ID: 1188480328

View in Genome Browser
Species Human (GRCh38)
Location X:30630585-30630607
Sequence CATGAAAGCCGCCATGGCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 1, 1: 3, 2: 2, 3: 18, 4: 229}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188480321_1188480328 12 Left 1188480321 X:30630550-30630572 CCAGCTGAAGATGAGTGGGGTAA No data
Right 1188480328 X:30630585-30630607 CATGAAAGCCGCCATGGCCCCGG 0: 1
1: 3
2: 2
3: 18
4: 229
1188480317_1188480328 28 Left 1188480317 X:30630534-30630556 CCAGGACATCAAGAAGCCAGCTG No data
Right 1188480328 X:30630585-30630607 CATGAAAGCCGCCATGGCCCCGG 0: 1
1: 3
2: 2
3: 18
4: 229

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188480328 Original CRISPR CATGAAAGCCGCCATGGCCC CGG Intergenic
900256075 1:1698900-1698922 CTTGAAGTCCGCCATGACCCTGG - Intronic
900264743 1:1751510-1751532 CTTGAAGTCCGCCATGACCCTGG - Exonic
900543187 1:3214334-3214356 CTTAAAAGCCGCCATCGCCCTGG - Intronic
900626625 1:3611525-3611547 CTGGAAAGCCGCCACGCCCCCGG + Intergenic
901343066 1:8512805-8512827 CATGGAAGCCACCATGGCTCTGG + Intronic
903499920 1:23795183-23795205 CATGAATGTGGCCATGGCCCCGG + Exonic
904415948 1:30361366-30361388 CAAGAAAGTCCCCAGGGCCCAGG + Intergenic
904520904 1:31094992-31095014 CATCAAAGCTGCCTTGGCTCAGG - Intergenic
905356285 1:37387331-37387353 CATGAAAGGGGCCATGGCTTTGG + Intergenic
906284009 1:44574041-44574063 CATGACAGCCTCCATCTCCCTGG - Intronic
906678829 1:47711327-47711349 GATTAAAGCAGCCATGGCGCTGG - Intergenic
907508805 1:54943307-54943329 CATGAAAGCTGCCAAGGCTTGGG - Intergenic
908746849 1:67384290-67384312 CATGGAAGCTGCCAAGGCCTGGG + Intronic
908919264 1:69170196-69170218 CATGAAAGCTGCCAAGGCCTGGG - Intergenic
912136173 1:106662590-106662612 CATGAAAGCCACCAAGGCTTGGG - Intergenic
912499633 1:110113373-110113395 GCTGAAAGCAGCCCTGGCCCAGG + Exonic
914905110 1:151737555-151737577 CATGAAAGCCACCAAAGCCTAGG - Intergenic
915215074 1:154334887-154334909 CATGAAGGCCTCCTTGTCCCTGG - Intronic
917517770 1:175722162-175722184 AATGAAACCCTCCATGGCCAGGG - Intronic
920729284 1:208467722-208467744 CATGAAAGGGACCATGGGCCTGG - Intergenic
922900771 1:229134880-229134902 CATGAAAGCTGCCAAGGCTTGGG - Intergenic
1065226062 10:23545097-23545119 CATGGAAGCTGCCAAGGCCTGGG - Intergenic
1066780830 10:38943021-38943043 TATGCAAGCCGCAGTGGCCCAGG - Intergenic
1068431810 10:56942724-56942746 CATGAAAACTGACATGACCCAGG - Intergenic
1070814551 10:79314448-79314470 TAGGAAAGCTGCCATTGCCCCGG + Exonic
1070854485 10:79595460-79595482 CATGTATGCCTACATGGCCCTGG - Intergenic
1071981032 10:91004458-91004480 CATGAAAGCTGCCAAGGCTTGGG + Intergenic
