ID: 1188484171

View in Genome Browser
Species Human (GRCh38)
Location X:30664529-30664551
Sequence TAGTAGTGCTAAAATTGTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 130}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188484167_1188484171 23 Left 1188484167 X:30664483-30664505 CCACCACGCCCGGCAAAACTTGC 0: 1
1: 1
2: 18
3: 297
4: 6013
Right 1188484171 X:30664529-30664551 TAGTAGTGCTAAAATTGTAGAGG 0: 1
1: 0
2: 0
3: 5
4: 130
1188484170_1188484171 14 Left 1188484170 X:30664492-30664514 CCGGCAAAACTTGCTATATTTTA 0: 1
1: 0
2: 2
3: 32
4: 401
Right 1188484171 X:30664529-30664551 TAGTAGTGCTAAAATTGTAGAGG 0: 1
1: 0
2: 0
3: 5
4: 130
1188484169_1188484171 15 Left 1188484169 X:30664491-30664513 CCCGGCAAAACTTGCTATATTTT 0: 1
1: 0
2: 1
3: 38
4: 473
Right 1188484171 X:30664529-30664551 TAGTAGTGCTAAAATTGTAGAGG 0: 1
1: 0
2: 0
3: 5
4: 130
1188484168_1188484171 20 Left 1188484168 X:30664486-30664508 CCACGCCCGGCAAAACTTGCTAT 0: 1
1: 0
2: 4
3: 41
4: 777
Right 1188484171 X:30664529-30664551 TAGTAGTGCTAAAATTGTAGAGG 0: 1
1: 0
2: 0
3: 5
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188484171 Original CRISPR TAGTAGTGCTAAAATTGTAG AGG Intronic
903407347 1:23108941-23108963 CAGTAGTGGCAAAATTATAGTGG + Intronic
906916890 1:50022210-50022232 TTGTAGAGCTTACATTGTAGTGG + Intronic
907028375 1:51145059-51145081 TAGTAGTTCTCAAACTTTAGGGG - Intronic
907876876 1:58498280-58498302 TAGGAATGCAAAAATGGTAGAGG - Intronic
912875888 1:113359120-113359142 TAGTAGTTTCAAAATTTTAGTGG - Intergenic
913035640 1:114962848-114962870 TTGTAGTGCTAACTTGGTAGTGG + Intronic
924167431 1:241299094-241299116 TAGTAGCGTTAAAATTAAAGTGG - Intronic
1068049399 10:51930177-51930199 TAGAATAGTTAAAATTGTAGAGG + Intronic
1073380260 10:103072818-103072840 AAGTAGAGCTAAAACCGTAGTGG - Intronic
1078791779 11:14550384-14550406 TTGGAATCCTAAAATTGTAGTGG + Intronic
1079405886 11:20145392-20145414 TAGTGGTGGTGAATTTGTAGGGG + Intergenic
1080498132 11:32841918-32841940 TAGTGGTTCTAAAATTCTATTGG + Intronic
1081034444 11:38124468-38124490 TAGTAGTGATACAATGATAGAGG - Intergenic
1083715563 11:64573614-64573636 TCGTAGTCCTAGATTTGTAGTGG - Intergenic
1085850075 11:80109680-80109702 TAGTAGTGCTAAAAGTGTTAAGG + Intergenic
1086940424 11:92792073-92792095 TAGGAGTGGTAAAATGGTGGTGG - Intronic
1087367257 11:97236084-97236106 TATGAGTGCAAAAATTTTAGAGG + Intergenic
1088525809 11:110753015-110753037 TTGTAGTGCTGACATGGTAGTGG + Intergenic
1089820825 11:121224672-121224694 GAGTAGTATTAATATTGTAGGGG + Intergenic
1095895459 12:47276041-47276063 TAGTAGTAGTATAATTATAGTGG - Intergenic
1098373378 12:69783954-69783976 TAGTGGTGTTATAATTGTGGTGG - Intronic
