ID: 1188479029 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:30618468-30618490 |
| Sequence | GGTTCATCCTACAGATCCCC TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1188479025_1188479029 | 17 | Left | 1188479025 | X:30618428-30618450 | CCAAATCAGAGTGGCTGCTCAGC | No data | ||
| Right | 1188479029 | X:30618468-30618490 | GGTTCATCCTACAGATCCCCTGG | No data | ||||
| 1188479028_1188479029 | -10 | Left | 1188479028 | X:30618455-30618477 | CCATGCTATAGGAGGTTCATCCT | No data | ||
| Right | 1188479029 | X:30618468-30618490 | GGTTCATCCTACAGATCCCCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1188479029 | Original CRISPR | GGTTCATCCTACAGATCCCC TGG | Intergenic | ||