ID: 1188484120

View in Genome Browser
Species Human (GRCh38)
Location X:30663798-30663820
Sequence TGCTGTAATTAGAGTAATTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 481
Summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 451}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188484117_1188484120 28 Left 1188484117 X:30663747-30663769 CCACAGGAAACCTAGGCATGGAA 0: 1
1: 0
2: 4
3: 24
4: 231
Right 1188484120 X:30663798-30663820 TGCTGTAATTAGAGTAATTTTGG 0: 1
1: 0
2: 0
3: 29
4: 451
1188484116_1188484120 29 Left 1188484116 X:30663746-30663768 CCCACAGGAAACCTAGGCATGGA 0: 1
1: 0
2: 1
3: 19
4: 164
Right 1188484120 X:30663798-30663820 TGCTGTAATTAGAGTAATTTTGG 0: 1
1: 0
2: 0
3: 29
4: 451
1188484118_1188484120 18 Left 1188484118 X:30663757-30663779 CCTAGGCATGGAAACACTTTACT 0: 1
1: 0
2: 0
3: 12
4: 158
Right 1188484120 X:30663798-30663820 TGCTGTAATTAGAGTAATTTTGG 0: 1
1: 0
2: 0
3: 29
4: 451

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188484120 Original CRISPR TGCTGTAATTAGAGTAATTT TGG Intronic
900994506 1:6113162-6113184 TGCTGTAATCCCAGTATTTTGGG + Intronic
901604862 1:10451123-10451145 TGCTTTAATTAGAGAAAAGTTGG - Intronic
901755243 1:11437475-11437497 TCCTGTAATCACAGCAATTTGGG + Intergenic
903253138 1:22071489-22071511 TGCTGTGGTTTGAGTACTTTTGG + Intronic
903401796 1:23058268-23058290 TGCTGTAATTCCAGCACTTTGGG - Intronic
903642005 1:24866710-24866732 TGCTGTGATCAGTGTCATTTGGG - Intergenic
903944675 1:26954481-26954503 TCCTGTAATTTCAGTACTTTGGG - Intronic
904061470 1:27714376-27714398 TGCTGTAATTCCAGCACTTTGGG + Intergenic
904983415 1:34525281-34525303 TGCTGTGATGAGAATAAATTGGG - Intergenic
905942268 1:41873579-41873601 AGCTGAAATTAGATAAATTTAGG + Intronic
906219261 1:44065666-44065688 GCCTGTAATTACAGCAATTTGGG - Intergenic
907423907 1:54366491-54366513 TGCTGAAATTAAAGTAAACTAGG + Intronic
907466417 1:54640777-54640799 TGCTGTAATCCCAGCAATTTGGG - Intergenic
908273761 1:62447736-62447758 TGCTTTAATAAGTGTACTTTTGG + Intronic
909876740 1:80814984-80815006 TGCTGTAATTTTTGCAATTTGGG + Intergenic
910781391 1:90938914-90938936 AGCTGTAAAGAGAGTAATTAAGG - Exonic
911479508 1:98420045-98420067 TGGTGTATTTACATTAATTTGGG - Intergenic
913282557 1:117200140-117200162 GCCTGTAATTCCAGTAATTTGGG + Intronic
913593363 1:120350680-120350702 TGCTGTAATCAAATTAATTAGGG - Intergenic
913661899 1:121012167-121012189 TCCTGTAATTAGAATTATTGTGG + Intergenic
914013276 1:143795352-143795374 TCCTGTAATTAGAATTATTGTGG + Intergenic
914046106 1:144094227-144094249 TCCTGTAATTACAGCACTTTGGG + Intergenic
914077967 1:144374639-144374661 TTCTGTAATAATAATAATTTTGG + Intergenic
914093892 1:144528306-144528328 TGCTGTAATCAAATTAATTAGGG + Intergenic
914101212 1:144591862-144591884 TTCTGTAATAATAATAATTTTGG - Intergenic
914132004 1:144866460-144866482 TCCTGTAATTACAGCACTTTGGG - Intergenic
914164550 1:145165833-145165855 TCCTGTAATTAGAATTATTGTGG - Intergenic
914172876 1:145243174-145243196 TTCTGTAATAATAATAATTTTGG + Intergenic
914264602 1:146027608-146027630 TGCTGTAATTCCAGCACTTTGGG + Intergenic
914304634 1:146405598-146405620 TGCTGTAATCAAATTAATTAGGG - Intergenic
914363273 1:146954724-146954746 AGCTGTATGTAGAGTAATTCTGG - Intronic
914597423 1:149167231-149167253 TGCTGTAATCAAATTAATTAGGG + Intergenic
914651898 1:149703961-149703983 TCCTGTAATTAGAATTATTGTGG + Exonic
915179136 1:154042969-154042991 AGCTGTAATTCCAGCAATTTGGG - Intronic
915199079 1:154213045-154213067 GCCTGTAATTACAGCAATTTGGG + Intronic
915383850 1:155470809-155470831 TGCTGTAATTCCAGCACTTTGGG - Intronic
916317790 1:163469751-163469773 TGCTGTAGTTAGAGCAATTGCGG + Intergenic
917124750 1:171677154-171677176 TCCTGTAATTCCAGTACTTTGGG + Intergenic
917208207 1:172600755-172600777 TGCTTTAGTTAGAGTGATCTTGG + Intronic
918241334 1:182623099-182623121 TTCTATTATTAGAGAAATTTTGG - Intergenic
918903705 1:190461518-190461540 TCCTTCAATTAGATTAATTTTGG + Intronic
918911722 1:190581459-190581481 TCCTGTGACTAGGGTAATTTGGG + Intergenic
919066838 1:192702730-192702752 TGCTGTAATTCGAGCACTTTGGG + Intergenic
919402135 1:197131816-197131838 TGCTGTAATCCGAGCACTTTGGG - Intronic
919517030 1:198538643-198538665 TCCTGTAATTGCAGTAATTTGGG + Intronic
920532319 1:206712704-206712726 TGCTGTAATCCCAGTATTTTGGG + Intronic
921095927 1:211887274-211887296 TGTTGTAATCACAGCAATTTGGG - Intergenic
