ID: 1188481208

View in Genome Browser
Species Human (GRCh38)
Location X:30638681-30638703
Sequence CTCCTAATACAGTCAGGCTA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188481202_1188481208 25 Left 1188481202 X:30638633-30638655 CCTATGTGGACTTCTCCTAAATG No data
Right 1188481208 X:30638681-30638703 CTCCTAATACAGTCAGGCTACGG No data
1188481204_1188481208 10 Left 1188481204 X:30638648-30638670 CCTAAATGCTCGGACAGAGCTCC No data
Right 1188481208 X:30638681-30638703 CTCCTAATACAGTCAGGCTACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188481208 Original CRISPR CTCCTAATACAGTCAGGCTA CGG Intergenic
No off target data available for this crispr