1099180281 12:79468184-79468206 TATTACTGCCAAAATTGCAGGGG + Intergenic
1099180972 12:79472528-79472550 TAGTAATCCCAATATTGTAGGGG + Intergenic
1100492677 12:95096512-95096534 CAGTAATGCTAGAATAGTAGCGG - Intronic
1100935976 12:99666519-99666541 TTGTAGGGGTAAATTTGTAGGGG + Intronic
1111741796 13:92214569-92214591 CAGTAGTGCACAAATTCTAGAGG - Intronic
1111983088 13:95037781-95037803 TAATAGGACTCAAATTGTAGTGG - Intronic
1112044434 13:95581779-95581801 TAGTAGTCTTAAAATTGAATTGG - Exonic
1117935882 14:60906455-60906477 TAGTCCTGCTAAGATGGTAGTGG + Intronic
1118108761 14:62692540-62692562 TATTATAGCTTAAATTGTAGGGG - Intergenic
1120389511 14:83888224-83888246 TAGAAGTGGAAAAATTGTAAAGG - Intergenic
1126234016 15:46361509-46361531 TAATAGAGCTAAAACTGTAATGG - Intergenic
1127014676 15:54670290-54670312 TTGTAGTGCTGACTTTGTAGTGG - Intergenic
1128905146 15:71460883-71460905 CTGTAGTGCTTAAATAGTAGGGG - Intronic
1148426575 17:47602978-47603000 TAGTTGCGTTAAAATTGTAGGGG + Intronic
1158389324 18:57031756-57031778 TAGCACTGCTCGAATTGTAGGGG + Exonic
1159681781 18:71362922-71362944 TGGTAGTGCGAAACTTGCAGAGG - Intergenic
1159799891 18:72885349-72885371 TATTAATGATAAAACTGTAGTGG + Intergenic
1161743197 19:6037740-6037762 TAGTAAGTCTAAAATTGAAGAGG - Intronic
1163259828 19:16182173-16182195 TAGTAGTGCTAAATATGCTGTGG - Intergenic
1163278355 19:16300061-16300083 TAGTATTCCCAATATTGTAGGGG - Intergenic
1164484614 19:28644257-28644279 CAGTAGTGCTTCAGTTGTAGTGG - Intergenic
1165133681 19:33649973-33649995 TAGTAGTATAAAAAGTGTAGGGG + Intronic
925546502 2:5022578-5022600 TAGTAGTATTAAAGTAGTAGTGG - Intergenic
928737811 2:34312874-34312896 TTTTAGTGCTAAAATTGTTCAGG - Intergenic
930469746 2:51796976-51796998 TTGTAGTGCTGACATGGTAGTGG - Intergenic
931062415 2:58546147-58546169 TAATTGAGCTAAAATTGAAGAGG - Intergenic
931924678 2:67058501-67058523 TAGAAATGCTAAAATGATAGAGG + Intergenic
933110936 2:78399072-78399094 TTGTAGTGCTAACTTGGTAGTGG - Intergenic
933883966 2:86700439-86700461 TACTAGTGCTAAATTGGGAGAGG + Intronic
936874938 2:117177267-117177289 TAGAAGTGCCAAAGATGTAGGGG - Intergenic
939434637 2:142159056-142159078 TATTAGTTCTAAAATTGTTTTGG - Intergenic
939811195 2:146834556-146834578 CAGTAGAGCTCAAATTGAAGTGG + Intergenic
940060667 2:149563010-149563032 TTTTAATGGTAAAATTGTAGAGG - Intergenic
941086959 2:161129118-161129140 AGGTAGTTCTAAAAGTGTAGAGG - Intergenic
942537844 2:176984253-176984275 CAGTAGAGCTAATATTCTAGTGG + Intergenic
942835755 2:180295032-180295054 TAGTAATGCTAAAAAGTTAGTGG - Intergenic
942983812 2:182114743-182114765 TAGTAATGCCACAATTGTATAGG + Intronic
945108156 2:206336716-206336738 TATTAGTGCTAAAATTAGGGAGG + Intergenic