1073864583 10:107787244-107787266 CATGAAAGCTGCCAAGGCTTGGG - Intergenic
1074622352 10:115138527-115138549 CATGGAAGCTGCCAAGGCCTGGG + Intronic
1074786965 10:116849831-116849853 CATGCCAGCCGCCCGGGCCCTGG + Intronic
1076388807 10:130080576-130080598 CATGGAGGCCACCCTGGCCCAGG + Intergenic
1076733938 10:132450525-132450547 CAGGGCAGCAGCCATGGCCCAGG - Intergenic
1078379661 11:10828915-10828937 CATGAAAGCAGCCAGGGCGGGGG - Intronic
1080973330 11:37304179-37304201 CATGAAAGCTCCCATGGCCTGGG + Intergenic
1081224319 11:40501543-40501565 CATGAAAGCTGCCAAGGCTTGGG + Intronic
1081400345 11:42635954-42635976 CATGGAAGCTGCCAAGGCCTGGG - Intergenic
1084423527 11:69072152-69072174 CATGGAAACCACCATGTCCCTGG + Intronic
1084694592 11:70746019-70746041 CATGAAAGCCCCCAGGCCCTGGG - Intronic
1085031733 11:73275250-73275272 CATGAAAACCGGCACTGCCCTGG - Intronic
1085698697 11:78727716-78727738 CATGACAGCCTCCCTGCCCCTGG + Intronic
1086287959 11:85271226-85271248 CATGAAAGCAGCCAAGGCTTGGG - Intronic
1086750709 11:90490189-90490211 CATGGAAGCTGCCAAGGCCTGGG - Intergenic
1087675613 11:101158176-101158198 CATGTAAGCCGCCAAGGCTAGGG - Intergenic
1089050194 11:115539083-115539105 CATGGGAGCCGCCACGGCCTTGG - Intergenic
1095544151 12:43345106-43345128 CATGAAAGCTGCCAAGGCTTTGG + Intergenic
1095836808 12:46648221-46648243 CATGTAAGCCACCAAGGCCTTGG + Intergenic
1100678449 12:96893428-96893450 CATGAAAGCTGCCAAGGCTTGGG - Intergenic
1101115723 12:101529577-101529599 CATGCAAGGCCCCATGGCCAAGG - Intergenic
1101516395 12:105439474-105439496 CATGAAATCTGCCAAGGCCTGGG + Intergenic
1103588423 12:121973221-121973243 CATGAAAGCTGCCAAGGCTTGGG - Intronic
1106631543 13:31479464-31479486 CATGAAAGCTGCCAAGGCTTGGG + Intergenic
1110443071 13:75547110-75547132 CATGAAAGCCTCCTTGGGCTTGG + Intronic
1111186305 13:84740640-84740662 CATGAAATCCTCCCTGGCCAAGG - Intergenic
1111339266 13:86862535-86862557 CATGAAAGCTGCCATGGCTTAGG - Intergenic
1111431694 13:88153757-88153779 AATGAAAGCCGCTTTAGCCCTGG + Intergenic
1112272989 13:97987165-97987187 CATGGAAGCTGTCATGGCCCTGG - Intronic
1112861528 13:103833698-103833720 CATGAAAGCTGCCAAGGCATGGG - Intergenic
1113269337 13:108655661-108655683 CATGAAAGCAGCCAGGAGCCGGG + Intronic
1113598177 13:111548904-111548926 CATGAAAGTCACTGTGGCCCTGG + Intergenic
1113675728 13:112206028-112206050 TAAGAATGCAGCCATGGCCCTGG + Intergenic
1118524287 14:66622184-66622206 CATGAAAGCTGCCAAGGCCTGGG + Intronic
1118780443 14:69004345-69004367 AAGGACAGCAGCCATGGCCCAGG - Intergenic
1120083083 14:80237204-80237226 CATGAAAGCTGCCAAGGCTTGGG + Intronic
1120132553 14:80824070-80824092 CATGGAAGCTGCCAAGGCCTGGG + Intronic
