAAATGG + Intronic
1020186854 7:5965696-5965718 TTGTAGCTATGAAGGGGAAAAGG - Exonic
1020296062 7:6759078-6759100 TTGTAGCTATGAAGGGGAAAAGG + Exonic
1021865393 7:24951594-24951616 GTGTGTGTGGGTAGGGGGAAGGG - Intronic
1022190784 7:28015055-28015077 GTGTGTGTGTGTAGGGGTAGGGG + Intronic
1022957915 7:35398496-35398518 GTGGGGGTATGTGAGGGGAAGGG - Intergenic
1023244715 7:38189129-38189151 GTGTGTGTGTGTCTGGGAAAAGG + Intronic
1023310628 7:38882724-38882746 ATGTGGGCATGTAAGTGAAAGGG - Intronic
1023321282 7:39000508-39000530 CTGTGGGTATGTTGAGAAAATGG - Intronic
1024248814 7:47490946-47490968 GTGTCGGGAAGTAGAGGAAAGGG + Intronic
1024499734 7:50092339-50092361 GTGGAGGTAGGTAGGGGATAGGG - Intronic
1024594499 7:50920800-50920822 GTGGGGGGATGTGGGGGGAAGGG - Intergenic
1025636558 7:63325036-63325058 GTGCTGGTATTGAGGGGAAAAGG + Intergenic
1025646138 7:63423066-63423088 GTGCTGGTATTGAGGGGAAAAGG - Intergenic
1026846154 7:73700196-73700218 GTGTGCGTCTGTACGGGAAGAGG - Exonic
1028224194 7:88231006-88231028 GGGTGGGTATGTATGGGTGAAGG - Intergenic
1030486064 7:110169316-110169338 GTGTGTGTATGTATTGTAAATGG + Intergenic
1031866117 7:127039959-127039981 GAAGGGGTATGGAGGGGAAAGGG + Intronic
1032308043 7:130755173-130755195 AGGTGGGAATGGAGGGGAAATGG - Intergenic
1032901327 7:136312280-136312302 GTGTGGGTGGGAAGGGGAGAAGG - Intergenic
1033651461 7:143346673-143346695 GTTTGGGGATACAGGGGAAAGGG + Intronic
1034460033 7:151193095-151193117 GTGGGGGAATGAAGGGAAAAGGG - Intronic
1034460783 7:151196852-151196874 GTGTGGGTGTGTAGGCAAAGGGG - Intronic
1034499749 7:151441910-151441932 GTGTGTGTGTGTAGGGGCAGGGG - Intergenic
1034937268 7:155208339-155208361 GTGTGTGTCTGTGGGGGAATGGG + Intergenic
1035474357 7:159131397-159131419 TTCTGGGTAGGTAGAGGAAATGG - Intronic
1035975830 8:4310301-4310323 GGGTGGGTGTGGAAGGGAAAAGG + Intronic
1036711653 8:11083302-11083324 GTATGGGGAGGTAGGGGAACAGG - Intronic
1037329087 8:17726000-17726022 GTGTGTGTATGAAGGGGTAGAGG - Intronic
1038049740 8:23797299-23797321 TTGTGGGTAGATGGGGGAAAAGG + Intergenic
1038328862 8:26591906-26591928 GTGTTGAGTTGTAGGGGAAAGGG + Intronic
1038691192 8:29765035-29765057 CAGTGGGTGTGAAGGGGAAAGGG - Intergenic
1039010805 8:33090751-33090773 GTGTGGGCATGAAGGGATAAGGG + Intergenic
1039143464 8:34419355-34419377 ATGTGTGTGTGTAGGGGAGAGGG + Intergenic
1039149722 8:34490335-34490357 GTGTGTGTGTGTAGCAGAAAGGG + Intergenic
1039352781 8:36780740-36780762 GTGTGTGTGTGTAGTGAAAAGGG - Intergenic
1039435356 8:37556171-37556193 GTGTGGGTGTGGAGGGGAAGGGG - Intergenic