948221781 2:236275708-236275730 TGATAGTACTAAAATAGTAGGGG + Intergenic
1169713149 20:8587100-8587122 TAATTGTGCCAAAATTGTAAGGG + Intronic
1173626701 20:44478180-44478202 TAGACGTGCTAGAAATGTAGAGG + Intronic
1175700474 20:61133179-61133201 AAGTATTGCTAAAAATGTACAGG + Intergenic
1176927961 21:14773251-14773273 TAATAATACAAAAATTGTAGTGG - Intergenic
1181422950 22:22814383-22814405 TAGTGGTGCTAAAACTGAATTGG - Intronic
1182190705 22:28457381-28457403 TGGTGGTGCTAAAATCGTTGAGG - Intronic
949141280 3:636358-636380 TAGAAGTACTAAAAATGAAGAGG + Intergenic
949194474 3:1288916-1288938 TAATAATAATAAAATTGTAGAGG + Intronic
951194582 3:19809620-19809642 TAAAAGTGCAAAAATTGTAATGG - Intergenic
951200346 3:19869526-19869548 TAGTAGTGGCAAGATTGTAAAGG + Intergenic
951253357 3:20419837-20419859 TAGAACTTCTAAATTTGTAGGGG + Intergenic
957475985 3:80724873-80724895 TAGTTGTGGCAAAATTTTAGGGG + Intergenic
958997358 3:100920147-100920169 TAGTGTTGGTAAAATTGTAGAGG - Intronic
959601540 3:108191741-108191763 TGGTAGTGTTAAAATTATAGTGG + Intronic
961957690 3:130821088-130821110 TAGCAGTGATGTAATTGTAGTGG + Intergenic
961974719 3:131011281-131011303 TAGTGGTGATAAAATTATACTGG - Intronic
963704825 3:148672946-148672968 CAGTAGTGTTAAAAATATAGTGG + Intergenic
965617679 3:170611642-170611664 TAGTAGAGCTCACATTGTGGCGG - Intronic
967244775 3:187475220-187475242 TAGTAGTACAAAAATTATATAGG + Intergenic
970168014 4:13260371-13260393 TAATAGTCCTAAAATTATATTGG + Intergenic
970630358 4:17936304-17936326 TGGTAGTTCCAAAATTCTAGTGG - Intronic
970783570 4:19768575-19768597 GAGTAGTGGAAACATTGTAGTGG + Intergenic
971750486 4:30640768-30640790 AAATGGTGCTAAAATTGGAGAGG + Intergenic
972076309 4:35092990-35093012 TTGTTGAGCTAAAATTCTAGAGG - Intergenic
972916634 4:43889079-43889101 AAGTATTTCCAAAATTGTAGTGG - Intergenic
974926403 4:68304036-68304058 TGGAAATGCTAAAATTGTATTGG + Intergenic
977751317 4:100613206-100613228 TAGTAATGCAATAATAGTAGGGG - Intronic
979085105 4:116398701-116398723 TAACAGTTCTAAAATTGTAATGG + Intergenic
980270948 4:130583002-130583024 TAGCAGTGGTAAATTTGTATGGG + Intergenic
983293229 4:165832690-165832712 TTCTAGTGCTAAAAGTATAGAGG + Intergenic
984483762 4:180338961-180338983 TTGTGGTGCTAATATTCTAGTGG - Intergenic
987209050 5:15659870-15659892 TAATAGTGCTTATATTGTGGAGG + Intronic
990803385 5:59631221-59631243 TAGTAGTGCTTAAATGGTTTAGG + Intronic
991990443 5:72333410-72333432 TAGTAGAGCTTAAATTCTGGTGG - Intronic
997682978 5:135769203-135769225 TATTACTCCTAATATTGTAGGGG + Intergenic
997726219 5:136121863-136121885 TAGTAGTTCTAGAACTGTTGGGG + Intergenic
1001694928 5:173662991-173663013 TAGTAGTGGGTAAACTGTAGGGG + Intergenic
1005114038 6:22316838-22316860 TACAAGTGTTAAAATTGTGGTGG + Intergenic