1120346105 14:83292326-83292348 CAGGGAAGCCACCATGTCCCTGG + Intergenic
1122858741 14:104572589-104572611 CAGGCCAGCTGCCATGGCCCAGG + Intronic
1124556077 15:30727162-30727184 CATGAAAGCTGCCAAGGCTTGGG + Intronic
1124675196 15:31678608-31678630 CATGAAAGCTGCCAAGGCTTGGG - Intronic
1126399831 15:48257577-48257599 CATGAAAGCTGCCAAGGCTTGGG + Intronic
1128232687 15:66046611-66046633 CAAGGAAGCCCCCTTGGCCCCGG - Intronic
1132365715 15:101254822-101254844 CATGAAAGTCCCAATGGCACAGG + Intergenic
1132833003 16:1938631-1938653 CCTGCCAGCCGCCCTGGCCCTGG - Exonic
1135119744 16:19755558-19755580 AATGAAAGGAGCCATGGCCAAGG + Intronic
1137538099 16:49342593-49342615 CCTGATGGCTGCCATGGCCCGGG - Intergenic
1139033279 16:62911574-62911596 CATGAAAGCCACCAAGGCTTGGG + Intergenic
1139852949 16:69961783-69961805 GCTGGCAGCCGCCATGGCCCAGG - Intronic
1139881920 16:70184691-70184713 GCTGGCAGCCGCCATGGCCCAGG - Intronic
1140370591 16:74410815-74410837 GCTGGCAGCCGCCATGGCCCAGG + Intronic
1141455631 16:84139862-84139884 AATGAAAACAGCCATCGCCCTGG - Intronic
1142471239 17:164403-164425 CATGACAGCTGCCCTGGGCCAGG - Intronic
1143373026 17:6452002-6452024 CATGAAAGACTCCAGGGCACAGG + Exonic
1144605196 17:16658548-16658570 CATGGAAGCCGCCAAGGCTTGGG + Intergenic
1147688960 17:42303931-42303953 CATGCAAGCCCCGTTGGCCCTGG - Intronic
1147834419 17:43319833-43319855 CATGAAAGCTGCCAAGGCCTAGG + Intergenic
1149029494 17:52067317-52067339 CATGTAAGCCACCAAGGCCTGGG - Intronic
1149362650 17:55911186-55911208 CATGAGCTCCCCCATGGCCCTGG + Intergenic
1150147262 17:62779373-62779395 CATGAAAGCAGCCACGGCTTAGG - Intronic
1151504306 17:74516520-74516542 AAAGAAAGTTGCCATGGCCCTGG + Intergenic
1151914174 17:77105259-77105281 CAAGACAGTCACCATGGCCCTGG - Intronic
1152400575 17:80064197-80064219 CATGAGAGAGGCCATCGCCCTGG - Intronic
1152687421 17:81701477-81701499 GAGGAAAGCAGGCATGGCCCTGG - Intronic
1153122109 18:1741062-1741084 CATGAAAGCCAAGATGGCACTGG - Intergenic
1153974055 18:10251308-10251330 GATAAAAGCCACCATGGGCCGGG + Intergenic
1155632141 18:27906259-27906281 CATGAAAGCTGCCAAGGCTTGGG + Intergenic
1155762386 18:29584212-29584234 CATGCAAGATGCCATGGCCAAGG - Intergenic
1156322332 18:36038388-36038410 CATGGAAGCCGCCAAGGCTTGGG - Intronic
1157332605 18:46714575-46714597 CAGGAAAGCAGACAAGGCCCAGG + Intronic
1158259091 18:55588072-55588094 CATGAACGCCGCCTCGGCGCCGG - Intronic
1158720118 18:59917303-59917325 CATCAAAACTGCCATTGCCCTGG + Intergenic
1158791397 18:60784523-60784545 CATGTAAGCTGCCATGGCCTGGG - Intergenic
1159606252 18:70478238-70478260 CATGGAAGCTGCCAAGGCCTGGG - Intergenic
1160244070 18:77143353-77143375 CATGAAAGCTGCCAAGGCTTGGG - Intergenic