921398092 1:214690005-214690027 TGCTGTCCTTAGAGAAAGTTGGG + Intergenic
921667079 1:217885658-217885680 TGATGTAAGTATAGTAGTTTGGG + Intergenic
921697921 1:218233500-218233522 TTCTGTAAACAGAGTAACTTTGG + Intergenic
922128209 1:222750242-222750264 AGCAATAATGAGAGTAATTTTGG + Exonic
922388851 1:225117014-225117036 TGTTATAATGAGAGAAATTTAGG + Intronic
922428525 1:225522787-225522809 TGTTCTAATTAGAATAATATGGG - Intronic
922628755 1:227082304-227082326 GCCTGTAATCACAGTAATTTGGG - Intronic
923800184 1:237201568-237201590 TTCAGTGCTTAGAGTAATTTAGG + Intronic
924403733 1:243719275-243719297 TGAATAAATTAGAGTAATTTTGG - Intronic
1063532853 10:6852439-6852461 CGCTGTAATCAGAGCACTTTGGG + Intergenic
1063924133 10:10960926-10960948 TGCTGGACTTTGAGAAATTTAGG - Intergenic
1063924915 10:10967892-10967914 TGCTGTAATATGAGTTATTAAGG + Intergenic
1063992606 10:11582358-11582380 GCCTGTAATTCCAGTAATTTGGG - Intronic
1065574738 10:27105840-27105862 TGCTGTAATCCCAGTACTTTGGG + Intergenic
1066350372 10:34631566-34631588 TTATGAAATTAGAGCAATTTAGG - Intronic
1066387273 10:34951859-34951881 TGCTGTAATCACAGCACTTTGGG + Intergenic
1067121234 10:43473898-43473920 TCCTGTAATTGCAGTATTTTGGG + Intronic
1069050870 10:63792202-63792224 TGCAGTAGTTTGAGTAATATTGG - Intergenic
1069081318 10:64090987-64091009 TTCTCTTATTGGAGTAATTTGGG + Intergenic
1070014578 10:72513130-72513152 TGCTGTAATCGCAGTACTTTGGG - Intronic
1070101359 10:73390482-73390504 TGCTACAAGTAGAATAATTTTGG - Intronic
1072350545 10:94552926-94552948 TGCTGTAATTGGTGCAATTGTGG - Intronic
1074330152 10:112498895-112498917 TGGTGAAAATAGAATAATTTAGG - Intronic
1074582206 10:114730524-114730546 AGCTCTAATTTGTGTAATTTAGG - Intergenic
1074669438 10:115772874-115772896 TGCTGTGAGCAGAGAAATTTGGG + Intronic
1074836262 10:117298493-117298515 TGCTGTAATTACTATAATTTGGG - Intronic
1075695627 10:124432960-124432982 TCCTGTAATTCCAGCAATTTGGG + Intergenic
1078573539 11:12479557-12479579 TGCTGTAATCACAGTACTTTGGG - Intronic
1079863916 11:25711180-25711202 TGATGTAATCAGGGAAATTTTGG - Intergenic
1079980334 11:27144363-27144385 TGTTATAATTTGAGTAATTTGGG - Intergenic
1080866975 11:36204105-36204127 TTCTGTAGTTAAAGCAATTTGGG + Intronic
1081128828 11:39351249-39351271 GGCTGTAATCACAGTACTTTGGG - Intergenic
1081154295 11:39670023-39670045 TCCTGTAATCACAGTATTTTAGG - Intergenic
1081463684 11:43296598-43296620 TGATCAAATTAGAGTAATTGGGG - Intergenic
1082792564 11:57356845-57356867 TGATGCAATTAGAGTGATCTTGG + Intronic
1083040788 11:59684089-59684111 TTTTGTAATTAGAGTAATGTTGG - Intergenic
1084665176 11:70572417-70572439 GGCTGTAATTCGAGCACTTTGGG - Intronic
1084865030 11:72048777-72048799 TGCTGTTTTTAGAGGAGTTTTGG - Intronic
1085494777 11:76958806-76958828 TGCTATAATTGGTGAAATTTTGG - Intronic
1085999745 11:81967873-81967895 TGCAGTACTTACAGTAATTGAGG - Intergenic
1086023193 11:82257159-82257181 CTCTTTACTTAGAGTAATTTGGG - Intergenic
1086193964 11:84114927-84114949 TCCTGTAATTCCAGTATTTTAGG - Intronic
1086828658 11:91532433-91532455 TTCTGTAAATTGAGAAATTTTGG - Intergenic
1086845565 11:91745675-91745697 TGCTGAAATTAAATTGATTTGGG + Intergenic
1087851873 11:103040737-103040759 GGTTGTAACTAGAGTAGTTTAGG + Intergenic
1088043280 11:105415472-105415494 TTTTCTAATTAGAGTAATTTAGG - Intergenic
1089154070 11:116387076-116387098 TGCTGTAATTCCAGCACTTTGGG - Intergenic
1089835898 11:121370380-121370402 GCCTGTAATGAGAATAATTTGGG - Intergenic
1089854545 11:121531503-121531525 TGCTGTATGTTAAGTAATTTTGG + Intronic
1089878421 11:121748389-121748411 TGATTTATTTAGATTAATTTGGG + Intergenic
1089897473 11:121945843-121945865 TGTTGTAATTCGTGTTATTTTGG - Intergenic
1092580742 12:9838298-9838320 TCCTGGAATAAGAGGAATTTGGG - Intronic
1093190762 12:16072243-16072265 TACTGTAATAACATTAATTTAGG + Intergenic
1093258178 12:16898963-16898985 TGCTGTAAGTAGCGTACTTTGGG - Intergenic
1093343161 12:18004530-18004552 TTATGTTATTAGAGTAATGTTGG - Intergenic
1093407524 12:18823181-18823203 TCCTGTAATTCCAGCAATTTGGG - Intergenic
1094812456 12:34151712-34151734 TGCTGTAATTAAAATAAAGTAGG - Intergenic
1095214418 12:39530906-39530928 TCCTGTAATTCCAGTACTTTGGG - Intergenic
1095751193 12:45713038-45713060 TGCTGGAATTATAGGCATTTTGG + Intergenic
1096322567 12:50628109-50628131 CGCTGTAATTCCAGTACTTTGGG + Intronic
1097165090 12:57080223-57080245 TCCTGTAATTTCAGTAATTTGGG - Intronic
1097490802 12:60268783-60268805 TCCTGGAAATAGTGTAATTTAGG + Intergenic
