ID: 1188483984

View in Genome Browser
Species Human (GRCh38)
Location X:30662491-30662513
Sequence CACAGAAAACAGAAGGATTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 684
Summary {0: 1, 1: 0, 2: 4, 3: 55, 4: 624}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188483984_1188483989 17 Left 1188483984 X:30662491-30662513 CCAAAATCCTTCTGTTTTCTGTG 0: 1
1: 0
2: 4
3: 55
4: 624
Right 1188483989 X:30662531-30662553 TGAATTCATTTTTAGCATAAGGG 0: 1
1: 0
2: 1
3: 29
4: 374
1188483984_1188483988 16 Left 1188483984 X:30662491-30662513 CCAAAATCCTTCTGTTTTCTGTG 0: 1
1: 0
2: 4
3: 55
4: 624
Right 1188483988 X:30662530-30662552 ATGAATTCATTTTTAGCATAAGG 0: 1
1: 0
2: 0
3: 39
4: 467

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188483984 Original CRISPR CACAGAAAACAGAAGGATTT TGG (reversed) Intronic
902211026 1:14904704-14904726 CACAGAGAAGAGCAGGCTTTGGG - Intronic
902442788 1:16441895-16441917 GACAGAAAACAAATGTATTTTGG - Intronic
902606669 1:17572997-17573019 CAAGGGAAACAGTAGGATTTGGG - Intronic
902956668 1:19929381-19929403 CAAAGAAGAGAAAAGGATTTTGG - Intergenic
903471177 1:23588458-23588480 CATAGAAAAAACATGGATTTGGG - Intronic
904860005 1:33529580-33529602 CACATAAAAAAGAATGAGTTTGG + Intronic
905577452 1:39056992-39057014 CACAGAAAAAGGAAATATTTAGG + Intergenic
906808188 1:48800748-48800770 CTCATGAAACAGAATGATTTTGG - Intronic
906994342 1:50774873-50774895 AACAGAATTCAGAAGGTTTTGGG + Intronic
908126815 1:61040339-61040361 CTCAGAGACCAGAGGGATTTAGG + Intronic
908781648 1:67696244-67696266 CCCAGAAAACACAAGGATAGTGG - Intergenic
908827243 1:68145665-68145687 CACAGAAAACACCAAGATTTAGG + Intronic
909121865 1:71613338-71613360 GACAGTAAATAGAAGAATTTTGG + Intronic
909357592 1:74727087-74727109 CTCAGAAGACAGGAAGATTTGGG - Intronic
909549062 1:76878042-76878064 GACAGAAGACAGATGGATCTTGG - Intronic
909580031 1:77223121-77223143 CTCAGAAGACAGAAAGATGTAGG - Intergenic
910417258 1:87014025-87014047 CTCAGAAGACAGAAAGATGTGGG - Intronic
910831105 1:91463457-91463479 CACAGAAACCCCTAGGATTTTGG - Intergenic
910899498 1:92104757-92104779 CACAGAAAACAGAAGTTTCAAGG - Intronic
910956534 1:92712244-92712266 CAGAGAAGACACAAGGAATTAGG + Intronic
911151972 1:94605009-94605031 TAAAGAGAACAGAAGCATTTGGG + Intergenic
911257435 1:95648240-95648262 TGCAGAAGACAGAAGGATCTTGG - Intergenic
911372900 1:97015345-97015367 CACAGGAGACTGAAGTATTTAGG + Intergenic
911882621 1:103261019-103261041 CACAGAAACCTTAAGGAATTGGG + Intergenic
912147455 1:106810622-106810644 CTCAGAAGACAGGAGGATGTGGG - Intergenic
912426635 1:109598863-109598885 CACAGATTCCAGAAGGATTTCGG - Exonic
913404025 1:118468324-118468346 AACAGAAAACACAGAGATTTGGG - Intergenic
915410149 1:155694650-155694672 CAAAGAAGAGAAAAGGATTTTGG - Intronic
915794363 1:158712287-158712309 TAGAGAAAACAGAAGAAATTTGG - Intergenic
916542134 1:165767226-165767248 CACAGAATACAGAAAGTTGTAGG + Intronic
917749531 1:178041516-178041538 CAGAGAAAGAAGAAAGATTTGGG - Intergenic
918309472 1:183275490-183275512 CAGAGGCAGCAGAAGGATTTGGG - Intronic
918424699 1:184396368-184396390 GACAGACAGAAGAAGGATTTAGG + Intronic
919718244 1:200802972-200802994 CAATGAAAAGAAAAGGATTTGGG - Intronic
919720038 1:200824043-200824065 CTCAAAAAACAAAAGGATTGGGG - Intronic
920200845 1:204258953-204258975 CCCAGAACACAGCAGGCTTTGGG - Intronic
921531162 1:216284725-216284747 CTCAGAAGACAGAAAGATGTGGG + Intronic
923164224 1:231343962-231343984 CATGGAAAACAGAGGTATTTTGG + Intronic
923872534 1:238011467-238011489 CACAGAAAGCAGAAGAAATCTGG - Intergenic
924561565 1:245160489-245160511 CACAGATATCAGAATGATCTAGG - Intronic
1062780578 10:201933-201955 AAGAGAAAACAGAACAATTTGGG - Intronic
1063041910 10:2350050-2350072 CACATAAAATAGATGGCTTTAGG + Intergenic
1063231111 10:4066591-4066613 CAGAGAGAACAGAACGTTTTGGG + Intergenic
1063759831 10:9061029-9061051 CACAGAAAAGATAAGTGTTTTGG + Intergenic
1063803133 10:9604379-9604401 GACAAAAAACGGAAGGCTTTGGG - Intergenic
1065395547 10:25232974-25232996 CATTGAAAACAGAAGGATTAAGG + Intronic
1065811146 10:29444909-29444931 CACAGAAAAATGAAGTAATTTGG - Intergenic
1066071705 10:31822193-31822215 CAAAGAAAACAGAATTATTGTGG + Intronic
1066141735 10:32510263-32510285 CACAGAAAGCAAAATAATTTAGG + Intronic
1066292105 10:34023607-34023629 CATTTAAAACAGAAAGATTTGGG - Intergenic
1066321644 10:34308814-34308836 AAGAGAAAACAAAAGGACTTCGG + Intronic
1066343020 10:34554987-34555009 CACAGAACACAGAGGATTTTAGG + Intronic
1067309681 10:45101188-45101210 CACTGAAGCCAGAAGGATTGAGG - Intergenic
1067518879 10:46979634-46979656 CACAAAAAAGAGATGGAATTTGG + Intronic
1067643368 10:48072200-48072222 CACAAAAAAGAGATGGAATTTGG - Intergenic
1069180602 10:65353873-65353895 AACAAAAAACAGAAATATTTAGG - Intergenic
1069493365 10:68880654-68880676 AACAAAAAACAGTAGGAATTAGG - Intronic
1069649168 10:70031083-70031105 GACAGAAAACAGGAGGAAGTAGG + Intergenic
1069884484 10:71615257-71615279 CACAGAGACCAGAAGGAGATTGG + Intronic
1070238046 10:74651007-74651029 CAGAGAAAACAGAAGCCATTAGG - Intronic
1070472755 10:76800422-76800444 CAGAGAAAACAGCAGGGCTTTGG - Intergenic
1071303227 10:84273519-84273541 CAGAAAAAAAAAAAGGATTTGGG + Intergenic
1071593383 10:86898015-86898037 TACAGAAAATACAAGGGTTTTGG - Intronic
1071990657 10:91097998-91098020 CTCAGAAGACAGGAAGATTTGGG - Intergenic
1072484896 10:95845648-95845670 AACAGAAAACAACAGGATGTGGG - Intronic
1072830893 10:98657325-98657347 CAAACAAAAAAAAAGGATTTTGG - Intronic
1073167373 10:101468346-101468368 CACTGAAAACAAAATGAATTGGG - Intronic
1073830590 10:107378868-107378890 TACAAAGAACAGATGGATTTTGG - Intergenic
1073864507 10:107786613-107786635 CTCAGAAGACAGAAAGATGTGGG + Intergenic
1073962248 10:108945823-108945845 CACAGTTCACAGAAGGGTTTGGG + Intergenic
1074235806 10:111583372-111583394 TACAGAAGACAGATGGATCTTGG - Intergenic
1074324194 10:112431867-112431889 CACTGAAAACAGATGGAGCTAGG - Intronic
1074632606 10:115274929-115274951 TGCAGAAGACAGATGGATTTTGG - Intronic
1074641488 10:115388263-115388285 CACAGAAGACATAAGGAGTAAGG - Intronic
1074886040 10:117694553-117694575 CACCCACCACAGAAGGATTTGGG - Intergenic