1039857597 8:41429682-41429704 TAGTAGGGATGTAGGGGAAAGGG + Intergenic
1041087386 8:54269324-54269346 GTGTGTGTATGTGTAGGAAATGG + Intergenic
1041330355 8:56717523-56717545 GTGTGTGTATTTAGGGGAGGGGG - Intergenic
1041789896 8:61683191-61683213 GTTTGGGTATTTAGGGGAAGGGG + Intronic
1043226033 8:77731571-77731593 GAGTGAGTATGTAGGGATAAAGG - Intergenic
1043428361 8:80171180-80171202 GTGTGCGTGTGTGGGGGAGAGGG - Intronic
1044462053 8:92457191-92457213 GGGTGGGAAGGGAGGGGAAAAGG + Intergenic
1046619207 8:116510150-116510172 GTGTGTGTATGTGGGAGAGAGGG - Intergenic
1046822362 8:118648401-118648423 GTGTGGGAGTGTAGGGGCTATGG + Intergenic
1047037712 8:120957196-120957218 GTGTCAATATGGAGGGGAAAAGG + Intergenic
1047091133 8:121577069-121577091 GAGTGAGTATGTAGGACAAAAGG + Intergenic
1048377257 8:133833654-133833676 GTGTGGGTATGGAGGGAATTGGG - Intergenic
1048453124 8:134551832-134551854 GTGTCGGTGTGAAAGGGAAATGG - Intronic
1048570783 8:135653987-135654009 CTGTGGGTGTGTGGGGGTAAAGG - Intronic
1049890326 9:63236-63258 GGGTGGGCATGGAGGGGAGAGGG + Intergenic
1050601655 9:7258887-7258909 GTGTGTGTGTTTAGGGGGAAGGG + Intergenic
1050824162 9:9923142-9923164 GTGTGTGTATGTACAGAAAAAGG + Intronic
1050980665 9:12009813-12009835 GTGTGTGTATTTAGTGGAGACGG - Intergenic
1051743561 9:20274306-20274328 ATGTGGTTATGTGGGGGAAGAGG + Intergenic
1052197894 9:25740373-25740395 GTGTGTGTATGGAGTGGAGAGGG + Intergenic
1052349239 9:27441541-27441563 GTGTGGGTATGCTGGACAAAGGG + Intronic
1052491592 9:29176455-29176477 GTGTGCATGTGTAGGGGACAGGG - Intergenic
1052768421 9:32665382-32665404 GTGTGTGTGTGTTGGGGTAAGGG + Intergenic
1053345780 9:37377300-37377322 GTGTGTGTGTGTAGGAGAGAAGG + Intergenic
1053731791 9:41064421-41064443 GGGTGGGCATGGAGGGGAGAGGG + Intergenic
1054696667 9:68367299-68367321 GGGTGGGCATGAAGGGGAGAGGG - Intronic
1055184794 9:73438039-73438061 GTGTGGCTATGTTGGACAAAAGG - Intergenic
1055612133 9:78033401-78033423 GTGTGTGTATGTGTGTGAAACGG - Intergenic
1055666018 9:78553886-78553908 GTGTGTGTATTGAGGGGAATTGG + Intergenic
1055801622 9:80042902-80042924 GTGTGTGCGTGTAGGGGAATGGG - Intergenic
1056205832 9:84318458-84318480 GTATGGGAATGTCAGGGAAAGGG + Intronic
1056291437 9:85147866-85147888 GGGTGGGTGGGTAGGGGAAGAGG - Intergenic
1057130530 9:92651389-92651411 GGGTGGGGATGGAGGAGAAAGGG + Intronic
1057319153 9:93996321-93996343 TGGTGGTTATGAAGGGGAAATGG - Intergenic
1057730412 9:97603387-97603409 GTGTGAGTATGAAGGAGAGAGGG - Intronic
1057846597 9:98530909-98530931 GTGTGTGTATAGAGGGGGAAGGG + Intronic