1097670054 12:62525301-62525323 TTCTGTGACTAGAGAAATTTGGG + Intronic
1097965491 12:65575235-65575257 TCTTGTAATTAGAGTTCTTTGGG - Intergenic
1098015749 12:66103018-66103040 GGCTGTAGGTAGAGCAATTTTGG + Intergenic
1098383669 12:69896247-69896269 TGCTCTAAGTAGACTAATGTAGG + Intronic
1099260356 12:80373172-80373194 TGCTGTAATCACAGCACTTTGGG + Intronic
1099439010 12:82678553-82678575 AGCTGTAAGTAGAATTATTTGGG + Intergenic
1099749146 12:86749064-86749086 TGCTGAAATAAGAGTAGTTTAGG - Intronic
1100916872 12:99433867-99433889 TGCTCTAAATAGAGAACTTTTGG - Intronic
1101058866 12:100950007-100950029 GGATGAAATTAGGGTAATTTGGG - Intronic
1103583026 12:121930227-121930249 TGCTGTAATTCCAGCACTTTGGG + Intronic
1104571768 12:129932271-129932293 TGCTGTAATTCCAGCACTTTGGG + Intergenic
1105359319 13:19692373-19692395 TGCTGTAATCTGAGCACTTTGGG - Intronic
1105937110 13:25112228-25112250 TGCTGGTCTTATAGTAATTTTGG - Intergenic
1106074538 13:26446551-26446573 TGCTTTAATTAGAGTATCTGTGG - Intergenic
1106611337 13:31284804-31284826 TTCTGTAAATACAGTAAATTAGG + Intronic
1107078821 13:36352455-36352477 TGCAGTTATTAGAAGAATTTTGG - Intronic
1107687669 13:42920291-42920313 TGCTTTGTTTAGGGTAATTTTGG - Intronic
1107695273 13:42993628-42993650 TCCTGTAATTCCAGTACTTTTGG + Intergenic
1109704932 13:66077910-66077932 TGCTGAAATTAGTGTAAGTTTGG - Intergenic
1109916702 13:68997058-68997080 TGCTGCAAAAAAAGTAATTTGGG + Intergenic
1110127454 13:71964031-71964053 ACCTGTAATTAGAGCACTTTGGG - Intergenic
1110572149 13:77016788-77016810 AGCTATAATTGGAGTACTTTGGG - Intronic
1111264043 13:85783406-85783428 TTATGTAATTACAGTACTTTGGG + Intergenic
1112097196 13:96147289-96147311 AGCTGTGATTTGAGTGATTTGGG - Intronic
1112655072 13:101443658-101443680 TGCGGTAATGAGATGAATTTAGG - Intergenic
1112814603 13:103257138-103257160 TGGTGAAATCAGAGTAATTAGGG + Intergenic
1113021938 13:105896949-105896971 GGCTTTAATTAGAACAATTTCGG + Intergenic
1113726220 13:112604555-112604577 TTCTGTAATTACAGCACTTTGGG - Intergenic
1114544852 14:23491867-23491889 TCCTGTAATTACAGCACTTTGGG + Intronic
1115525886 14:34280188-34280210 TGCTGTAATTGTAATAGTTTGGG - Intronic
1115651776 14:35407453-35407475 TGCTGTAATTTCAGCACTTTGGG + Intergenic
1116092308 14:40325413-40325435 TTTTGATATTAGAGTAATTTTGG - Intergenic
1116395067 14:44437980-44438002 GCCTGTAATTACAGCAATTTGGG - Intergenic
1116691890 14:48118174-48118196 TGCTGTCATTTGGGTAATTTTGG + Intergenic
1117811405 14:59551178-59551200 TGATATAATTAAAGTACTTTGGG + Intronic
1117885610 14:60358544-60358566 GGCTGTAATTAGACTAACTGGGG + Intergenic
1118183576 14:63518501-63518523 CCCTGTAATTACAGTGATTTGGG - Intronic
1118271986 14:64352047-64352069 GGCTGTAATTCCAGTACTTTGGG + Intergenic
1120453284 14:84698878-84698900 TATAGTAATTAGAGAAATTTTGG - Intergenic
1120456087 14:84732074-84732096 TGCTGGGATTACAGTAAATTAGG + Intergenic
1122136223 14:99634515-99634537 TGCTGTAGTTAGAGAAGTATGGG - Intergenic
1122529101 14:102412647-102412669 TGCTGTAATTATTCAAATTTGGG - Intronic
1123190991 14:106569786-106569808 GCCTGTAATTTCAGTAATTTGGG + Intergenic
1123857967 15:24433819-24433841 AGCTGTAATTCCAGTACTTTGGG - Intergenic
1124111077 15:26788407-26788429 TGGTGTAAGTAGAGTATTTTTGG - Intronic
1124476743 15:30041295-30041317 TGCTGTAATCCCAGTAACTTGGG - Intergenic
1125526883 15:40382171-40382193 AGCTGTAATTATAGCACTTTGGG - Intergenic
1125994054 15:44139629-44139651 TGCTGTAATTCCAGCACTTTGGG + Intronic
1130453772 15:84083040-84083062 TGATGTACTTAGAATAAATTCGG + Intergenic
1130613692 15:85383463-85383485 AGCTGTAATGATAATAATTTTGG + Intronic
1130698574 15:86156178-86156200 GCCTGTAATTCCAGTAATTTGGG - Intronic
1130819580 15:87480226-87480248 TTTTGTAATTAGAGTGACTTAGG + Intergenic
1130974549 15:88763249-88763271 TGCTGTAATCCCAGTATTTTGGG - Intergenic
1132489350 16:217274-217296 AGCTGTAATTCCAGCAATTTGGG - Intronic
1132777374 16:1602680-1602702 TCCTGTAATTACAGCACTTTGGG + Intronic
1133535301 16:6696547-6696569 AGGTTTAATTCGAGTAATTTAGG + Intronic
1133962900 16:10510107-10510129 TGCTGTAATCACAGCATTTTGGG + Intergenic
1134358518 16:13507330-13507352 TGATGTGATTAGAGGCATTTTGG + Intergenic
1134511392 16:14850820-14850842 TGCTGTAATTCCAGCATTTTGGG + Intronic
1134699036 16:16249318-16249340 TGCTGTAATTCCAGCATTTTGGG + Intronic
1134972801 16:18545355-18545377 TGCTGTAATTCCAGCATTTTGGG - Intronic