1076270259 10:129146586-129146608 AATAGAAAACAATAGGATTTGGG - Intergenic
1076353221 10:129832771-129832793 CACAGGATACAGAAGCATGTGGG - Intergenic
1078513810 11:12007026-12007048 CACAGGAAACAGAAAGATCATGG + Intronic
1079834900 11:25322455-25322477 CTCAGAAGACAGAAAGATCTGGG + Intergenic
1080322692 11:31032248-31032270 CTCAGAAATCAAAAGGATATAGG + Intronic
1080449054 11:32363726-32363748 AAAAAAAAAAAGAAGGATTTGGG + Intergenic
1080599682 11:33809524-33809546 CACAGAAAAGAGGTGGCTTTTGG + Intergenic
1081576830 11:44323995-44324017 CACTGGAATCAGAATGATTTGGG + Intergenic
1083537195 11:63480365-63480387 TACAGAAAACAGAAGGCTCAGGG + Intronic
1084347871 11:68568139-68568161 CACAGAAAACAGGAGCAATTTGG + Intronic
1084554370 11:69867129-69867151 CACAGACAACAGGATGGTTTCGG - Intergenic
1084725840 11:70941384-70941406 TACAGATAACAGAAGCATTACGG + Intronic
1085432978 11:76471947-76471969 AACAGAAACCAGAAGGAAGTAGG - Intronic
1085491032 11:76917411-76917433 CAAAGAAAATAGAATGACTTAGG + Intronic
1085826859 11:79857332-79857354 AACAAAAATCAGAAGGCTTTTGG - Intergenic
1086188425 11:84048887-84048909 CAGGGAAAAAAGAAGAATTTTGG + Intronic
1086669203 11:89526921-89526943 AACAGAAGACAGAAAGATGTGGG + Intergenic
1086798689 11:91143451-91143473 TGCAGAAAACAGCAGGACTTTGG - Intergenic
1086943685 11:92823811-92823833 CACTTAAAACAGAAGTAATTAGG + Intronic
1087197883 11:95318645-95318667 GACAGAATACAGATGGGTTTTGG + Intergenic
1087479662 11:98683102-98683124 CACAGAAGTCTGAAAGATTTTGG + Intergenic
1087569738 11:99910268-99910290 CATAGAAAAATGAAGGTTTTTGG - Intronic
1087668868 11:101082435-101082457 CTCAGAAGACAGAAAGATATGGG + Intronic
1088265047 11:107980658-107980680 TACAGAAGACAGATGGATTTTGG + Intergenic
1089903503 11:122012708-122012730 TACAGAATACAGATGGATCTTGG + Intergenic
1089994694 11:122894755-122894777 CAAAGAAAAAAAAAGGACTTTGG + Intronic
1090077449 11:123588192-123588214 AGGAGAAAACAGATGGATTTCGG - Intronic
1090209610 11:124908935-124908957 TACAGAAGACAGATGGATCTTGG - Intergenic
1090686240 11:129124078-129124100 CACAGAGACCAGAAGAGTTTTGG + Intronic
1091811942 12:3406765-3406787 CTCAGAAGACAGAAAGATGTAGG - Intronic
1091852242 12:3708885-3708907 CACAGAAAACATAGATATTTAGG - Intronic
1094421257 12:30273503-30273525 CTCAGAAGACAGAAAGATGTGGG - Intergenic
1094685427 12:32708823-32708845 GACAGAAGACAGCAGGATTCAGG - Intronic
1095242357 12:39876264-39876286 CACACAAAACAGAAACATATAGG + Intronic
1095475791 12:42586173-42586195 CACAATAAAGAGAAGGAGTTAGG - Intronic
1095582025 12:43811273-43811295 AACAGAAAACAGGAGGAGGTGGG - Intergenic
1095987219 12:48006564-48006586 AACAGAAAAAAAAAGAATTTGGG + Intergenic
1096296650 12:50389799-50389821 TAAAGAATACAGATGGATTTTGG - Intronic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096658084 12:53104108-53104130 CACAGTCAACAGGAGGAATTGGG - Intronic
1096826622 12:54283508-54283530 CACAGCAAGCAGAAGTATCTTGG - Intronic
1097108270 12:56638258-56638280 CACAGAAAAATGAAGCTTTTTGG + Exonic
1097943360 12:65337795-65337817 AACAGAAACCAGAAATATTTTGG - Intronic
1098745593 12:74233691-74233713 TGCAGAAGACAGATGGATTTTGG + Intergenic
1098769710 12:74537918-74537940 CAAAACAAACAGAAGGACTTGGG + Exonic
1099231940 12:80036853-80036875 CATACAAAACAGAAGAATTCTGG - Intergenic
1099607842 12:84828187-84828209 GTCAGAAGACAGAAAGATTTGGG + Intergenic
1099696250 12:86023437-86023459 TCCAGAAACCAGTAGGATTTAGG + Intronic
1099834144 12:87886239-87886261 CAAAGAAGACAGATGGATTTTGG - Intergenic
1100083207 12:90877330-90877352 TACAGAAGACAGATGGATCTTGG + Intergenic
1100166013 12:91918598-91918620 GGCAGAGAACAGAAGGATTATGG - Intergenic
1100369889 12:93958629-93958651 CACAGTAAACACAAGGCTTCTGG + Intergenic
1100652411 12:96604914-96604936 CCCAGAAAGCACAAGGGTTTGGG - Intronic
1100673003 12:96836309-96836331 CAGGGAAAACATAAGGATTGAGG + Intronic
1101033934 12:100686278-100686300 CTCAGAAGACAGAAAGATGTGGG - Intergenic
1101056004 12:100914585-100914607 CACACACAAAAAAAGGATTTTGG + Intronic
1101171416 12:102099989-102100011 AACAAAAAACAAAAAGATTTGGG + Intronic
1101193127 12:102355220-102355242 CTCAGAAGACAGAAAGATGTGGG - Intergenic
1101556990 12:105819292-105819314 CACTGACAACAGAAGGAATCAGG - Intergenic
1102224296 12:111217024-111217046 CACAGGAAACTGGAGGATTAGGG + Intronic
1103007885 12:117436279-117436301 CACAGAAAACAAAAGGAGACCGG - Intronic
1103229747 12:119319382-119319404 CAAAGAAAAGAGATGCATTTGGG + Intergenic
1104115840 12:125748289-125748311 CTCAGAAGACAGAAAGATATGGG + Intergenic
1104545115 12:129704025-129704047 CATAGAAAACAGAATGATTAGGG + Intronic
1104696770 12:130870230-130870252 CACATAAAACAAAAGCATATTGG - Intergenic
1105234989 13:18542439-18542461 CACAAAGAACAGTAGCATTTTGG + Intergenic
1106646782 13:31643556-31643578 CAGAGAAAACAGAAGTATATAGG + Intergenic
1106738310 13:32611307-32611329 CATAGAGAAGAGAAGGGTTTGGG - Intronic
1107146557 13:37066841-37066863 CAAAGAAAAAAAAAGCATTTGGG - Intergenic
1107687729 13:42920874-42920896 CAAAGAAAAAAGGAGGAGTTTGG + Intronic
1107965947 13:45598440-45598462 CAAAGCAAGCAGAAGGATTCTGG - Intronic
1108100133 13:46945629-46945651 CTCAGAAGACAGAAAGATGTGGG - Intergenic
1108238623 13:48436767-48436789 AATAGAAAATAGAAGAATTTTGG - Intronic
1109287183 13:60423972-60423994 GAGAGAAAACATCAGGATTTTGG - Intronic
1109323925 13:60845208-60845230 CATAGACAACAGAAGGATACAGG - Intergenic
1110276698 13:73649018-73649040 CAGAGACTTCAGAAGGATTTTGG + Intergenic
1110377072 13:74805579-74805601 TGCAGAAAACAGATGGATCTTGG + Intergenic
1110468905 13:75835320-75835342 CACAGAACTCTGAAGGCTTTCGG - Exonic
1110566326 13:76960700-76960722 CTCAGAAGACAGAAAGATATGGG - Intergenic
1111307438 13:86433911-86433933 CTCAGAAGACAGGAGGATGTGGG + Intergenic
1111669596 13:91312814-91312836 CATAGCAAACAGAATTATTTGGG - Intergenic
1112592977 13:100781362-100781384 AACACAAAACAGTAGGTTTTTGG - Intergenic
1112821631 13:103344775-103344797 CAAAGAAAACAGAAACAATTTGG - Intergenic
1112857342 13:103787479-103787501 CTCAGAAGACAGAAAGATGTGGG - Intergenic
1112859005 13:103807729-103807751 CTCAGAAAACAGGAAGATGTGGG + Intergenic
1113315065 13:109170589-109170611 CACAGAAAACTTAAATATTTTGG - Intronic
