ID: 1188481396

View in Genome Browser
Species Human (GRCh38)
Location X:30640175-30640197
Sequence ACACTGCCATGGTCTCATCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188481390_1188481396 7 Left 1188481390 X:30640145-30640167 CCCTAATTCTTCAGCCCTACCTT No data
Right 1188481396 X:30640175-30640197 ACACTGCCATGGTCTCATCATGG No data
1188481392_1188481396 -7 Left 1188481392 X:30640159-30640181 CCCTACCTTCATGCAGACACTGC No data
Right 1188481396 X:30640175-30640197 ACACTGCCATGGTCTCATCATGG No data
1188481391_1188481396 6 Left 1188481391 X:30640146-30640168 CCTAATTCTTCAGCCCTACCTTC No data
Right 1188481396 X:30640175-30640197 ACACTGCCATGGTCTCATCATGG No data
1188481393_1188481396 -8 Left 1188481393 X:30640160-30640182 CCTACCTTCATGCAGACACTGCC No data
Right 1188481396 X:30640175-30640197 ACACTGCCATGGTCTCATCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188481396 Original CRISPR ACACTGCCATGGTCTCATCA TGG Intergenic