1135333838 16:21584248-21584270 TGCTGTAATTCCAGCACTTTGGG + Intergenic
1135779739 16:25289854-25289876 TGCTGTAATCTGAGCACTTTGGG - Intergenic
1137051064 16:35713492-35713514 CTCTGTAATTAGAATTATTTGGG + Intergenic
1137276759 16:46939715-46939737 TGCTGTAATTCCAGCACTTTGGG + Intergenic
1137453928 16:48603732-48603754 GGTTGTAATCAGAGTAATTTCGG - Intronic
1137781532 16:51101643-51101665 TCCTGTAATTCCAGTACTTTGGG + Intergenic
1138175722 16:54896620-54896642 TGCTATAATCACAGTACTTTGGG + Intergenic
1138268443 16:55677538-55677560 GGCTGTAATTAAAGTAAGTAGGG - Intronic
1139604722 16:68009987-68010009 TCCTGTAATTCCAGCAATTTGGG - Intronic
1140278362 16:73531453-73531475 TCCTGTAATTACAGCACTTTAGG + Intergenic
1140298578 16:73733470-73733492 TACTTCAATTAGTGTAATTTGGG - Intergenic
1140646170 16:77032388-77032410 TGCTGTAATTCCAGCACTTTGGG - Intergenic
1142739702 17:1924441-1924463 TCCTGTAATTCAAGTACTTTAGG - Intergenic
1142882326 17:2891398-2891420 ACCTGTAATTACAGTACTTTGGG - Intronic
1143168912 17:4914769-4914791 GGCTGTAATTCCAGTACTTTGGG - Intergenic
1143874041 17:9978400-9978422 GTCTGTAATTTGGGTAATTTTGG + Intronic
1145287885 17:21520127-21520149 TGCTGTAATTTCAATACTTTGGG - Intergenic
1145362689 17:22225383-22225405 GCCTGTAATTACAGTACTTTGGG + Intergenic
1147008011 17:37420188-37420210 TCCTGTAATCACAGTACTTTGGG + Intronic
1147344674 17:39781725-39781747 TGCCCTAATTACAGTTATTTAGG - Intronic
1148064460 17:44858700-44858722 TGCTGTAATTGCAGCACTTTGGG - Intronic
1148917660 17:50996282-50996304 TGCTGTAACCAGAGCAATTCTGG - Intronic
1149052091 17:52317581-52317603 TGCTGTATTAAGAGAAATATAGG - Intergenic
1149725977 17:58895118-58895140 TGATGTTATTATTGTAATTTTGG + Intronic
1150120683 17:62599204-62599226 TGCTGTAATCCCAGCAATTTGGG - Intronic
1150882570 17:69047214-69047236 TGCTGTAATTCCAGCACTTTGGG - Intronic
1151734271 17:75929209-75929231 GCCTGTAATTACAGTATTTTGGG + Intronic
1153586721 18:6628870-6628892 TTGTATAATTAGAGTGATTTTGG - Intergenic
1154533417 18:15371594-15371616 GCCTGTAATTCCAGTAATTTGGG - Intergenic
1156306416 18:35881809-35881831 TCTTCTAATTAGAATAATTTTGG + Intergenic
1158138728 18:54233897-54233919 GCCTGTAATTACAGTACTTTGGG + Intergenic
1159288282 18:66381591-66381613 TGCTGTAATTCCAGCACTTTGGG - Intergenic
1159693183 18:71517907-71517929 TTCTGGAATTAGGGTGATTTTGG - Intergenic
1160102914 18:75939935-75939957 TCCTGTAATTGCAGTACTTTGGG + Intergenic
1160196925 18:76763235-76763257 TGCTGTAATTCCAGCACTTTGGG - Intergenic
1162036365 19:7941993-7942015 AGCTATAAACAGAGTAATTTAGG + Intronic
1162524554 19:11199887-11199909 TGCTGTAATTCCAGCACTTTAGG + Intronic
1163179775 19:15591024-15591046 TCCTGTCATTAGAGTAATAATGG + Intergenic
1163340370 19:16702468-16702490 TGCTGGAATTACAGGACTTTGGG - Intergenic
1165754949 19:38287584-38287606 GGCTGTAATTCCAGTACTTTGGG - Intronic
1166949698 19:46418442-46418464 TGCTGTGATGAAAATAATTTAGG - Intergenic
1167138561 19:47633460-47633482 GTCTGTAATTACAGTACTTTGGG - Intronic
1167877593 19:52427219-52427241 GCCTGTAATTTGAGTACTTTGGG + Intergenic
1202685659 1_KI270712v1_random:47640-47662 TCCTGTAATTACAGCACTTTGGG + Intergenic
927280552 2:21301726-21301748 TTCTGTAATTAAAGATATTTAGG + Intergenic
927408309 2:22797139-22797161 TGCTGTCTTTTGAGTAAGTTGGG - Intergenic
928238854 2:29569264-29569286 TGCTGTAATTATAGAAAGTCAGG - Intronic
929493188 2:42415933-42415955 GGCTGTAATCTGAGTACTTTGGG + Intronic
929683829 2:44017442-44017464 TCCTGTAATTCCAGCAATTTAGG + Intergenic
929833552 2:45372518-45372540 TACAGTAATTAAAGTAGTTTGGG + Intergenic
930138609 2:47928553-47928575 TTCTGCAATAAGAGTACTTTGGG + Intergenic
930319424 2:49835550-49835572 AGCTGTAATTACAGCACTTTGGG - Intergenic
930684755 2:54296017-54296039 TGCTGTAATTCGAGCACTTTGGG - Intronic
932912127 2:75817475-75817497 TGCTGTATTTGGGGTCATTTTGG + Intergenic
933046373 2:77542020-77542042 TGCTGTTATGAAATTAATTTGGG - Intronic
933378162 2:81507848-81507870 CACTGTCAATAGAGTAATTTAGG - Intergenic
933446143 2:82382002-82382024 TGCTGTAATCTCAGCAATTTGGG - Intergenic
934206026 2:89930772-89930794 TCCTGTAATCCCAGTAATTTGGG + Intergenic
934246063 2:90307193-90307215 TCCTGTAATTACAGCACTTTGGG - Intergenic
934262685 2:91489840-91489862 TCCTGTAATTACAGCACTTTGGG + Intergenic
935836066 2:107055266-107055288 AGCTGTAAATAGACTACTTTTGG + Intergenic
935868821 2:107422706-107422728 TTAGGTAATAAGAGTAATTTAGG + Intergenic