1160591162 18:79945405-79945427 CAGGTCAGCAGCCATGGCCCAGG + Intronic
1161364690 19:3871591-3871613 CATGGAAGCCGCCATGGCCCCGG + Intergenic
1162377908 19:10315975-10315997 CATGGCCGCCTCCATGGCCCGGG - Exonic
1163144795 19:15373123-15373145 CCTGGAAGCGGCCCTGGCCCCGG + Exonic
1166585014 19:43937925-43937947 AATGCAAGCGTCCATGGCCCAGG - Intergenic
1167133919 19:47605718-47605740 AAAAAAAGCCTCCATGGCCCAGG - Intergenic
1167163332 19:47781343-47781365 CATCAAAGCCGCCTTGGCTCAGG + Exonic
1167313465 19:48750915-48750937 CATGCATGCCGCCCTGGCCCCGG - Exonic
1167349614 19:48966319-48966341 CATGAAAGCTGCCATGGCCCTGG + Exonic
1167877499 19:52426538-52426560 CCTGAAAGGCGGCCTGGCCCAGG + Intergenic
925130767 2:1492672-1492694 CATGAAAGCCTCACTGTCCCTGG + Intronic
927658490 2:24971890-24971912 CATGTTGGCCTCCATGGCCCTGG + Exonic
927872462 2:26632258-26632280 CATGACTGCCGCCTTGGCCACGG + Intronic
928048872 2:27968317-27968339 CATGGAAGCTGCCAAGGCTCGGG - Intronic
928812729 2:35248594-35248616 CATGTAAGCCACCAAGGCTCAGG + Intergenic
929612815 2:43284441-43284463 CATGAAAGCCACCAAGGCTTGGG - Intronic
930503709 2:52255789-52255811 CATGAAAGCTGCCAAGGCTTGGG + Intergenic
931176731 2:59861756-59861778 CATGAAAGCTGCCAAGGCTTGGG + Intergenic
933900164 2:86844074-86844096 CAGGAATGCTGCCCTGGCCCAGG + Intronic
935780392 2:106505149-106505171 CAGGAATGCTGCCCTGGCCCAGG - Intergenic
937053101 2:118908174-118908196 CAGAGAAGCCCCCATGGCCCAGG - Intergenic
939667101 2:144965503-144965525 CATGAAAGCCGCCAAGACTTGGG - Intergenic
939830412 2:147064357-147064379 CATGAAAGCTGCCAAGGCTGTGG - Intergenic
939847800 2:147268991-147269013 CATGGAAGCTGCCAAGGCCTGGG + Intergenic
940249815 2:151662875-151662897 AATGAAAGCAGCCATGGCACAGG - Intronic
940691330 2:156924096-156924118 CATGAAAGCTGCCAAGGCTTGGG - Intergenic
943193981 2:184719130-184719152 CATGAAAGCTGCCAAGGCTTGGG + Intronic
945357855 2:208860337-208860359 CATGAAAGCTGCCAAGGCTTGGG - Intergenic
946400204 2:219464627-219464649 CATGAATGCCCACCTGGCCCTGG + Intronic
946976868 2:225163001-225163023 CAAGAATGCTGTCATGGCCCAGG - Intergenic
948757388 2:240167498-240167520 CATGGAGGCCGCCACTGCCCAGG - Intergenic
948773179 2:240262860-240262882 CATGGAAGCCACCAAGGCCTGGG - Intergenic
1169245888 20:4024204-4024226 CATGAAAGCTGCCATGGCCCTGG + Intergenic
1170078994 20:12450712-12450734 CATGAAAGCTGCCAAGGCTTGGG - Intergenic
1172230638 20:33333482-33333504 CATGAAAGCCTCCATGGTTTGGG - Intergenic
1172692598 20:36800488-36800510 CAGGAAAGTGGGCATGGCCCAGG + Intronic
1173603282 20:44311053-44311075 CATGGAGGCCACCAGGGCCCAGG + Exonic
1173814341 20:45975466-45975488 CACGGAAGCCGCCATGGCCCTGG - Intergenic