1057950816 9:99367951-99367973 GTGTGTGTGTGTTGGGGAAGGGG - Intergenic
1058758115 9:108102599-108102621 GTGTGTGTATGTTGGGGAGTAGG + Intergenic
1059130524 9:111743460-111743482 GTGTGGATATGCTGGGCAAAGGG - Intronic
1059541634 9:115136269-115136291 GTGTGTGTATGTTGGGGGGATGG + Intergenic
1059753016 9:117266585-117266607 GTGTAGTTATCTAGGAGAAAAGG - Intronic
1060595749 9:124847639-124847661 ATGTGGGGAAGTAGGGGAGAGGG - Intergenic
1060862801 9:126969233-126969255 GTGTGTGTATGTAAGAGACAAGG + Intronic
1061418195 9:130459430-130459452 GTGTGTGTGTGTGGGGGAGAGGG + Intronic
1062113410 9:134795144-134795166 TTGTGGGCATGTTTGGGAAACGG + Intronic
1062300655 9:135866200-135866222 GTGAGGGTATTTGGGGGAATTGG - Intronic
1062530391 9:136997029-136997051 GTGTGGGTGAGCAGGAGAAATGG + Intergenic
1185451458 X:283079-283101 GTGTGTGTGTGTAGGCGACACGG + Intronic
1186358089 X:8808365-8808387 GTTTGAGTATGTAGGAGAGAGGG + Intergenic
1186461942 X:9754764-9754786 CGGTGGGGATGTGGGGGAAAAGG - Intronic
1188473868 X:30569345-30569367 GTGTGGGTATGTAGGGGAAATGG + Intronic
1189412856 X:40789449-40789471 GAGTGGGGAGGTAGGGGAAAGGG - Intergenic
1189700694 X:43714774-43714796 GTGTGTGTGTGGTGGGGAAATGG + Intronic
1190260720 X:48795241-48795263 GAGTGGGAATGTTGGGGAAGGGG - Intergenic
1190324010 X:49195563-49195585 GTGTGTGTATGTGAGGGAAGAGG + Intronic
1190420817 X:50282495-50282517 CAGTGTGTATGTAGGGGACATGG + Intronic
1192146839 X:68688110-68688132 GTGTATGTATGGAGGGGAAAGGG + Intronic
1192826677 X:74704495-74704517 CTGTGTGTTTGTGGGGGAAATGG - Intergenic
1193407134 X:81115280-81115302 GTGTAAATATTTAGGGGAAATGG - Intronic
1193837167 X:86357990-86358012 GTGTGGGTGTGTACAGGTAATGG + Intronic
1194744296 X:97611552-97611574 GTGTGTGTGTGTGGTGGAAAGGG + Intergenic
1194941222 X:100013400-100013422 GTGTGTATATGAAGGGGAATGGG - Intergenic
1194986590 X:100496423-100496445 GTGTGTGTGTGTAGAGGACAGGG + Intergenic
1195968075 X:110447450-110447472 GTGTGGGGATGTAGGGGAGATGG + Intronic
1196043941 X:111236453-111236475 GGGTGGGGAGGTCGGGGAAATGG - Intergenic
1196160568 X:112478117-112478139 GTGTGTGTGTGAAGGTGAAAAGG + Intergenic
1196772369 X:119307857-119307879 TTGTGCGTATGTAGATGAAAAGG + Intergenic
1197175009 X:123476364-123476386 GTGTGTGTGTGTTGGGGAGAGGG + Intronic
1198435912 X:136616788-136616810 GTGTGGGTATGTGAGGGAGTGGG - Intergenic
1199571091 X:149267992-149268014 GTGTGTGTATGTATGGGTGAGGG + Intergenic
1201427287 Y:13866415-13866437 GTGTGGGAATGAAGGAGACATGG + Intergenic
1201573747 Y:15440220-15440242 GTGGGGATATGTGGGGGCAAAGG + Intergenic