936597611 2:113864024-113864046 TCCTGTAATTATAGCATTTTGGG + Intergenic
936691465 2:114894341-114894363 TGTTTTAATTAGAGTTACTTAGG - Intronic
936779368 2:116013690-116013712 TCCTGTAATTCCAGCAATTTGGG - Intergenic
938591608 2:132742569-132742591 ATCTGTAATTACAGTAATATAGG - Intronic
938701858 2:133886629-133886651 TGCTCTAAGTAGGGTATTTTGGG + Intergenic
938713310 2:133994239-133994261 TCCTGTAATTACAGCACTTTGGG + Intergenic
939398183 2:141659161-141659183 TGCTGTAATTTTAGCACTTTGGG - Intronic
939422579 2:141992890-141992912 TGCTGAAATTACAGTGATTTAGG - Intronic
941988628 2:171533064-171533086 TGCTTTATTTAGAATTATTTGGG + Intronic
941989254 2:171539055-171539077 TGCTGTAATTTCAGCACTTTGGG - Intronic
942772667 2:179540787-179540809 TGCTATAATTAATGTAATCTGGG + Intronic
943202099 2:184841225-184841247 TCCTGTAATTGGAGTGAGTTAGG - Intronic
943542694 2:189237638-189237660 TGCTGATATTATAGTGATTTTGG + Intergenic
943590488 2:189790343-189790365 TGCTATAATGAGTGTAATGTTGG - Intronic
944215415 2:197249697-197249719 TGCTGTAATGAAAGACATTTTGG - Intronic
945001131 2:205352071-205352093 TGGTGTAATGAGAGTAAACTGGG - Intronic
945146193 2:206740811-206740833 AGCTGAAGTTAGAGTATTTTGGG + Intronic
945403024 2:209410835-209410857 TGTTTTAATTACTGTAATTTTGG - Intergenic
945594317 2:211773041-211773063 TGCTGTAATCCCAGAAATTTGGG - Intronic
945850290 2:214998219-214998241 AGCTATAAATACAGTAATTTTGG - Intronic
947208794 2:227686576-227686598 TCCTGTAATCCGAGCAATTTGGG - Exonic
947830041 2:233133190-233133212 TGCTGTAATTGCAGCACTTTGGG - Intronic
1169113994 20:3050968-3050990 TGCTGAAATAAGAGCAACTTTGG + Intergenic
1170337854 20:15290773-15290795 AGCTGTTATTTGAGTAAGTTGGG + Intronic
1173637477 20:44573205-44573227 TGCTGTCATTAGAGCAACTGAGG + Intronic
1174242581 20:49149590-49149612 TAGTGTAATTTGAGTTATTTTGG - Intronic
1175518790 20:59586385-59586407 TACTGGAATTAGAGTGAATTAGG - Intronic
1175983120 20:62751134-62751156 TCCTGTAATCACAGTATTTTGGG - Intronic
1177593357 21:23202511-23202533 TCCTGTAATTCCAGTACTTTGGG + Intergenic
1177626476 21:23667940-23667962 TGCACTCATTATAGTAATTTTGG + Intergenic
1177798533 21:25804770-25804792 TGCTGTAATTCCTGTACTTTGGG + Intergenic
1178188074 21:30247246-30247268 TGGAGTAATTAGAGTAATGAAGG + Intergenic
1178887600 21:36496167-36496189 TGCTGGAATTACAGGCATTTTGG - Intronic
1179067410 21:38038907-38038929 ATCTGTAATTACAGCAATTTGGG + Intronic
1181929807 22:26391690-26391712 TTCTGGAATTTAAGTAATTTGGG - Intergenic
1182482716 22:30619892-30619914 TCCTGTAATTCCAGTGATTTGGG + Intronic
1182561994 22:31167290-31167312 TGCTGTAATTCCAGCACTTTAGG - Intronic
1182995032 22:34804058-34804080 TGTTCCAAGTAGAGTAATTTGGG - Intergenic
1184180414 22:42819756-42819778 GGCTGTAAATAAAGTTATTTCGG - Intronic
1184224405 22:43120914-43120936 TGCTGTAATCCCAGTACTTTGGG + Intronic
1184366410 22:44054473-44054495 TGCTGTAATCTGAGCACTTTGGG - Intronic
1184640069 22:45865999-45866021 TGCTGTAATTGGAGTGACTTGGG + Intergenic
1185254088 22:49822446-49822468 TGCTGTAATTCCAGCACTTTGGG + Intronic
949983488 3:9519332-9519354 GCCTGTAATTCCAGTAATTTGGG - Intronic
951214422 3:20010540-20010562 TGCTGTAATTCCAGCACTTTGGG + Intronic
951231003 3:20179686-20179708 GGCTGTAATCAGAGCACTTTGGG - Intronic
951787679 3:26440811-26440833 TTCTCTAATTATACTAATTTAGG + Intergenic
951875579 3:27421052-27421074 TGCTGTAATTCCAGCACTTTGGG - Intronic
952061555 3:29516951-29516973 TCCTGTAATTCCAGCAATTTGGG + Intronic
953527876 3:43709741-43709763 GGCTATAATTAAAGGAATTTAGG + Intronic
954276981 3:49548725-49548747 GCCTGTAATTCCAGTAATTTGGG - Intergenic
954854684 3:53633912-53633934 TTCTTTAATTACAGTAATGTTGG - Intronic
956214138 3:66830992-66831014 GGCTGTTATGAGATTAATTTGGG - Intergenic
956432971 3:69206090-69206112 TCCTGTAATTCCAGTACTTTGGG + Intronic
956822831 3:72969266-72969288 TGCTGTAATCTGAGTGACTTGGG + Intronic
957276661 3:78098485-78098507 TTCTCTAATGAGTGTAATTTAGG - Intergenic
957411893 3:79852114-79852136 GCCTGTAATTCCAGTAATTTGGG + Intergenic
957745055 3:84329775-84329797 TGATGTTTTTATAGTAATTTGGG - Intergenic
958024044 3:88029048-88029070 TGCAGTAGTTAGATTAATGTTGG + Intergenic
958903073 3:99911056-99911078 TGCTGTAATTAGCCAATTTTAGG + Intronic
959612167 3:108307374-108307396 GGCTGTAATCTCAGTAATTTGGG + Intronic
959862524 3:111231725-111231747 TTCTGTCATTAGAGGTATTTGGG + Intronic