1005487050 6:26310614-26310636 GAGTAGGGCTAAAATTTCAGAGG + Intergenic
1008938757 6:57021820-57021842 CAGTGGTGCTAAAATGGTGGGGG + Intronic
1009363804 6:62842730-62842752 TATTAGTCCCAAAATTGAAGTGG + Intergenic
1009448812 6:63777002-63777024 AAGTAATGATAAAATTATAGTGG + Intronic
1014030172 6:116692189-116692211 TACTATTGCTAAAATTATTGAGG - Intronic
1015271998 6:131345919-131345941 AAGTATTGCTAATATTGAAGTGG + Intergenic
1017201657 6:151761115-151761137 TAGTAGTGGGAAAATGGTATTGG - Intronic
1018404851 6:163468957-163468979 TAGTACAGCTGAAATTGTCGAGG - Intronic
1019566913 7:1687774-1687796 TAGTAATGCTAAAATTTAAAAGG - Intergenic
1019839033 7:3420537-3420559 TAGTCGTGCTAATCTTTTAGGGG + Intronic
1020693196 7:11384213-11384235 TAATAGTCTTAAAATTGTTGAGG - Intronic
1022243741 7:28536967-28536989 CAGTACAGCTAATATTGTAGGGG - Intronic
1023673758 7:42607763-42607785 TAGTAGTTGGAAGATTGTAGGGG + Intergenic
1024380676 7:48692413-48692435 TGGTATTCCTAAAATAGTAGTGG - Intergenic
1027130946 7:75590981-75591003 TAGTAGTTCTCAACTGGTAGAGG + Intronic
1028490681 7:91408021-91408043 TAGTGGTGATAAAATTCCAGAGG + Intergenic
1030375043 7:108745008-108745030 TAGTACCACTACAATTGTAGTGG + Intergenic
1030884141 7:114918601-114918623 TAGTAGTACTTAAACAGTAGTGG + Intergenic
1031672052 7:124561247-124561269 AAAAAGTCCTAAAATTGTAGTGG + Intergenic
1033014135 7:137654455-137654477 TGGTAGTGATAGAATTGAAGGGG - Intronic
1036982859 8:13490245-13490267 TAGAAGTGAAAAAATTGAAGAGG + Intronic
1037472260 8:19222444-19222466 TAATAGTGGTGAAATTGGAGAGG + Intergenic
1038712390 8:29959722-29959744 TAGTACTGCAATAATCGTAGAGG - Intergenic
1039335922 8:36589314-36589336 TAGTAGTGTGAAACATGTAGTGG - Intergenic
1047547208 8:125829877-125829899 TAATAGTGCTTACCTTGTAGAGG + Intergenic
1050386804 9:5099592-5099614 TGGTAGGCCTAGAATTGTAGGGG - Intronic
1051044988 9:12862171-12862193 TAGGAGTGATAAAATAGAAGTGG - Intergenic
1058694439 9:107547564-107547586 TAGAAATGCTAAAATTGTGGAGG - Intergenic
1059286697 9:113178966-113178988 TAGTAGTAATATAATTGTATAGG - Intronic
1059510165 9:114837557-114837579 TAGTAGTAATAAAGTAGTAGTGG - Intergenic
1060265251 9:122108367-122108389 TAGGATTGATAAAATTGTTGAGG + Intergenic
1185482513 X:458426-458448 TATCAGTGCTAAAATCATAGGGG - Intergenic
1188484171 X:30664529-30664551 TAGTAGTGCTAAAATTGTAGAGG + Intronic
1189567375 X:42256630-42256652 TAGTAGTGCTAGCTTGGTAGTGG - Intergenic
1189618456 X:42810245-42810267 TCATAGTGCCAAAACTGTAGGGG + Intergenic
1193771742 X:85595408-85595430 TTGTAGTGCTAACTTGGTAGTGG - Intergenic
1197676182 X:129333301-129333323 TACTAGTTATAAAATTGTATTGG - Intergenic
1198712642 X:139522515-139522537 TTGTAGTGCTGACTTTGTAGTGG - Intergenic