1113504225 13:110802439-110802461 CACTGAAGACAGAAGGAAATAGG + Intergenic
1115052862 14:29085834-29085856 CACAGAAGACACTAGGATCTGGG + Intergenic
1115306771 14:31941789-31941811 CACAGAAAAAACAAAGAGTTGGG - Intergenic
1116126659 14:40797138-40797160 CACAGAAAACAGGAAGATATGGG - Intergenic
1116286984 14:42986485-42986507 CTCAGAAGACAGAAAGATGTGGG - Intergenic
1116916165 14:50528125-50528147 CACAGAAGAGAAAAGGAATTTGG - Intronic
1117596383 14:57330780-57330802 TACAGAAGACAGATGGATCTTGG - Intergenic
1117803629 14:59468341-59468363 CACAGAAAAAAGAAGGAAAGTGG - Intronic
1117973066 14:61271235-61271257 CACAGAAAAGATAACAATTTAGG - Intronic
1119130270 14:72165809-72165831 CACAGAGAACAGGACCATTTTGG - Intronic
1119783588 14:77296024-77296046 CAGAGAAAACAGAAGGGTGCAGG + Intronic
1120279458 14:82420670-82420692 CACACAAAAAAGCAGTATTTAGG + Intergenic
1120357965 14:83458538-83458560 CTCAGAAGACAGAAAGATGTGGG + Intergenic
1122194040 14:100071582-100071604 TACATAAAACAGAAGCTTTTTGG + Intronic
1122314016 14:100815163-100815185 CACAGAATACACAAGGACTTGGG + Intergenic
1122499989 14:102191083-102191105 CAGAGCACACAGAAGTATTTGGG - Intronic
1122595665 14:102888638-102888660 CACAGAAAACAGACTCTTTTTGG - Intronic
1123145328 14:106124204-106124226 CACAAAAACTTGAAGGATTTGGG + Intergenic
1123628779 15:22246321-22246343 CTCAGAAAACAGGAGGATGTGGG + Intergenic
1124225983 15:27895385-27895407 CTCAGAATACAGAAGAATGTGGG + Intronic
1124951780 15:34329542-34329564 CACTGAGAACAAAAGAATTTGGG + Intronic
1126997489 15:54462074-54462096 CACAAAATAGATAAGGATTTGGG + Intronic
1128924679 15:71644131-71644153 AACAGAAAACAGTAGGACTCAGG + Intronic
1129321969 15:74780517-74780539 AACAGAAAAAAGATGAATTTGGG - Intergenic
1130306030 15:82712636-82712658 TACTGGAAACAGAAGGCTTTTGG + Intergenic
1130903665 15:88225430-88225452 TACAGAAAACAGAGGGTTTTTGG - Intronic
1131372657 15:91896035-91896057 CATTGAGAACTGAAGGATTTAGG - Intronic
1131896014 15:97030064-97030086 TGCAGGAAACAGACGGATTTTGG - Intergenic
1132305888 15:100812064-100812086 CACAGAAGACAGATGGATCTTGG - Intergenic
1132630024 16:912767-912789 CAAAGAAAACAGAAGCAGGTGGG - Intronic
1133814622 16:9187177-9187199 CACATAAAACAGTTGAATTTTGG + Intergenic
1134881575 16:17748972-17748994 CCTAGAAGACAGAAGTATTTAGG - Intergenic
1135340958 16:21647651-21647673 GTCAGAAAACAGGAGGAGTTGGG - Intronic
1135474496 16:22762372-22762394 CCCAGAAAACAGATGGAGTTTGG + Intergenic
1137959080 16:52863301-52863323 AAGAGAATACAGAAGTATTTAGG + Intergenic
1138292661 16:55861295-55861317 CATAGAAAAGAGGAGGATTGAGG - Intronic
1139130538 16:64137995-64138017 CATACAAAACAGAAGTAATTGGG + Intergenic
1139203957 16:65007191-65007213 CAAAGGAAACAGAAAGACTTGGG - Intronic
1139248388 16:65470806-65470828 AAAATAAAACAGAAGGAATTGGG - Intergenic
1139268432 16:65660643-65660665 CTCAGACAAGAGAAGGATCTTGG - Intergenic
1140146990 16:72320680-72320702 CTCAGAAGACAGAAAGATTTGGG - Intergenic
1140219203 16:73031678-73031700 CACAGCAAACAGAACGAGCTGGG + Intronic
1140262432 16:73391911-73391933 CACTGAAAACAGAGTCATTTGGG + Intergenic
1140889305 16:79271501-79271523 TACAGAGGACAGAGGGATTTTGG - Intergenic
1141975302 16:87511948-87511970 CTCAGAAGACAGGAGGATGTGGG - Intergenic
1143662582 17:8335832-8335854 CACACAACACAGAAGAATCTTGG - Intergenic
1143827841 17:9627134-9627156 GACAGACAAAAGAAGGGTTTTGG + Intronic
1144302580 17:13935783-13935805 AACAGAAAACCAAAGGCTTTGGG + Intergenic
1145689456 17:26722735-26722757 CACAGAAGACTAAGGGATTTTGG + Intergenic
1146141612 17:30373154-30373176 GACATAGAACAGAAGGTTTTTGG - Intergenic
1146673805 17:34759405-34759427 AAAAGAAAAGAGAAGGTTTTGGG + Intergenic
1146805017 17:35858143-35858165 CACGGAAAAGAGAAAGGTTTGGG + Intronic
1149041824 17:52198921-52198943 GATAGAAAACAAAATGATTTGGG + Intergenic
1149486057 17:57043824-57043846 CACAGAAAGTTGAAGGACTTGGG + Intergenic
1149750631 17:59142172-59142194 CAAAGAAAATAGAAGAATTGTGG - Intronic
1150508453 17:65723152-65723174 AACAGAACACAGAAGCAGTTTGG - Intronic
1151760322 17:76098022-76098044 CACAGACAACAGAAGGAAGCAGG + Intronic
1153177875 18:2399428-2399450 AAGACAAAACAGAAGGATTCTGG + Intergenic
1153409062 18:4773316-4773338 CTCAAAAAAAAGAAGTATTTTGG - Intergenic
1153462469 18:5351869-5351891 GAGAGAAAATAGATGGATTTTGG + Intergenic
1153549291 18:6244501-6244523 CACAGAATACCGATGGATGTCGG + Exonic
1154104665 18:11511149-11511171 TACAAAAAACACAAGGATCTGGG - Intergenic
1155457585 18:26035272-26035294 CAAACCAAACAGAAGGATTTCGG + Intronic
1155947254 18:31868994-31869016 CAAAAAAAAAAAAAGGATTTTGG - Intronic
1155993152 18:32301968-32301990 TACAAATGACAGAAGGATTTTGG + Intronic
1156033552 18:32741621-32741643 CAAAAAGAACAGAAGAATTTTGG + Intronic
1157052784 18:44187754-44187776 AAGAGAAAACAGAAGGTTTAGGG + Intergenic
1157448224 18:47764332-47764354 CAGAGAAAACAGAATGCTGTTGG + Intergenic
1157995910 18:52555636-52555658 CACAGGAAGCAGAAGGACTCAGG + Intronic
1158173891 18:54631863-54631885 CTAAGCAAACAGAAGGATTATGG - Intergenic
1158543397 18:58376557-58376579 CACAGAAATGAGAAAGGTTTGGG - Intronic
1159014948 18:63093735-63093757 TACAGAAAAGAAAAGGAGTTTGG - Intergenic
1159425017 18:68273681-68273703 CAAAGAAAACATGAGGATTATGG + Intergenic
1160041861 18:75352797-75352819 CTCAGAAGACAGAAAGATGTGGG + Intergenic
1160752907 19:743113-743135 CTCTGAGAACAGAAGGCTTTGGG - Intronic
1161261486 19:3340256-3340278 CCCAGAAAACAGAAGCAGCTTGG + Intergenic
1162074989 19:8180432-8180454 TACAGAAAAAAGCAGGATATTGG + Intronic
1162467326 19:10850150-10850172 CACAGAAAACACAAGGCTGAGGG + Intronic
1162963800 19:14145782-14145804 CACAGAAACCAGAGTGATCTTGG - Intergenic
1163099955 19:15089385-15089407 CACAGGAAACACATAGATTTTGG - Intergenic
1163877762 19:19889066-19889088 CACAGATAAGAAAAGAATTTTGG - Intronic
1164117427 19:22236011-22236033 GGCAGAAGACAGATGGATTTTGG - Intergenic
1164200128 19:23011284-23011306 TACAGAAGACAGATGGATTTTGG - Intergenic
1164569191 19:29357282-29357304 CATAGAACACATAAGGATTATGG + Intergenic
1165678237 19:37747008-37747030 CTCAAAAAACAGAAGGATCAGGG + Intronic
1166323047 19:42031194-42031216 TACAGAAGGCAGATGGATTTTGG - Intronic