960303769 3:116036129-116036151 TGCTTTCATCAGAGTCATTTTGG - Intronic
963338326 3:144003026-144003048 TGCTGCAATTACAGCACTTTGGG - Intronic
963338329 3:144003033-144003055 TGCTGTAATTGCAGCACTTTGGG + Intronic
964185826 3:153941440-153941462 TGCTGTAATCCCAGCAATTTGGG + Intergenic
966613839 3:181893729-181893751 TTCTATCATTAGAGAAATTTTGG - Intergenic
966676418 3:182595018-182595040 TTCTGTAAAGAAAGTAATTTTGG - Intergenic
966929398 3:184665962-184665984 TGCTGTAATTCCAGCACTTTGGG + Intronic
967634853 3:191789639-191789661 TGCTGTAAGTTTAATAATTTTGG + Intergenic
969076762 4:4585368-4585390 TGCTGGAATTACAGCACTTTTGG + Intergenic
970559980 4:17273186-17273208 TCCTGTCATTAGAGGAATTTTGG - Intergenic
970794878 4:19899428-19899450 TGTTGACATGAGAGTAATTTTGG - Intergenic
971307607 4:25497248-25497270 ACCTGTAATTCCAGTAATTTGGG - Intergenic
971726218 4:30315843-30315865 AGCTGTAATTTCAGTACTTTGGG + Intergenic
972890269 4:43549375-43549397 TGCTGTAATTCCAGCACTTTGGG - Intergenic
973775615 4:54238704-54238726 TCCTGTAATCATAGTACTTTGGG + Intronic
973889948 4:55358798-55358820 TGTTATAATAAAAGTAATTTAGG + Intronic
973914192 4:55616785-55616807 TGCTGTTATTATGTTAATTTAGG - Intronic
974020968 4:56692099-56692121 TAATGTCATTAGAGTATTTTAGG + Intergenic
974035659 4:56815842-56815864 TCCTGTAATTCCAGTACTTTGGG + Intronic
975089675 4:70387296-70387318 AGGTGTCATTACAGTAATTTGGG + Intronic
975401778 4:73946311-73946333 TGCTGTCATTACAGTAATCCTGG + Intergenic
975755365 4:77566735-77566757 TGCTATAAAGAGGGTAATTTAGG - Intronic
975894042 4:79064825-79064847 TGCAATAATTTGGGTAATTTAGG + Intergenic
975900488 4:79146051-79146073 TTCTGTCACAAGAGTAATTTGGG - Intergenic
976730703 4:88258368-88258390 TGCTGTAATCCCAGCAATTTGGG + Exonic
977096322 4:92749253-92749275 TGCTGTAATCCCAGTACTTTGGG - Intronic
978130744 4:105193530-105193552 GGCAGTAGTTGGAGTAATTTAGG + Intronic
978374407 4:108059942-108059964 TCCTGTAATTCCAGTACTTTGGG - Intronic
978445382 4:108775505-108775527 ATCTGTAATTTGAGCAATTTGGG - Intergenic
978710926 4:111779830-111779852 TGCTGTAATTCCAGTACTTTGGG - Intergenic
980163600 4:129197643-129197665 GCCTGTAATTCCAGTAATTTGGG - Intergenic
980858861 4:138474848-138474870 TCCTATCCTTAGAGTAATTTAGG + Intergenic
983341090 4:166462186-166462208 TTCTGAAATTGTAGTAATTTGGG - Intergenic
984455802 4:179966304-179966326 TGCTTTACTTATGGTAATTTAGG - Intergenic
985235133 4:187864459-187864481 TGCTGAAATTATAATTATTTGGG - Intergenic
985806398 5:2047320-2047342 TGCTATAATGAGGGTAATTCTGG - Intergenic
986495106 5:8333492-8333514 TGCTGAAAATAGATTTATTTTGG + Intergenic
986520156 5:8606807-8606829 AACTTTAATTAGATTAATTTTGG + Intergenic
987179458 5:15351959-15351981 TGCTGTTATTAGAGTAGTGAAGG - Intergenic
987497450 5:18665918-18665940 TGCAATAATGAGAGTATTTTGGG + Intergenic
987637227 5:20559503-20559525 TGCTGAAAATTGAGTACTTTTGG - Intronic
987727480 5:21720835-21720857 TGCTATAATTGAAATAATTTGGG + Intergenic
987885743 5:23809184-23809206 TGCTGTAATCACAGAAATTTGGG - Intergenic
988229677 5:28459221-28459243 TACTGTACTTACAGTGATTTGGG - Intergenic
988394019 5:30673998-30674020 TTCTGTAATTCCAGTACTTTGGG + Intergenic
988820987 5:34885483-34885505 GTCTGTAATTCCAGTAATTTGGG + Intronic
989276950 5:39600443-39600465 TCCTGTCATTAGAGTCAGTTGGG + Intergenic
990493010 5:56320419-56320441 TGCTGTTTTTGGTGTAATTTTGG - Intergenic
991268698 5:64753031-64753053 TGCAGTAATTAGAATTCTTTAGG - Intronic
991702838 5:69332267-69332289 TGTTGACATTAGAGGAATTTGGG - Intronic
991974601 5:72173866-72173888 AGCTGTAATCACAGTACTTTGGG + Intronic
992031082 5:72722173-72722195 TGCTGTAATCCCAGTAGTTTGGG + Intergenic
992425331 5:76651129-76651151 TGAGGTAGTCAGAGTAATTTTGG - Intronic
993390770 5:87317893-87317915 GCCTGTAATTATAGAAATTTGGG - Intronic
993448457 5:88043892-88043914 AGCTGTAATTACAGACATTTTGG - Intergenic
993470302 5:88299530-88299552 TGCTGTAATCCCAGTAGTTTTGG - Intergenic
995668947 5:114578240-114578262 TGATGTAATGATTGTAATTTTGG - Intergenic
996171510 5:120297956-120297978 TCCTGGAAGTAAAGTAATTTTGG + Intergenic
996458083 5:123708046-123708068 TCCTGTAATCCCAGTAATTTGGG - Intergenic
997000451 5:129753222-129753244 TGCTGTAATTCCAGCACTTTGGG + Intronic
998699511 5:144681996-144682018 GGCTGTGAGTAGAGTACTTTTGG + Intergenic
998728552 5:145047101-145047123 TGCTCTAATTAAATTAAATTGGG + Intergenic
998769681 5:145527974-145527996 TTCTGAAATGAGAGTAATTATGG - Intronic
