ID: 1188485777

View in Genome Browser
Species Human (GRCh38)
Location X:30680431-30680453
Sequence GGGGTTGGTGAGGATATAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 357
Summary {0: 1, 1: 0, 2: 3, 3: 34, 4: 319}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188485767_1188485777 13 Left 1188485767 X:30680395-30680417 CCAACCTTAAAGCTTGTGTTCTA 0: 1
1: 0
2: 0
3: 13
4: 140
Right 1188485777 X:30680431-30680453 GGGGTTGGTGAGGATATAGAGGG 0: 1
1: 0
2: 3
3: 34
4: 319
1188485768_1188485777 9 Left 1188485768 X:30680399-30680421 CCTTAAAGCTTGTGTTCTAATTT 0: 1
1: 0
2: 1
3: 18
4: 348
Right 1188485777 X:30680431-30680453 GGGGTTGGTGAGGATATAGAGGG 0: 1
1: 0
2: 3
3: 34
4: 319

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188485777 Original CRISPR GGGGTTGGTGAGGATATAGA GGG Intronic
901454414 1:9354911-9354933 GGGGATGGTGAGGCCAGAGAGGG + Intronic
901704532 1:11063397-11063419 GAGGATGGTGAGCACATAGAGGG - Intergenic
903097363 1:20990253-20990275 GTGGTTGCTGAGGATTGAGATGG - Intronic
903537290 1:24075439-24075461 GAGGTTGGTGTGGATGAAGAGGG - Exonic
903821798 1:26108861-26108883 TGGGTTGGAGGGGATAGAGATGG - Intergenic
904006103 1:27364147-27364169 GGGGCTGGTGAGGGTATGGTGGG - Intronic
905150098 1:35920448-35920470 GGGGTGGGAGAGGAGGTAGATGG + Exonic
908940250 1:69423720-69423742 GAGGTTGGAGAGGATGTGGAAGG - Intergenic
909679316 1:78274197-78274219 GGAGTTTGTGAGCATATAAATGG - Intergenic
909873642 1:80777755-80777777 GAAGTTGGTGAGTATTTAGAGGG - Intergenic
910087148 1:83417179-83417201 GGTTTTGGTGAAGACATAGAGGG + Intergenic
910794309 1:91082458-91082480 GTGGTTGGTGATGATAAAGATGG + Intergenic
913142519 1:115955541-115955563 CAGGTTGGTGTGGGTATAGAGGG + Intergenic
913303783 1:117401468-117401490 TGGATTGGGGTGGATATAGAGGG + Intronic
913446769 1:118958652-118958674 GGGGCTGGTGGGAATATGGAAGG - Intronic
913543031 1:119840028-119840050 GGGGCTGGTGAGTTTATCGAGGG + Intergenic
916321411 1:163509046-163509068 GGTATTGATTAGGATATAGAAGG - Intergenic
916647245 1:166797843-166797865 GGGGTTGGTGAGCATGGGGAGGG - Intergenic
916841945 1:168609855-168609877 GAGGTTGCTGAGGAGACAGAGGG + Intergenic
917029527 1:170673537-170673559 GGGAGTGGTTAGTATATAGATGG - Intronic
918918855 1:190678466-190678488 GGTGGTGGTGAAGATACAGAGGG + Intergenic
919341120 1:196308285-196308307 GGGGAAGGAGAGGATACAGATGG - Intronic
919728180 1:200897070-200897092 TGGGTTGGTGAGGAGGGAGAGGG + Intronic
922996717 1:229969992-229970014 GCTGTTGGTGGGAATATAGATGG + Intergenic
923064810 1:230507964-230507986 TGGGTTGGTTTGCATATAGAAGG + Intergenic
924716976 1:246584756-246584778 GGAGTTGGGGAGCATATAGAAGG - Intronic