1167345916 19:48945654-48945676 CAAAAAAAAAAGAATGATTTTGG + Intergenic
1168174926 19:54620026-54620048 CATATAAAACACAAGGATATAGG + Intronic
1168542671 19:57226081-57226103 CCCAGAAAAGACAAGGACTTAGG - Intergenic
925201595 2:1971428-1971450 CACCCAAAAGAGAAGGCTTTGGG + Intronic
925384070 2:3449821-3449843 CACAGAAAACAAATTGATTGTGG + Intronic
925774096 2:7316275-7316297 GGCAGAACACAGAAGAATTTTGG + Intergenic
925960722 2:9012867-9012889 CATAGAAAACTGAATGATTAAGG - Intergenic
926443373 2:12914032-12914054 CAAAGAAAAGACAAGCATTTTGG + Intergenic
926612003 2:14956301-14956323 CTCAGAAGACAGAAAGATATGGG - Intergenic
926991239 2:18682808-18682830 TCCATAAAACAGATGGATTTTGG + Intergenic
927012278 2:18916652-18916674 CACTGAAAACACCAGGATTGAGG - Intergenic
927855413 2:26524591-26524613 CAAACAAATCAGAAGTATTTGGG - Intronic
928953733 2:36839676-36839698 CACAGAAGAAAGCAGGAATTTGG - Intergenic
929211345 2:39360382-39360404 CTCAGAAGACAGAAAGATGTGGG - Intronic
929926060 2:46210634-46210656 AACAGAAACAAGAAGTATTTGGG + Intergenic
930330304 2:49975009-49975031 CACTGGAAACAGATGTATTTGGG - Intronic
930376367 2:50572100-50572122 CAGAGAAAACAGGAGGACTAAGG + Intronic
930807553 2:55506505-55506527 AAAAAAAAAAAGAAGGATTTTGG - Intergenic
931067836 2:58606828-58606850 CAGAGAGAACAAAAGGATGTGGG + Intergenic
931283489 2:60813828-60813850 CAAAGAAAATGGAAGGCTTTTGG - Intergenic
931727870 2:65129166-65129188 CACAGAAGACAAAATGACTTAGG + Intronic
931910609 2:66895767-66895789 CACAGGAACCAGAAAGATTCAGG - Intergenic
932544304 2:72691574-72691596 CTCAGAAAACAGAACTATATGGG + Intronic
932942754 2:76188293-76188315 CAAAGAAAAAAGAAAAATTTTGG - Intergenic
933176972 2:79185410-79185432 AACAGAAAAAAAAAGGAATTTGG + Intronic
933417876 2:82010249-82010271 GACAGAAAATAAAAGTATTTGGG - Intergenic
933976010 2:87510428-87510450 CACTGAAAACAGGATGATTTTGG - Intergenic
935036343 2:99378358-99378380 CTCAGAAAGCTGAAGCATTTAGG + Intronic
935479156 2:103562924-103562946 CTCAGAAGACAGAAAGATGTGGG - Intergenic
936317812 2:111440382-111440404 CACTGAAAACAGGATGATTTTGG + Intergenic
936885825 2:117309330-117309352 CACAAAGGACAGAAGCATTTGGG - Intergenic
936945872 2:117930277-117930299 CACTGAAACCACATGGATTTAGG + Intronic
937612600 2:123879683-123879705 CCCAGGAAGTAGAAGGATTTAGG - Intergenic
937820205 2:126302216-126302238 CACAGAAAACATCTGGATTCTGG + Intergenic
937915787 2:127098083-127098105 CACAGATGACAGAATGACTTAGG + Intronic
937961331 2:127462037-127462059 CACATACAAAAGAATGATTTTGG + Intronic
938881025 2:135588395-135588417 GACAGAAAAGAGAAAGATCTGGG - Intronic
938996063 2:136679598-136679620 CAGAGTAAACAGAAGACTTTTGG + Intergenic
939755149 2:146100903-146100925 CACAGAAAACAGATAGATCTTGG + Intergenic
940171428 2:150833620-150833642 TGCAGAAAACAGATGGATCTTGG - Intergenic
940181442 2:150938135-150938157 CAAAGAAAACTGAAGGTCTTTGG + Intergenic
940691227 2:156923280-156923302 CTCAGAAAACAGGAAGATGTGGG + Intergenic
941127035 2:161596295-161596317 CACAGAAAGTAAAAGAATTTAGG + Intronic
941584174 2:167336206-167336228 TACATAAAACAGTAGGATTCAGG - Intergenic
942091166 2:172492840-172492862 TTCAGAAAACAGAATGATTAGGG - Intronic
942234225 2:173888824-173888846 CTCAGAAGACAGAAAGATGTGGG + Intergenic
942264404 2:174206827-174206849 CAAAGAAAACATATGGTTTTTGG + Intronic
942283289 2:174389230-174389252 CTCAGAAAACAGGAAGATGTGGG + Intronic
942758220 2:179366584-179366606 AAAAGAGAGCAGAAGGATTTTGG - Intergenic
943178784 2:184514535-184514557 AACAGGAAACAGGAGGTTTTTGG + Intergenic
943506283 2:188763154-188763176 CACTGAAAACTGAATGATTTGGG - Intronic
944965099 2:204922349-204922371 TACAGAAAAGGGAAGGATTGTGG + Intronic
944977592 2:205073599-205073621 CAAAGAAAACAGAAAGAGTCTGG - Intronic
945189824 2:207175744-207175766 CACAGAAAAGGAAAGGATTGGGG - Intergenic
945822465 2:214681327-214681349 CATAGAGAACAGAAGGAAATTGG + Intergenic
946678089 2:222183747-222183769 CAAAGAAAACAAAACGTTTTTGG + Intergenic
947334193 2:229064377-229064399 CACAGAAGAAAGAACAATTTAGG + Intronic
948213269 2:236210608-236210630 CACAGGAAACAGAAGGCCTTTGG + Intronic
948664529 2:239526772-239526794 CACAAAAAGCAGCAGCATTTGGG + Intergenic
948768401 2:240234998-240235020 CACTGAACACAGAATGCTTTTGG + Intergenic
1168785247 20:533688-533710 AACAGAAAACATTAGCATTTGGG + Intronic
1169126102 20:3127922-3127944 CACAAAGAACAGGAGGCTTTAGG - Intronic
1169522281 20:6386754-6386776 CCCATAAAACAGGAGGATTTGGG - Intergenic
1169933223 20:10856247-10856269 CAAAGAAAACTTAAGGAGTTTGG + Intergenic
1170271919 20:14537064-14537086 AACAGAAAACAGAAGGAAGGGGG - Intronic
1170336673 20:15277773-15277795 CTCAGAAAAAGGAAGGAATTGGG + Intronic
1170797984 20:19566392-19566414 CACAGGAAACAGCAGGGTGTGGG - Intronic
1171293465 20:23995751-23995773 CAAAGAAAACAGAAGCATGGAGG - Intergenic
1172350943 20:34240156-34240178 AAGAGAAAAAAGAAGCATTTGGG + Intronic
1173183587 20:40822257-40822279 GACAGAAAAGAGGAGGACTTAGG - Intergenic
1173916740 20:46713659-46713681 CACAGCAGCCAGAAGGATTCTGG - Intronic
1174479152 20:50818756-50818778 CAGAGAGAACAGAAGGATTCAGG - Intronic
1175196501 20:57247286-57247308 CAAAGAAGACAGAAGAAATTGGG - Intronic
1175291723 20:57880505-57880527 CACAGACAAAAGAAGCAATTGGG - Intergenic
1177257894 21:18689886-18689908 TGCAGAAAACAGATGGATCTTGG + Intergenic
1177557048 21:22704041-22704063 CTCAGAAAACAGGAAGATGTGGG + Intergenic
1177854124 21:26382835-26382857 CTCAGAAGACAGGAAGATTTGGG + Intergenic
1177913065 21:27055318-27055340 TGCAGAAGACAGATGGATTTTGG + Intergenic
1178060864 21:28852041-28852063 TACAGAAGACAGATGGATCTTGG - Intergenic
1178261965 21:31107850-31107872 CTCAGAAGACAGAAAGATGTGGG - Intergenic
1178387629 21:32166489-32166511 CTCAAAAAACAGAAGGATGGAGG + Intergenic
1178778597 21:35576714-35576736 CAAACAAGACAGAAGGATCTTGG + Intronic
1178913678 21:36695388-36695410 AACAGCAAACAGAACGAATTAGG + Intergenic
1178980715 21:37262087-37262109 CTAAGAAAACAGAAATATTTTGG + Intronic
1179383413 21:40920156-40920178 TGCAGAAGACAGATGGATTTTGG + Intergenic
1180112335 21:45666671-45666693 CACAGAAACTAGAAGGCTGTAGG - Intronic
1180824521 22:18853467-18853489 CAAAGAAAACAGAAGCATGGAGG - Intronic