999290919 5:150425508-150425530 TGCTGTAATTCTAGCACTTTGGG + Intergenic
1000478160 5:161738001-161738023 TGTTATTACTAGAGTAATTTAGG + Intergenic
1000684845 5:164235737-164235759 TGCTGTAAAAAAATTAATTTTGG - Intergenic
1000840156 5:166208267-166208289 GCCTGTAATTCCAGTAATTTGGG + Intergenic
1002555234 5:180032494-180032516 TGCTGTAATTACAGCACTTTGGG - Intronic
1002701211 5:181126359-181126381 GGCTTTATTTGGAGTAATTTGGG - Intergenic
1004709810 6:18158825-18158847 TGCTGTTATTGGACTAGTTTGGG + Intronic
1004830576 6:19473292-19473314 TGCTGTGAATGGAGTAAGTTTGG + Intergenic
1006322332 6:33327160-33327182 TGCTGTAATTCCAGCACTTTGGG + Intronic
1006692868 6:35904877-35904899 ACCTGTAATTCTAGTAATTTGGG + Intronic
1007061323 6:38943172-38943194 TGCTTTAAGAAGATTAATTTGGG + Intronic
1008038268 6:46770461-46770483 TCCTGTAATCACAGTAATTTGGG + Intergenic
1008111036 6:47494899-47494921 TGTTGTAATCTGAGTACTTTGGG + Intronic
1008481930 6:51994840-51994862 TCCTGTAATTCCAGTACTTTGGG - Intronic
1008509365 6:52261818-52261840 TACTGTAGTTAAAATAATTTGGG - Intergenic
1010753042 6:79636040-79636062 TCGTGTTATTAGAGTAACTTAGG - Intronic
1010881644 6:81181922-81181944 TGCTGTAATTATGGAGATTTAGG + Intergenic
1011042790 6:83049330-83049352 TGCTGGAATTAGATAAATTCAGG + Intronic
1011281272 6:85680179-85680201 GTCTGTAATTAGAGCACTTTTGG + Intergenic
1012464164 6:99499033-99499055 TCCTGTAATCAGAGCACTTTGGG - Intronic
1012678741 6:102152396-102152418 ATCTGTAATTTGAGCAATTTGGG + Intergenic
1012727454 6:102833208-102833230 TGATGTTATTATTGTAATTTTGG + Intergenic
1013550341 6:111201788-111201810 TTCTGTAAATAAAGTGATTTGGG + Intronic
1013950702 6:115778079-115778101 TCCTGTAATTCCAGTACTTTGGG + Intergenic
1014410888 6:121118909-121118931 TGATGTAGTCAGTGTAATTTGGG + Intronic
1014516925 6:122390860-122390882 TACTGTAAATAGAGAAAATTTGG + Intergenic
1014821283 6:125990985-125991007 TCCTGTAATTCCAGTACTTTGGG + Intronic
1015391783 6:132690503-132690525 AGCTCTACTTAGATTAATTTGGG - Intronic
1015401440 6:132792857-132792879 TCCTGTAATTCCAGCAATTTAGG + Intronic
1015964876 6:138688209-138688231 ACCTGTAATTACAGTACTTTGGG - Intronic
1017296221 6:152797776-152797798 TGTTTTCATTAGAGTCATTTTGG + Intergenic
1017697579 6:157032784-157032806 TGATGTACTTAGAATATTTTTGG - Intronic
1018637749 6:165879334-165879356 TGCTGTAGTTTGAGCAATTTTGG + Intronic
1018696515 6:166395707-166395729 TTCTGTCATTAGCATAATTTTGG - Intergenic
1019877214 7:3824474-3824496 TGCTGTAATTAGTTTAAAATCGG + Intronic
1019992983 7:4705089-4705111 TGCTGTAATCCCAGTACTTTGGG - Intronic
1020974331 7:14986590-14986612 TGATGTAATTTTAATAATTTAGG + Intergenic
1021158182 7:17237743-17237765 TGCTGTAATCACAGAACTTTGGG - Intergenic
1021592118 7:22274587-22274609 TGCTGTAATCCCAGTACTTTAGG - Intronic
1023075335 7:36476252-36476274 TGCTGAACTTACAGTATTTTAGG - Intergenic
1023714299 7:43027939-43027961 TGCTTTAATTAGACTACCTTAGG + Intergenic
1024828832 7:53424284-53424306 TGGTGTAATTTGAGTTATTTTGG + Intergenic
1025614914 7:63109912-63109934 TGTTTTAATTATAGTAATTCTGG - Intergenic
1025739871 7:64185653-64185675 TGATGTAATTATACTACTTTGGG - Intronic
1025964761 7:66258221-66258243 TGCTCTCATTTGAGTAATTTTGG + Intronic
1026114545 7:67485230-67485252 TTCTTGAATTAGAGTGATTTAGG + Intergenic
1026499634 7:70932892-70932914 TGCAGTATATAGATTAATTTGGG + Intergenic
1027157061 7:75775919-75775941 TGCTGTAATCCCAGTACTTTGGG - Intronic
1027870435 7:83700455-83700477 TGCTGTAATCCCAGCAATTTGGG + Intergenic
1028076520 7:86523356-86523378 AAATGTAATTAGAGTGATTTTGG - Intergenic
1030352250 7:108502564-108502586 GGCTGCAGTTAGAGAAATTTTGG - Exonic
1032182771 7:129695119-129695141 TACTGTAATTTGAGGAGTTTAGG + Intronic
1034025876 7:147703205-147703227 TGTTCTAATTAGAGTGATCTGGG - Intronic
1035810107 8:2484524-2484546 AGCTGTAATTCCAGCAATTTTGG - Intergenic
1036098972 8:5756506-5756528 ACCTGTAATTACAGTACTTTGGG + Intergenic
1036210849 8:6839991-6840013 TGCTGTGATTAGAGCAGTTCAGG + Intergenic
1037412445 8:18613083-18613105 TGATGTAGTGAGAGTCATTTTGG - Intronic
1038148525 8:24920604-24920626 TGCTGTCATTGGAGTCAGTTTGG - Intergenic
1038727846 8:30096895-30096917 TGCTGTAATTAGAGACCATTAGG + Intronic
1039305862 8:36261968-36261990 GGCTGTAATTACAGCACTTTGGG + Intergenic
1039315943 8:36372230-36372252 GCCTGTAATCAGAGCAATTTGGG - Intergenic
1039697969 8:39932347-39932369 TGATTTAATTAGAGTAATTCAGG - Intergenic