1174077735 20:47950186-47950208 CAGGAGAGCTGACATGGCCCAGG - Intergenic
1175694306 20:61089916-61089938 CATGAGAGCCAGCATGGCCTGGG - Intergenic
1175823667 20:61925049-61925071 CATGAGACCCTCCAGGGCCCTGG + Intronic
1178338604 21:31766212-31766234 CATGGAAGCTGCCAAGGACCAGG - Intergenic
1179192757 21:39137243-39137265 CATGAAAACCCTCATGGCCTCGG + Intergenic
1179727715 21:43349571-43349593 CATGAAGGCCACCAGGGCCATGG - Intergenic
1182795032 22:32985671-32985693 CATGAAGGACGCCAGGGCTCTGG - Intronic
949769627 3:7565533-7565555 CATGAAAGCCACTGTGGGCCAGG + Intronic
951261474 3:20514617-20514639 CATGAAATCTGCCAGTGCCCCGG - Intergenic
951550813 3:23873388-23873410 GATGAGAGACCCCATGGCCCTGG + Intronic
952918866 3:38270829-38270851 CCTGAGTGCCGCCATGCCCCAGG - Intronic
953845392 3:46422448-46422470 CCTGAGAGCCGCCATGGCAGTGG + Intergenic
956246289 3:67186733-67186755 CATGTAAGCCTCCAAGGCTCGGG + Intergenic
958160847 3:89815440-89815462 CATGAAAGCTGCCAAGGCTTGGG + Intergenic
958864714 3:99486695-99486717 CAGGACAGCCTCCATAGCCCAGG + Intergenic
959031832 3:101308461-101308483 CATGTAAGCTGCCAAGGCCTGGG + Intronic
959091776 3:101911093-101911115 CAGGAAAGCCCCCATCTCCCTGG - Intergenic
959113809 3:102152250-102152272 CATGAAAGCTGCCAAGGCTTGGG + Intronic
959679265 3:109074224-109074246 CCTGAAATCCGCCATGGCTCGGG - Intronic
959973408 3:112431970-112431992 CATGGAAGCCGCCAAGGCTTGGG - Intergenic
961795328 3:129404720-129404742 CAACAAAGCCCCCAAGGCCCCGG + Intronic
963421056 3:145061464-145061486 CATGGAAGCTGCCAAGGCCTAGG + Intergenic
964426722 3:156561740-156561762 CATGAAAGCTGCCAAGGCCTGGG - Intergenic
964836157 3:160940585-160940607 CATGAAAGCTGCCAAGGCTTGGG - Intronic
965189189 3:165506486-165506508 CATGAAAGCCTCCAAGGCTTGGG + Intergenic
965897444 3:173594832-173594854 CATGAAAGCTGCCAAGGCTTGGG + Intronic
968842707 4:3019733-3019755 CATCAAAGCCGGGATTGCCCAGG - Exonic
969317948 4:6393548-6393570 TACGAATGCCCCCATGGCCCCGG + Intronic
970473530 4:16400091-16400113 CATGAAAACCCCAAAGGCCCAGG + Intergenic
971831854 4:31704965-31704987 CATGGAAGCTGCCAAGGCCTGGG + Intergenic
972727400 4:41757110-41757132 CAAGAAAGCTGCCTTGGTCCTGG + Intergenic
973008675 4:45044804-45044826 CATGAAATGGGCCATGTCCCTGG + Intergenic
973182937 4:47291232-47291254 CATGGAAGCTGCCAAGGCCTGGG - Intronic
974171259 4:58270065-58270087 CATGGAAGCTGCCAAGGCCTGGG - Intergenic
974724166 4:65777601-65777623 CATGAAAGCTGCCAAGGCTCAGG - Intergenic
974846032 4:67351901-67351923 CATGAAAGCTGCCAAGGCTTGGG + Intergenic
976128045 4:81854450-81854472 CATGGAAGCTGCCAAGGCTCAGG + Intronic
977670112 4:99685469-99685491 CATGGAAGCTGCCAAGGCCTGGG - Intergenic