1181124943 22:20696622-20696644 CAAAGAAAACAGAAGCATGGAGG - Intergenic
1181188214 22:21121081-21121103 CAAAGAAAACAGAAGCATGGAGG + Intergenic
1181210982 22:21289412-21289434 CAAAGAAAACAGAAGCATGGAGG - Intergenic
1181398518 22:22637476-22637498 CAAAGAAAACAGAAGCATGGAGG + Intergenic
1181650897 22:24258584-24258606 CAAAGAAAACAGAAGCATGGAGG - Intergenic
1181706484 22:24652155-24652177 CAAAGAAAACAGAAGCATGGAGG + Intergenic
1182085430 22:27557918-27557940 AACTGTCAACAGAAGGATTTGGG + Intergenic
1182345832 22:29664106-29664128 CTCAAAAAAAAGAAGGGTTTAGG - Intronic
1182999500 22:34843453-34843475 CTCAGAAGACAGAAGGATTTGGG + Intergenic
1183151315 22:36039930-36039952 CTCAGAAGACAGAAAGATGTGGG - Intergenic
1184501627 22:44878207-44878229 CACAGGCAACAGCTGGATTTTGG + Intergenic
1203215964 22_KI270731v1_random:6018-6040 CAAAGAAAACAGAAGCATGGAGG + Intergenic
1203274659 22_KI270734v1_random:79372-79394 CAAAGAAAACAGAAGCATGGAGG - Intergenic
949149927 3:754142-754164 TACAGAAATCAGTAGCATTTCGG - Intergenic
949164858 3:927504-927526 ACCAGAAAACAGGAGTATTTGGG - Intergenic
950704789 3:14773037-14773059 CACAGAAGACAGAATGAGCTGGG - Intergenic
950740045 3:15043508-15043530 CACAGAAATCATTAGCATTTCGG - Exonic
951257505 3:20467457-20467479 CCCACAAAACATAAGGATTATGG - Intergenic
952187663 3:30988144-30988166 CATAGAAAACAAAAGCATTTGGG - Intergenic
952608808 3:35182322-35182344 CTCAGAAAACAGGAAGATGTGGG - Intergenic
953294551 3:41700695-41700717 CCAAGAAAACAGGAAGATTTGGG + Intronic
953309105 3:41859639-41859661 CAAACAAAAAAGAAGGAATTTGG - Intronic
953569030 3:44057133-44057155 CACAGGAAACAGAAGGACCTCGG - Intergenic
954484715 3:50837082-50837104 CTCAGAAGACAGAAAGATGTGGG - Intronic
955457005 3:59133655-59133677 CACAGAAAGCAGAAGGGCTTTGG + Intergenic
955569441 3:60288534-60288556 CCTAGAAAACAGAATGATTAAGG - Intronic
955736625 3:62045588-62045610 TACAGAAAACAGCAGCATTGAGG - Intronic
956140856 3:66145512-66145534 TAAACAAAGCAGAAGGATTTGGG - Intronic
956164815 3:66388672-66388694 CACAGAGAACAGAAGGCAGTAGG + Intronic
956823994 3:72980569-72980591 AAAAGAAAAAAAAAGGATTTGGG - Intronic
957115567 3:76019973-76019995 CAGAGAAAACCGAAGCATGTGGG - Intronic
957471666 3:80667030-80667052 CACAGAAATGAGAAGGAATGAGG + Intergenic
957511408 3:81192701-81192723 CAAAGAAAACAAAAGAATTATGG - Intergenic
957682830 3:83459739-83459761 CACAGAAAGGAAAGGGATTTTGG + Intergenic
958057076 3:88427045-88427067 CTCAGAAGACAGAAAGATGTGGG + Intergenic
958688150 3:97426042-97426064 CTCAGAAGACAGGAAGATTTGGG - Intronic
959543816 3:107570823-107570845 GAGAGAAAGAAGAAGGATTTGGG + Intronic
959807129 3:110568918-110568940 CAAAGAAAAAAGAAAGATTAAGG + Intergenic
961400582 3:126639297-126639319 CACAGAAGCCAGGAGGAGTTTGG - Intronic
961712878 3:128840710-128840732 CAGAGAAAGAAGAAAGATTTGGG + Intergenic
962109245 3:132425973-132425995 GACAGAAAACCACAGGATTTGGG - Intronic
963566796 3:146940076-146940098 TGCAGAAAACAGATGGATCTTGG + Intergenic
963975249 3:151473146-151473168 TACAGAAAACGAAAGGATTAGGG - Intergenic
964498027 3:157315510-157315532 GACAGAAAACGGAAAGAATTTGG + Intronic
964897119 3:161612078-161612100 CTCAGAAGACAGAAAGATGTGGG + Intergenic
965382606 3:168008537-168008559 TACAGAAAACAGAAGCAGGTGGG + Intergenic
965417202 3:168411218-168411240 CATAGAAATCAGAAGTAATTTGG - Intergenic
966143254 3:176780978-176781000 CAGACAAAACAGAAGGAAATGGG + Intergenic
966337294 3:178882731-178882753 TCCAGATAACAGAAGGACTTGGG - Intergenic
966964782 3:184980119-184980141 CACACAAACCAGAAGGGATTGGG - Intronic
967092062 3:186143300-186143322 CACAGAAAACCAAGGGGTTTTGG - Intronic
967691570 3:192479986-192480008 AAGAGAAGAAAGAAGGATTTGGG + Intronic
968410097 4:383068-383090 AAAAGATAACAGAAGCATTTAGG - Intronic
968421294 4:487270-487292 AAAAGATAACAGAAGCATTTAGG - Intronic
970150371 4:13082879-13082901 CACAGAAGACAGCAAGATGTGGG - Intergenic
970825477 4:20268017-20268039 CACTGAAAACAGATGGGATTGGG + Intronic
971011243 4:22438194-22438216 CTTAGACAACAGAAGGATCTGGG + Intronic
971100323 4:23459313-23459335 CAGAAAAAAAAGAAAGATTTGGG - Intergenic
971460728 4:26892997-26893019 TGCAGAAAACAGATGAATTTTGG - Intronic
971530527 4:27682919-27682941 CACAGAAAAAAAAATGAGTTAGG - Intergenic
971840520 4:31846411-31846433 GTAAGGAAACAGAAGGATTTAGG - Intergenic
972056283 4:34806884-34806906 CTCAGAAAACAGGAAGATGTGGG - Intergenic
972085121 4:35206206-35206228 TACAGAAGAAAGAGGGATTTTGG + Intergenic
972347890 4:38208895-38208917 CAGAGAGATGAGAAGGATTTGGG - Intergenic
972690838 4:41396142-41396164 CATAGCCAAGAGAAGGATTTAGG + Intronic
973162774 4:47038955-47038977 TACTGAAAACAGAAGTATTTTGG - Intronic
974060213 4:57026483-57026505 CACATAAAACAAAAGCATTTTGG - Intronic
974178586 4:58357551-58357573 CTCAGAAAACAGAAAAATATGGG + Intergenic
974319082 4:60321478-60321500 CTCAGAAAACACAAGGATAAAGG + Intergenic
974367046 4:60963677-60963699 CATAAAAAATAGTAGGATTTAGG + Intergenic
974404065 4:61442687-61442709 AATAGAAAGCAGGAGGATTTGGG + Intronic
974558704 4:63488721-63488743 GACAGGAAACACAAGGGTTTTGG - Intergenic
975151961 4:71032755-71032777 GAGAGAAAGAAGAAGGATTTGGG - Intergenic
975152017 4:71033069-71033091 GAGAGAAAGAAGAAGGATTTGGG - Intergenic
975204148 4:71624764-71624786 CTCAGAAGACAGAAAGATGTGGG - Intergenic
975255314 4:72228341-72228363 CTCAGAAAACAGATTGATTTAGG + Intergenic
975406886 4:73999899-73999921 CACAGATAACAGAAGGAGAGAGG - Intergenic
975587583 4:75965794-75965816 TGCAGCAAACAGAAGGATCTTGG + Exonic
975677109 4:76837875-76837897 CACAGAAAAGTTAAGGAATTTGG + Intergenic
976034299 4:80796662-80796684 TACAGAAGACAGATGGATCTTGG - Intronic
976947671 4:90790762-90790784 CTCAGAAGACAGGAGGATGTGGG - Intronic
976964579 4:91020806-91020828 CAGAGAAAACAGAAGTACCTTGG - Intronic
977356486 4:95953226-95953248 CTCAGAAGACAGGAGGATGTGGG - Intergenic
977594501 4:98863968-98863990 CACAGATTAAAGAATGATTTTGG + Intergenic
977930518 4:102744704-102744726 TGCAGAAGACAGAAGGATCTTGG - Intronic
978093095 4:104741813-104741835 AGCAGAAAACAGATAGATTTTGG - Intergenic
979008360 4:115334313-115334335 CCCAGAAATCAGAAAGAATTTGG - Intergenic
979038289 4:115753872-115753894 CTCAGAAGACAGAAAGATATGGG + Intergenic