1039699877 8:39951237-39951259 TGCAGTCATTGCAGTAATTTTGG - Intronic
1039830707 8:41211597-41211619 TGCTGCAATTACAGCACTTTGGG + Intergenic
1040353674 8:46594130-46594152 TGCTGTATTTAGAATACTGTGGG - Intergenic
1042152766 8:65806418-65806440 TGCTGGAATTAGAGTAGTAAAGG + Intronic
1042571566 8:70171091-70171113 TACTGTTATTTGGGTAATTTAGG - Intronic
1044398764 8:91744965-91744987 AGCTATATTTAGAGGAATTTGGG - Intergenic
1044889475 8:96817872-96817894 TGCTGTAATCCCAGCAATTTGGG - Intronic
1046434565 8:114170259-114170281 TGAAGAAATTAGAGTGATTTAGG + Intergenic
1046472145 8:114689921-114689943 GCCTGTAATTACAGTACTTTGGG + Intergenic
1050267963 9:3910907-3910929 TTCTGTATTGAGAGTAATTAAGG - Intronic
1052142244 9:25001692-25001714 TGCTGTAATATGAGTAATATTGG - Intergenic
1052169128 9:25372257-25372279 TGCTGTAATCCCAGCAATTTGGG + Intergenic
1052275205 9:26667483-26667505 TGCTGTAATCCTAGTATTTTGGG - Intergenic
1052928959 9:34040411-34040433 TGTTGTAATTACAGATATTTTGG - Intronic
1052931832 9:34061989-34062011 TCCTGTAATTCCAGTACTTTGGG + Intergenic
1053581473 9:39409099-39409121 TGCCGTTATTAGAATCATTTTGG + Intergenic
1053845952 9:42237132-42237154 TGCCGTTATTAGAATCATTTTGG + Intergenic
1054103054 9:60967851-60967873 TGCCGTTATTAGAATCATTTTGG + Intergenic
1054583300 9:66938964-66938986 TGCCGTTATTAGAATCATTTTGG - Intergenic
1055357320 9:75450808-75450830 TGCTGTGATGAGAGGTATTTGGG - Intergenic
1055730407 9:79274675-79274697 TGCTGTAGTGAGAGAAATTTAGG - Intergenic
1055965349 9:81860470-81860492 TACTGTATTTAGAGTACTTGGGG + Intergenic
1056742273 9:89267787-89267809 TGCTGTAATCCGAGTCACTTGGG - Intergenic
1057776330 9:98013284-98013306 ACCTGTAATCCGAGTAATTTGGG - Intronic
1057833627 9:98426735-98426757 TGCTGTAATTCTAGCACTTTGGG + Intronic
1058639721 9:107071187-107071209 TACAGTTCTTAGAGTAATTTAGG + Intergenic
1060086748 9:120710167-120710189 ACCTGTAATTACAGTACTTTGGG + Intronic
1060126081 9:121048139-121048161 TTTTGTAATTAGAAAAATTTAGG + Intronic
1060133211 9:121125457-121125479 TGCTGTAAAAAGTTTAATTTCGG - Intronic
1061703449 9:132433891-132433913 GCCTGTAATTACAGTACTTTGGG + Intronic
1185946094 X:4378062-4378084 ACCTGTAATTCGAGTACTTTGGG - Intergenic
1185995842 X:4947887-4947909 TTCTCTTATTAGAGTAAATTGGG + Intergenic
1187777556 X:22779446-22779468 TGCTGTAATTTAAGTAATGAAGG - Intergenic
1188224984 X:27586218-27586240 TGCTGGAAAGAGTGTAATTTGGG + Intergenic
1188484120 X:30663798-30663820 TGCTGTAATTAGAGTAATTTTGG + Intronic
1189777019 X:44479384-44479406 TACTGCAATTTGAGTATTTTAGG - Intergenic
1190065295 X:47236835-47236857 AGCTGTAAATATAATAATTTGGG + Intronic
1191648706 X:63511903-63511925 TGCTGTAATTCAATTAATTAGGG - Intergenic
1191682671 X:63857342-63857364 TGCAGTAATTAGGGCAAGTTGGG + Intergenic
1191845089 X:65541100-65541122 ACCTGTAATTCCAGTAATTTGGG - Intergenic
1192307336 X:69975788-69975810 TGCTGAAATTAAAATAGTTTAGG + Intronic
1192604809 X:72505555-72505577 TGCTGTAATTCCAGCACTTTGGG + Intronic
1193136862 X:77981548-77981570 TGCTGTAATCCCAGTACTTTGGG + Intronic
1193618241 X:83716903-83716925 TCCTGTAATTCCAGAAATTTGGG - Intergenic
1194261196 X:91698603-91698625 TTCTGTAATTTCAGTCATTTTGG + Intergenic
1195482131 X:105357883-105357905 ACCTGTAATTCCAGTAATTTGGG + Intronic
1195903361 X:109820955-109820977 TGCTGTAATTCCAGCACTTTGGG - Intergenic
1196066106 X:111466121-111466143 TGCTATAAGTAGAGTAATAAAGG + Intergenic
1196331702 X:114478261-114478283 TGCTGAAATTCCAGTACTTTGGG + Intergenic
1197526910 X:127575517-127575539 AGCTGTAATTCAAGAAATTTGGG + Intergenic
1197950241 X:131887336-131887358 GCCTGTAATTCGAGTACTTTGGG + Intergenic
1197960910 X:132005135-132005157 TGCTGTAATTATAAGAATGTAGG - Intergenic
1198035018 X:132793318-132793340 TGCTGTAATCCCAGTACTTTGGG - Intronic
1198689639 X:139266834-139266856 AGCTGTCATTAGATTAATTAGGG - Intergenic
1200579845 Y:4937404-4937426 TTCTGTAATTTCAGTCATTTTGG + Intergenic
1200936854 Y:8745820-8745842 TTATGTAATTAAAGTAATGTGGG + Intergenic
1201533699 Y:15022125-15022147 TGCTGTAATCCCAGTATTTTGGG - Intergenic
1201546751 Y:15173347-15173369 GCCTGTAATTACAGTACTTTGGG - Intergenic
1201784863 Y:17764150-17764172 CGCTGTAATTAAAGTTAATTGGG - Intergenic
1201816689 Y:18141837-18141859 CGCTGTAATTAAAGTTAATTGGG + Intergenic
1201853451 Y:18515001-18515023 TGCTGTCATTAGAGTTCATTGGG + Intergenic
1201879870 Y:18805383-18805405 TGCTGTCATTAGAGTTCATTGGG - Intronic