ID: 1188479023 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:30618396-30618418 |
| Sequence | GCTGAGCAGCCACTCTGATT TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1188479023_1188479024 | 0 | Left | 1188479023 | X:30618396-30618418 | CCAAATCAGAGTGGCTGCTCAGC | No data | ||
| Right | 1188479024 | X:30618419-30618441 | AGCATGACGCCAAATCAGAGTGG | No data | ||||
| 1188479023_1188479027 | 28 | Left | 1188479023 | X:30618396-30618418 | CCAAATCAGAGTGGCTGCTCAGC | No data | ||
| Right | 1188479027 | X:30618447-30618469 | CAGCAGCACCATGCTATAGGAGG | No data | ||||
| 1188479023_1188479026 | 25 | Left | 1188479023 | X:30618396-30618418 | CCAAATCAGAGTGGCTGCTCAGC | No data | ||
| Right | 1188479026 | X:30618444-30618466 | GCTCAGCAGCACCATGCTATAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1188479023 | Original CRISPR | GCTGAGCAGCCACTCTGATT TGG (reversed) | Intergenic | ||