979139291 4:117152020-117152042 CTCAGAAGACAGGAAGATTTGGG - Intergenic
979508297 4:121523172-121523194 CACAGAAAATGGAAGGATGAAGG + Intergenic
979723824 4:123936075-123936097 CACACAAAAAAGAAAGAATTTGG - Intergenic
979984474 4:127296625-127296647 CTCAGAAGACAGGAAGATTTGGG - Intergenic
980386373 4:132091388-132091410 TGCAGAAGACAGATGGATTTTGG - Intergenic
980629423 4:135413372-135413394 TGCAGAAAACAGATGGATCTTGG + Intergenic
980989564 4:139727783-139727805 GAGGGAAAACAGAAGGATTTGGG - Intronic
981184335 4:141783226-141783248 CTCAGAAAACAGGAAGATGTGGG - Intergenic
981503198 4:145474253-145474275 CACAGAAGACAGGAAGATGTGGG - Intergenic
981717009 4:147761688-147761710 AACAGCAAACAGAATGAATTGGG + Intronic
982132770 4:152245289-152245311 GATGGAAAACAGAAGTATTTAGG - Intergenic
982554193 4:156839714-156839736 CTCAGAAGACAGGAAGATTTGGG + Intronic
982925235 4:161328627-161328649 AACAGACAACAGAAGGATTCTGG - Intergenic
982928710 4:161373833-161373855 CACATAAAACAGAAGACTGTGGG - Intergenic
983766270 4:171488779-171488801 CTCAGAAGACAGAAAGATGTGGG + Intergenic
983847319 4:172536360-172536382 CTCAGAAGACAGAAAGATGTGGG + Intronic
984061190 4:174990703-174990725 TACAGAAGACAGATGGATCTTGG - Intergenic
984368134 4:178824712-178824734 CACACAAAAAAGAAATATTTTGG + Intergenic
984555952 4:181213990-181214012 CACAGAAGTCAGTAGAATTTAGG - Intergenic
984675996 4:182548364-182548386 CACAGTAAACACACGGTTTTAGG + Intronic
984867750 4:184296948-184296970 CACTGAAGCCAGAAGGGTTTTGG + Intergenic
985172024 4:187160712-187160734 AACATAAAACAGAAGGAATTTGG + Intergenic
986220812 5:5767163-5767185 CACAGAAAGGTAAAGGATTTCGG - Intergenic
986507873 5:8471441-8471463 CTCAGAAGACAGAAAGATGTGGG - Intergenic
986562410 5:9075156-9075178 CATAGAAAACAGTGGGATTGTGG - Intronic
986615345 5:9611796-9611818 CACAGAGAACAGAAGGTAATAGG + Intergenic
986640704 5:9869029-9869051 CTCAGAAAACAGGAAGATGTGGG - Intergenic
986686858 5:10282380-10282402 CACAGAAAACTGCAACATTTGGG + Intronic
987244019 5:16029937-16029959 AATAGAAAACAGATGGAGTTTGG - Intergenic
987374435 5:17219759-17219781 CAGAGAAAACAGAAAGGGTTAGG - Intronic
987395034 5:17415253-17415275 AAAAGAAAACAGAATCATTTAGG + Intergenic
987515954 5:18908202-18908224 CAAAGAAAACAGAATCAATTAGG + Intergenic
987657244 5:20822555-20822577 TGCAGAAGACAGAAGGATCTTGG - Intergenic
988353586 5:30143544-30143566 CTCAGAAAACAGGAAGATGTGGG - Intergenic
988766302 5:34381393-34381415 TGCAGAAGACAGAAGGATCTTGG + Intergenic
989164378 5:38420376-38420398 CACAGAAAGAAGATGGATTTTGG - Intronic
989410484 5:41114153-41114175 CAGAGAAAACAGAAGTATACAGG - Intergenic
989523729 5:42428867-42428889 CTCAGAAAACAGGAAGATGTGGG - Intronic
990794430 5:59524227-59524249 CTCAGAAGACAGAAAGATGTGGG + Intronic
991278435 5:64880511-64880533 CACAGAAATCAAAATGATTAAGG - Intronic
992313235 5:75524654-75524676 AACAAAAAACAGATAGATTTTGG + Intronic
992541712 5:77771910-77771932 GAGAGAAAATTGAAGGATTTGGG + Intronic
992927859 5:81609002-81609024 AAGAGAAAATAGAAGGAATTTGG + Intronic
993317547 5:86429631-86429653 AAAAGAAAACATCAGGATTTGGG - Intergenic
993906193 5:93626065-93626087 CAAAGTAAACATCAGGATTTTGG - Intronic
994121072 5:96113527-96113549 CAGAGAAAAAAGAAAGTTTTAGG + Intergenic
994199520 5:96956824-96956846 CACAGAGAAAAGAAAGATTGAGG - Intronic
994351282 5:98749121-98749143 CACAGAAACCAGAAAAATCTTGG + Intergenic
994590859 5:101769834-101769856 CTCAGAATACAGAAAGATGTCGG - Intergenic
994764441 5:103899439-103899461 CTCAGAAAACAGGAAGATGTGGG + Intergenic
994896773 5:105715834-105715856 CAAAGAAAATAAAAAGATTTAGG + Intergenic
994988452 5:106967802-106967824 CTCAGAAAACAGATGGAATATGG + Intergenic
995022397 5:107381209-107381231 CACAGAAAACATCAGGGTCTTGG - Exonic
995232517 5:109784834-109784856 GACAGAAGCCAGAAGGAATTTGG + Exonic
995448202 5:112270240-112270262 CTGAGAAAACTGAAGGATGTAGG + Intronic
996353831 5:122575263-122575285 CACAAAGGAGAGAAGGATTTGGG - Intergenic
996392304 5:122974657-122974679 TGCAGAAGACAGATGGATTTTGG - Intronic
997044741 5:130300718-130300740 CATAGAAAACAAATGAATTTTGG + Intergenic
997378017 5:133411326-133411348 CACAGCACAAAGAAGGCTTTTGG + Intronic
998939553 5:147266499-147266521 TACAGAAAAAGGATGGATTTGGG - Intronic
999132609 5:149296009-149296031 CACATAAAACAAAAGCAATTTGG + Intronic
1000248315 5:159468917-159468939 CACACAAAAAAGAGGGATTTGGG + Intergenic
1000790959 5:165606711-165606733 CAGAGAAATTAGAAAGATTTTGG - Intergenic
1002690753 5:181048342-181048364 CACAGAGAACAGAAGAATGTCGG + Intronic
1002930344 6:1630150-1630172 CACAGACAACATAATTATTTAGG + Intronic
1003226974 6:4214889-4214911 CTCAGAAAACAGGAAGATTTGGG - Intergenic
1003280733 6:4689405-4689427 TACAGAAAACAGGAGGGCTTTGG + Intergenic
1003767960 6:9262063-9262085 CTCAGAAGACAGAAAGATATGGG - Intergenic
1003833937 6:10046985-10047007 CAAAGAAAACTGAAAGAATTAGG + Intronic
1003900611 6:10651789-10651811 CACATAAAAAAGAATGAATTGGG - Intergenic
1004259151 6:14093215-14093237 GACACCAAAAAGAAGGATTTAGG + Intergenic
1004601417 6:17153970-17153992 CAGAGAAAGCAGAAGCGTTTGGG - Intergenic
1005241156 6:23829360-23829382 CACATACAATAGAATGATTTTGG - Intergenic
1005286153 6:24329098-24329120 AACGCAAAACAGAAGCATTTAGG + Intronic
1005714102 6:28530751-28530773 AACAGATAACAGAAGGACATAGG + Intronic
1006253724 6:32812924-32812946 CACAGAAAAGTAAATGATTTGGG + Exonic
1006499580 6:34449303-34449325 CACAGAAGACAGCAGGAGTGAGG - Intergenic
1006616583 6:35332133-35332155 CACAGGAAGCAGAAGGGGTTGGG + Intergenic
1007996609 6:46314762-46314784 CACAGAATACAGAAGTTTTAAGG - Intronic
1008439110 6:51512027-51512049 CCTAGAAAACAGAAGCATTTAGG + Intergenic
1008566986 6:52778170-52778192 CAGAGAACACAGAGTGATTTAGG - Intergenic
1008568923 6:52796130-52796152 CAGAGAACACAGAGTGATTTAGG - Intronic
1008570533 6:52812235-52812257 CAGAGAACACAGAGTGATTTCGG - Intergenic
1008577886 6:52878714-52878736 CAGAGAATACAGAGTGATTTAGG - Intronic
1008580477 6:52902294-52902316 CAGAGAACACAGAGTGATTTAGG - Intronic
1009702846 6:67205022-67205044 CACAGAAACCAGAAGCAAATGGG + Intergenic
1010020379 6:71153068-71153090 CCCAGCAAACTGAAGGATTGAGG - Intergenic
