ID: 1188479026

View in Genome Browser
Species Human (GRCh38)
Location X:30618444-30618466
Sequence GCTCAGCAGCACCATGCTAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188479023_1188479026 25 Left 1188479023 X:30618396-30618418 CCAAATCAGAGTGGCTGCTCAGC No data
Right 1188479026 X:30618444-30618466 GCTCAGCAGCACCATGCTATAGG No data
1188479025_1188479026 -7 Left 1188479025 X:30618428-30618450 CCAAATCAGAGTGGCTGCTCAGC No data
Right 1188479026 X:30618444-30618466 GCTCAGCAGCACCATGCTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188479026 Original CRISPR GCTCAGCAGCACCATGCTAT AGG Intergenic
No off target data available for this crispr