978991238 4:115084677-115084699 CATGAAAGCCACCAAGGCTTGGG - Intronic
979132043 4:117059380-117059402 CATGTAAGTCCCCATGGCCAGGG - Intergenic
980538394 4:134160194-134160216 CACCACAGCCGACATGGCCCTGG - Intergenic
982299879 4:153867710-153867732 CATAAAAGCCGCCAAGGCTTGGG - Intergenic
982524980 4:156466872-156466894 CATGAAAGCCACCAAGGCTTGGG + Intergenic
982868215 4:160544136-160544158 CATGGAAGCTGCCATGGCTTGGG + Intergenic
985135156 4:186778765-186778787 CATGGAAGCTGCCAAGGCTCGGG - Intergenic
986196362 5:5539846-5539868 CATGACAGCCTCCTTGTCCCCGG - Intergenic
991122534 5:63032644-63032666 CATGGAAGCAGCCAAGGCCTGGG - Intergenic
993451332 5:88074677-88074699 CATGAAAGCAGCCAGGACCAGGG + Intergenic
995212048 5:109551575-109551597 CATGGAAGCTGCCATGGCTTGGG - Intergenic
995393174 5:111661236-111661258 CATGGAAGCTGCCATGGCTTGGG + Intergenic
997086462 5:130806081-130806103 CATGAAAGCTGCCAAGGCTTGGG - Intergenic
998151274 5:139758894-139758916 CAGGAAAGCTGCCTTCGCCCAGG + Intergenic
998405851 5:141874390-141874412 CAGGAAGGCAGCCAGGGCCCGGG - Intronic
1005303757 6:24494989-24495011 AATGCAGGTCGCCATGGCCCGGG - Exonic
1006327445 6:33365072-33365094 CATGAACGTGGCCATGGCCCCGG - Intergenic
1007185906 6:39972202-39972224 CATGGAAGCCGCCAAGGCTTGGG - Intergenic
1008869496 6:56255798-56255820 CAAGAAAGCCGCAATGTACCTGG + Intronic
1010324099 6:74544962-74544984 CATGGAAGCTGCCAAGGCTCGGG + Intergenic
1011349016 6:86402037-86402059 CATGAAAGCTGCCAAGGCTTGGG + Intergenic
1011918992 6:92547613-92547635 CATGAAAGCTGCCAAGGCTTTGG - Intergenic
1012732482 6:102900075-102900097 CATGGAAGCCACCAAGGCCTGGG + Intergenic
1018266103 6:162025882-162025904 CATTAAACACACCATGGCCCGGG - Intronic
1019299300 7:295522-295544 CCAGAAAGCCGCCGTGGCCTGGG - Intergenic
1019533352 7:1514670-1514692 CCTGAACTCCGCCATGGGCCTGG - Intergenic
1021762257 7:23913384-23913406 CATGGAAGCTGCCAAGGCCTGGG - Intergenic
1023324936 7:39043910-39043932 CATGAAGGCTGCCATACCCCAGG + Intronic
1023831136 7:44039604-44039626 CATCCAAGCCTCCTTGGCCCTGG + Intergenic
1024424762 7:49212691-49212713 CATGAAAGCTGCCAAGGCTTGGG + Intergenic
1028172359 7:87613754-87613776 TATGAAAGATCCCATGGCCCAGG - Intronic
1029741464 7:102493910-102493932 CATCCAAGCCTCCTTGGCCCTGG + Exonic
1029759456 7:102593079-102593101 CATCCAAGCCTCCTTGGCCCTGG + Exonic
1029776823 7:102688989-102689011 CATCCAAGCCTCCTTGGCCCTGG + Intergenic
1029914884 7:104198968-104198990 CATGTAAGCCGCCAAGGCTTGGG - Intronic
1031711577 7:125053247-125053269 CATGGGAGCCGCGATGGCTCAGG - Intergenic
1031914127 7:127546381-127546403 CATGGAAGCCACCATGGCTTGGG + Intergenic
1033629955 7:143147884-143147906 CAAGAGAGGGGCCATGGCCCTGG + Intergenic