1010164242 6:72897072-72897094 CATAGAAAACAGAACGTATTTGG + Intronic
1010290260 6:74128322-74128344 CACAGAAAAAAGTAGGAATTTGG - Intergenic
1010609431 6:77935332-77935354 CACAGTGGAAAGAAGGATTTAGG + Intergenic
1010628489 6:78168364-78168386 CACAGACACCAAAAGGAATTCGG - Intergenic
1010818516 6:80387498-80387520 TGCAGAAGACAGATGGATTTTGG + Intergenic
1011031644 6:82930500-82930522 CTCAGAAGACAGAAAGATATGGG + Intronic
1011122627 6:83970435-83970457 CACAGATAACTGAATGAATTGGG + Intergenic
1011204335 6:84875434-84875456 CACAGAAAACCTGAGAATTTTGG - Intergenic
1011407299 6:87029487-87029509 CACTGAAAACAGGAGGATTTAGG - Intergenic
1011476881 6:87757019-87757041 CACAGAAAGCAGAAGCTTGTGGG + Intergenic
1011512064 6:88112437-88112459 CTGAGACAACAGAAGGGTTTTGG - Intergenic
1011828168 6:91335470-91335492 AACAGAAAACAAAAAGGTTTTGG + Intergenic
1012097273 6:94978030-94978052 CTCAGAAGACAGAAAGATGTGGG - Intergenic
1012514118 6:100038887-100038909 CTCAGAAGACAGAAAGATGTGGG + Intergenic
1012768220 6:103396634-103396656 CTCAGAAGACAGAAAGATGTGGG + Intergenic
1013146146 6:107394889-107394911 CACAGAAGAATGAAGCATTTTGG - Intronic
1013405704 6:109841015-109841037 CAAAGAAAACAAAAGGAATCCGG + Intergenic
1014469906 6:121801171-121801193 CTCAGAAAACAGGAAGATATGGG + Intergenic
1014535027 6:122604769-122604791 CACAGAAAACAGAAAATGTTGGG - Intronic
1014565904 6:122947249-122947271 CACTGAAAACAGGAGAGTTTGGG + Intergenic
1014596975 6:123357138-123357160 CAAAGAAAAAAGTGGGATTTTGG - Intronic
1015282688 6:131450797-131450819 CCAAGAAAACAGAAGGAGGTTGG - Intergenic
1015866752 6:137734929-137734951 GACAGAAAAAAGAGGGAGTTTGG - Intergenic
1016151348 6:140746142-140746164 CTCAGAAAACAGGAAGATATTGG + Intergenic
1016188219 6:141224285-141224307 CACAGAAAACAGACTGATTGTGG - Intergenic
1016493387 6:144632061-144632083 CACAGAATTCAGAAAGCTTTCGG - Intronic
1016494543 6:144645468-144645490 CAGAGAAAACACAAACATTTAGG + Intronic
1016707716 6:147131883-147131905 CAAAGAAAACAGCAAGTTTTAGG - Intergenic
1017480304 6:154846939-154846961 AACTAAGAACAGAAGGATTTGGG - Intronic
1017487521 6:154916971-154916993 CATAGAGATCAGAAGGATATAGG + Intronic
1017860649 6:158394333-158394355 CTCAGAAGACAGGAGGATTGTGG - Intronic
1018162508 6:161059942-161059964 CACAGAAAATAGAAACATGTGGG - Intronic
1019409245 7:899473-899495 CACAGCAAACGGAAGGCTTCCGG - Exonic
1020455522 7:8369823-8369845 ATCAGAAAAGAGAAAGATTTAGG - Intergenic
1020480543 7:8654827-8654849 CACAGAAGAAAGAAGGGGTTTGG + Intronic
1020681592 7:11243938-11243960 CGCAGAAGACAGATGTATTTTGG + Intergenic
1020824237 7:13007464-13007486 CAGAGACCACAGAAGGAATTTGG - Intergenic
1020996195 7:15268396-15268418 CACAGACTCCAAAAGGATTTTGG - Intronic
1021002166 7:15344953-15344975 ACCAGAAAACTGAAAGATTTAGG - Intronic
1021175078 7:17440718-17440740 CTCAGAAGACAGGAAGATTTTGG - Intergenic
1021272152 7:18603122-18603144 CACACTAAACAGAAGGATGTTGG - Intronic
1023190978 7:37582339-37582361 CACATGAAACAGAAGGAATTTGG - Intergenic
1023547872 7:41338323-41338345 CACAGAAATCAAAATGGTTTTGG + Intergenic
1024741657 7:52362045-52362067 CTCAGAAAAAAGAAAGATTACGG - Intergenic
1024756164 7:52535015-52535037 CACAGAAAGCAAAACTATTTAGG + Intergenic
1025035270 7:55589713-55589735 CACAGAAAAGAGAAGGGTGAGGG - Intergenic
1026079723 7:67206984-67207006 CACAGAAGAAAGAAGGAATATGG - Intronic
1026576837 7:71578917-71578939 CACAGGCCACAGAAGGCTTTGGG - Intronic
1027352519 7:77326563-77326585 CACTGGAAACAGAGGGACTTGGG + Intronic
1027778751 7:82497904-82497926 CCCAGAAAGCAGAAGGATTTGGG - Intergenic
1027795510 7:82688506-82688528 CACAGCAAACAGAATTATTTTGG - Intergenic
1028084141 7:86616238-86616260 CTCAGAAGACAGAAAGATGTGGG + Intergenic
1028731554 7:94157018-94157040 CATATAAAAAAGAAGGATTTAGG + Intergenic
1030795728 7:113784689-113784711 GAAAGAAAAAAGAAGAATTTGGG + Intergenic
1031598728 7:123677603-123677625 CACATGACACAGTAGGATTTGGG - Intergenic
1031637468 7:124119251-124119273 CTCAGAAGACAGAAAGATGTGGG + Intergenic
1033682426 7:143607845-143607867 CAAAGAAAACTGAAGGGATTTGG + Intergenic
1033702463 7:143854068-143854090 CAAAGAAAACTGAAGGGATTTGG - Exonic
1034148321 7:148891894-148891916 AAAAGAAAACAGAATGATTTTGG + Intergenic
1034333969 7:150308543-150308565 GAGAGAAAGAAGAAGGATTTGGG - Intronic
1034510829 7:151533262-151533284 CTCAGAAGACAGAAAGATGTGGG - Intergenic
1034718457 7:153265130-153265152 CTCAGAAGACAGAAAGATATGGG - Intergenic
1036450332 8:8860597-8860619 CACAGCAAACAGGAGGCTTAAGG + Intronic
1036469764 8:9042179-9042201 CACAGAAAAGAGAAGGAACTTGG + Intronic
1038880547 8:31606140-31606162 CTCAGAAGACAGAAAGATGTGGG - Intergenic
1039357688 8:36839287-36839309 AAAGGAAAACAGGAGGATTTTGG - Intronic
1039588577 8:38728037-38728059 AACAAAAAACAGAGGGATGTGGG + Intergenic
1040428096 8:47309657-47309679 ATCAGAAAACAGAAGTATTTGGG - Intronic
1040726349 8:50385881-50385903 TGCAGAAGACAGATGGATTTTGG - Intronic
1040769073 8:50951023-50951045 GACAGAAAACAGAAGGAGGCAGG + Intergenic
1041541735 8:58992504-58992526 TACAGAAGAAAGAAGGAGTTGGG - Intronic
1041725851 8:61016760-61016782 CCCAGAATACAGAAGGCTTGTGG + Intergenic
1042301065 8:67282265-67282287 CTCAAAAAACAGAACCATTTAGG + Intronic
1042323133 8:67499256-67499278 CACAGAAACCAGAAGTATCAAGG - Intronic
1042588669 8:70372467-70372489 CTCTGAAAAGAGTAGGATTTTGG - Intronic
1042994841 8:74685422-74685444 CAAAGGAAACAGTAGAATTTTGG + Intronic
1042996316 8:74703495-74703517 CATGGATAACAGCAGGATTTAGG + Intronic
1043041657 8:75270871-75270893 CACAAAATAGAAAAGGATTTGGG + Intergenic
1043735561 8:83738396-83738418 GCAAGAAAACAGTAGGATTTTGG + Intergenic
1043949304 8:86290479-86290501 CACAAAAAACAGAAAGTTCTGGG - Intronic
1044181853 8:89206099-89206121 CATAGAAATGAAAAGGATTTCGG + Intergenic
1044233467 8:89805129-89805151 CACTGAAAACAAAAATATTTTGG - Intergenic
1044516442 8:93144296-93144318 CAGAGAAAAGGGAATGATTTTGG + Intronic
1044673918 8:94710982-94711004 CCCAGAAAGCAGCAGGATTTTGG - Intergenic
1045608446 8:103806235-103806257 CTCAGAAAACATAAGGCTTAAGG + Intronic
1045845318 8:106628166-106628188 CACAGAAAACAGGAGGTTCTAGG - Intronic
