ID: 1188475177

View in Genome Browser
Species Human (GRCh38)
Location X:30584206-30584228
Sequence GTGAACAAAACAAAAAGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188475175_1188475177 26 Left 1188475175 X:30584157-30584179 CCTGGGTGACAGAGCGAGCCTCT 0: 27
1: 6824
2: 48776
3: 129569
4: 163141
Right 1188475177 X:30584206-30584228 GTGAACAAAACAAAAAGTGCTGG No data
1188475176_1188475177 8 Left 1188475176 X:30584175-30584197 CCTCTGTCTCAAAAAAAAAAAGA 0: 10
1: 516
2: 1060
3: 2798
4: 12024
Right 1188475177 X:30584206-30584228 GTGAACAAAACAAAAAGTGCTGG No data
1188475174_1188475177 30 Left 1188475174 X:30584153-30584175 CCAGCCTGGGTGACAGAGCGAGC 0: 117
1: 21458
2: 115212
3: 161100
4: 168140
Right 1188475177 X:30584206-30584228 GTGAACAAAACAAAAAGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188475177 Original CRISPR GTGAACAAAACAAAAAGTGC TGG Intergenic
No off target data available for this crispr