1033823912 7:145166044-145166066 CGTGAAAGGCGCCCTGGACCTGG + Intergenic
1034281770 7:149859563-149859585 CATCATAGCCGCCTGGGCCCTGG - Intronic
1038110899 8:24496175-24496197 CATGAAGGCTGCCAAGGCCTGGG - Intronic
1042412505 8:68481197-68481219 CATGAAAGCTGCCAAGGCTTGGG - Intronic
1042646087 8:70987931-70987953 CATGGAAGCTGCCAAGGCCTGGG + Intergenic
1045422164 8:102026917-102026939 CATGAAAGCTGCCAAGGCCTGGG + Intronic
1046525900 8:115381829-115381851 CCTGATAGCCGCTATGGCCTGGG - Intergenic
1047060468 8:121219407-121219429 CATGAAAGCCACCAAGGCTTGGG + Intergenic
1047176074 8:122541699-122541721 AAGAAAAGCTGCCATGGCCCAGG + Intergenic
1048668355 8:136689608-136689630 CATGAAAGCTGCCAAGGCTTGGG + Intergenic
1049217155 8:141413431-141413453 CATGAAGCCTGCCCTGGCCCTGG - Intronic
1049582014 8:143417071-143417093 CATGGAGGCCGCAAGGGCCCAGG + Intergenic
1050255608 9:3789351-3789373 CATGGAAGCTGCCAAGGCCTGGG - Intergenic
1052124252 9:24755887-24755909 CATGAAAGCTGCCAAGGCTTGGG - Intergenic
1055264113 9:74475861-74475883 CATGAAAGCTGCCAAGGCTTTGG - Intergenic
1057933602 9:99218020-99218042 CTTAAAAGCCACCATGGGCCTGG - Exonic
1061288020 9:129635284-129635306 CATCAAAGACAACATGGCCCAGG + Exonic
1186897786 X:14021615-14021637 CATGAAATCAGGCATGGTCCTGG - Intronic
1187054701 X:15731639-15731661 CATAAAACCCCTCATGGCCCTGG - Intronic
1187070126 X:15879646-15879668 CATGGAAGCTGCCAAGGCTCGGG + Intergenic
1188106807 X:26156375-26156397 CATGGAAGCTGCCAAGGCCTGGG + Intergenic
1188480328 X:30630585-30630607 CATGAAAGCCGCCATGGCCCCGG + Intergenic
1188997596 X:36904873-36904895 CATGGAAGCTGCCAAGGCCTGGG - Intergenic
1189129624 X:38484961-38484983 CATGGAAGCCGCCCTGGCCCTGG - Intronic
1190485096 X:50916177-50916199 CATGAACTCCTCCATGCCCCTGG - Exonic
1190834316 X:54086456-54086478 CATGAAAGCAGTCATAGGCCAGG + Intronic
1192378300 X:70587475-70587497 CATGAAAGCCACCAAGGCTTGGG - Intronic
1192742426 X:73906083-73906105 CATGGAAGCTGCCAAGGCCTGGG - Intergenic
1194505616 X:94730121-94730143 CATGGAAGCCACCAAGGCCTGGG + Intergenic
1194756355 X:97743645-97743667 CATGAAAGCAGCCAGGGAGCAGG + Intergenic
1195545227 X:106106134-106106156 CATGGAAGCTGCCAAGGCCTGGG - Intergenic
1197160577 X:123318033-123318055 CATGGAAGCCGCCAAGGCTTGGG + Intronic
1199106571 X:143875750-143875772 CATGAAAGCTGCCAAGGCTTGGG - Intergenic
1199185485 X:144910717-144910739 CATGGAAGCTGCCATGGCTTGGG + Intergenic
1199373765 X:147083408-147083430 CATGGAAGCAGCCAAGGCCTGGG - Intergenic
1199476727 X:148254521-148254543 CATGGAAGCCACCATGGCTTGGG - Intergenic
1199931843 X:152531002-152531024 CATGAAAGCCACCAAGGCTTGGG + Intergenic