1046074782 8:109302371-109302393 CAGAGAAAGAAGAAAGATTTGGG - Intronic
1046080804 8:109368294-109368316 CACAGAAAGCATATGGACTTTGG + Intronic
1046217053 8:111162334-111162356 CTCAGAAAACAAATGGATCTTGG + Intergenic
1046311338 8:112441363-112441385 CTCAGAATACAGAAAGATGTGGG - Intronic
1046358278 8:113116696-113116718 CTCAGAAAACAGGAAGATGTTGG + Intronic
1046567186 8:115917168-115917190 AATAGAAAAAAGAAGGACTTTGG + Intergenic
1046827754 8:118710383-118710405 CACCTGAAAAAGAAGGATTTGGG + Intergenic
1047042087 8:121007576-121007598 CCCAGAAAACTGAGGGATTGGGG + Intergenic
1047172155 8:122504128-122504150 CTCTGAAAACAGAGGGAATTGGG + Intergenic
1047195435 8:122716844-122716866 CATAGAAAGGAGTAGGATTTGGG + Intergenic
1047271267 8:123361462-123361484 CTAAGAAAACAGAATAATTTGGG - Intronic
1048164049 8:132046335-132046357 CACAGAAATCAGAATGTTTACGG - Intronic
1048409709 8:134159831-134159853 CACAGAAAACAGAAATATATAGG - Intergenic
1048554396 8:135459769-135459791 CACAGAATCCAAAAGAATTTTGG - Intronic
1050020432 9:1278972-1278994 CAGAGAAAAGAGAAAGCTTTGGG - Intergenic
1050275682 9:3996316-3996338 CAGAGAAAACAGAAAAATATGGG + Intronic
1050444966 9:5711355-5711377 CAGACAAAACAGAAGCATTTAGG - Intronic
1050987613 9:12102901-12102923 AAAAGAAGACAGAAAGATTTAGG - Intergenic
1051242271 9:15071478-15071500 CACAGGAAATAGAAGAACTTAGG + Intergenic
1051589447 9:18761823-18761845 CACAGACAAGATAAGCATTTAGG + Intronic
1051745827 9:20293745-20293767 AACAGAAAATAGAAGGGTTGGGG - Intergenic
1052354046 9:27486197-27486219 CACAGAGACTAGAAGGATTCAGG + Intronic
1052526776 9:29628959-29628981 CTCAGAAGACAGAAAGATGTGGG + Intergenic
1053358085 9:37464111-37464133 CACAGAAATCACAAGAGTTTAGG + Intronic
1053485010 9:38445794-38445816 CAAAAAAAGCAGAAGGATGTGGG + Intergenic
1054829237 9:69605068-69605090 AACATAAAACAGAATGATTTGGG + Intronic
1054903552 9:70394081-70394103 CATAGATAAAAGAAGAATTTGGG + Intronic
1055590624 9:77809490-77809512 CACAAAAAACAGATGGTTGTAGG - Intronic
1056316273 9:85393615-85393637 CACAGCAAGCCAAAGGATTTGGG + Intergenic
1057058912 9:91985706-91985728 TGCAGAAGACAGATGGATTTTGG + Intergenic
1057948168 9:99348043-99348065 AACAGAAAGAAAAAGGATTTGGG - Intergenic
1058292316 9:103257601-103257623 CACAGAAAACAGGAAGATGTGGG - Intergenic
1058317123 9:103581983-103582005 AAAAGAAAACAGAAAGATGTGGG - Intergenic
1059211809 9:112519684-112519706 CTCAAAGAACTGAAGGATTTGGG - Intronic
1060134374 9:121137677-121137699 CTCAGAAATCAGGAGGTTTTAGG + Intronic
1061312128 9:129770653-129770675 TGCAGAAAACAGATGGATCTTGG - Intergenic
1062112087 9:134787596-134787618 CACAGACCAGAGATGGATTTAGG - Intronic
1062113828 9:134796965-134796987 CAGAGAAAACAGGCGGGTTTTGG - Intronic
1186058160 X:5673508-5673530 CACAAAGAAAAGAAAGATTTGGG - Intergenic
1186308106 X:8286945-8286967 CACAGAAAACAAAAAGAGCTTGG + Intergenic
1186994746 X:15107919-15107941 CACAGAAAAAAGTAAGATATAGG - Intergenic
1187134898 X:16538696-16538718 CACAGAAATCAGGAATATTTAGG + Intergenic
1187379800 X:18790652-18790674 CACATAAAACAGAAAGAATTTGG - Intronic
1187845279 X:23529573-23529595 CATAGACAACAGAAGGAAATAGG + Intergenic
1188457048 X:30379155-30379177 CTCAGAAGACAGAAAGATGTGGG + Intergenic
1188483984 X:30662491-30662513 CACAGAAAACAGAAGGATTTTGG - Intronic
1188873224 X:35399221-35399243 CTCAGAAGACAGGAAGATTTGGG - Intergenic
1188918742 X:35945503-35945525 CAAAGAAAAAAGAAGTATTGGGG - Intronic
1188967408 X:36571754-36571776 CACAGAAAAAAAATGGACTTGGG + Intergenic
1189248258 X:39580153-39580175 CACAGAACACACAGGGATTATGG + Intergenic
1189459830 X:41231014-41231036 CACTGGAAAAAAAAGGATTTGGG + Intronic
1189781835 X:44522070-44522092 CAAAGAAAAAACAAGTATTTTGG + Intergenic
1189788625 X:44582651-44582673 CACAGAAGACAGGAAGATGTGGG + Intergenic
1190424484 X:50320158-50320180 TCCAGAAAACAGAAGGGTTGGGG - Intronic
1191188497 X:57639500-57639522 CTCAGAAGACTGAAAGATTTGGG + Intergenic
1191211544 X:57890134-57890156 CTCAGAAGACAGAAAGATGTGGG - Intergenic
1192103613 X:68291664-68291686 TTCAGAACACAGAAGGATGTGGG - Intronic
1192454475 X:71265734-71265756 GAGAGAAAAAAGAAAGATTTGGG - Intergenic
1192616273 X:72625987-72626009 CAAAGAAAACTTAAGTATTTAGG + Intronic
1192898602 X:75471007-75471029 AACAGAAAACAGATGGATTTTGG + Intronic
1193008045 X:76643280-76643302 CTCAGAAGACAGAAAGATGTGGG + Intergenic
1193085271 X:77443314-77443336 CAAAGAAAACAGAAGGAGAGAGG + Intergenic
1193198881 X:78665057-78665079 CTCAGAAGACAGGAAGATTTGGG + Intergenic
1193367016 X:80646809-80646831 CACAGGAGAAAGAAGGAGTTGGG - Intergenic
1193678307 X:84484055-84484077 CTCAGAAGACAGAAAGATGTAGG - Intronic
1193832836 X:86309207-86309229 TACAGAAGACAGATGGATCTTGG + Intronic
1193840782 X:86405566-86405588 CTCAGAAAACAGGAAGATGTGGG - Intronic
1193919777 X:87410786-87410808 CTCAGAAAACAGAAAGATGAGGG - Intergenic
1194054770 X:89117913-89117935 CTCAGAAGACAGAAAGATGTGGG - Intergenic
1194271098 X:91816893-91816915 AACAGAAAACTGAAGGGTATAGG - Intronic
1194461334 X:94173046-94173068 CACAAAAAAAATAAGTATTTGGG - Intergenic
1194850127 X:98859214-98859236 CTCAGAAGACAGAAAGATGTGGG + Intergenic
1196177318 X:112653504-112653526 CACAGAAAAAAGAAAGAGTTAGG + Intronic
1196811947 X:119635930-119635952 CACAGGAAACAGAGGTATTCAGG + Intronic
1197069021 X:122270905-122270927 CAGAGGAAACAGACGTATTTGGG - Intergenic
1197426543 X:126304344-126304366 CTCAGAAAACAGGAAGATATGGG + Intergenic
1197594537 X:128450236-128450258 CTCAGAAAACAGGAAGATGTGGG - Intergenic
1197822478 X:130555084-130555106 CTCAGACCACAGAATGATTTGGG - Intergenic
1197848509 X:130831057-130831079 CACACAAAACAGAGGGAATGGGG + Intronic
1199155125 X:144537557-144537579 CTCAGAAGACAGAAAGATGTGGG - Intergenic
1199306103 X:146269202-146269224 CTCAGAAGACAAAAGGATGTGGG + Intergenic
1199357076 X:146875099-146875121 CTCAGAAGACAGAAAGATGTGGG + Intergenic
1200588338 Y:5038333-5038355 AACAGAAAACTGAAGGGTATAGG - Intronic
1200976544 Y:9217600-9217622 TGCAGAAGACAGATGGATTTTGG + Intergenic
1201646191 Y:16235105-16235127 CACAGAACAGAGAAGAATGTGGG + Intergenic
1201656622 Y:16350212-16350234 CACAGAACAGAGAAGAATGTGGG - Intergenic
1202088529 Y:21163956-21163978 CACAGAAAACTGAGGGTTTGAGG + Intergenic