1062962219 10:1581122-1581144 TGTATTGGCGAGGATATAGAGGG - Intronic
1063025108 10:2170408-2170430 GGGGGTGGTGAGGATAAAAGGGG - Intergenic
1063613102 10:7579904-7579926 GGTGTTGTTGAGGATCTTGAGGG + Exonic
1064913507 10:20429775-20429797 AGAGTTGGTGAGGATGTTGATGG + Intergenic
1067828709 10:49597720-49597742 GGGGTGGGTGAGGAAACAGCTGG - Intergenic
1068841496 10:61619746-61619768 GGGGTGGGTGGGGAGAAAGAGGG - Intergenic
1069588805 10:69629747-69629769 AGGGTAGGTAAGGATAGAGAAGG - Intergenic
1069862549 10:71480681-71480703 GGGGCTGGTGAGGAAACAGATGG + Intronic
1072461260 10:95620969-95620991 GGGGCTGGTGTGGATATTGGAGG - Intronic
1072728549 10:97829597-97829619 GGGATTGGTGAGGATCAGGATGG + Intergenic
1074403099 10:113157895-113157917 GGGGTTTGTGTGGATGGAGATGG + Intronic
1074420998 10:113308999-113309021 GGGAATGGGGAGGAAATAGATGG + Intergenic
1075161180 10:120025809-120025831 GGGGTTAGTGAGGTGAGAGATGG + Intergenic
1075631765 10:124004668-124004690 AGGGTTGGTGAGGACAGAGATGG + Intergenic
1078758529 11:14233626-14233648 GCTGGTGCTGAGGATATAGAAGG + Intronic
1079036654 11:17025994-17026016 GGAGTTGGCTAGGATACAGAGGG - Intergenic
1083653874 11:64219825-64219847 GGGGTTGGTCTGCATATGGAGGG + Intronic
1083756798 11:64796296-64796318 GCGGTTGGTGGGGATGGAGAGGG + Exonic
1083781058 11:64917530-64917552 GTGGTTGGGGAGGATTTAAAGGG + Intergenic
1085204085 11:74719925-74719947 AGGGTTGGTGAGGATAGGGCGGG - Intronic
1086778134 11:90865827-90865849 GGGGTTGGTGGGGACATCCAGGG - Intergenic
1088542518 11:110928152-110928174 GGGGGTGGGGAGGAGAGAGATGG - Intergenic
1091160214 11:133413103-133413125 GGGGATGGTGGGGATGTGGAGGG + Intronic
1091668849 12:2438235-2438257 GGGGATGGTGATGATAATGATGG + Intronic
1091844825 12:3647807-3647829 GGGAATGGTGAGGAAACAGAAGG - Intronic
1091953497 12:4615635-4615657 GGGCTCTGTGAGGATATAGAGGG + Exonic
1092272797 12:7036979-7037001 GGGTTTGGGGAGGACACAGATGG + Intronic
1092721567 12:11446430-11446452 GGGGTTGGAGGACATATAGAAGG - Intronic
1092881251 12:12889465-12889487 TGGGTTTTTGAGGATATAGTTGG + Intergenic
1093117638 12:15231334-15231356 GGGGTTGGTGTGGGTAGATAAGG + Intronic
1093729109 12:22547720-22547742 GGGGTTGGGGGGGAGAGAGATGG - Intergenic
1093779147 12:23113712-23113734 GGGGTTGGTGAAATTATAGCTGG + Intergenic
1095158091 12:38882897-38882919 GGGGTTGGTGAGGAAATTTTGGG - Intronic
1097386966 12:58961901-58961923 GGGGTGGGTGAGTAGCTAGATGG - Intergenic
1097552991 12:61099020-61099042 GGGTGTGATGGGGATATAGATGG + Intergenic
1099338159 12:81391914-81391936 AGGGTGGGAGTGGATATAGATGG + Intronic
1099488857 12:83262350-83262372 GGGGTTCTTGAGGTTATGGAGGG - Intergenic
1100503263 12:95194613-95194635 GGGGTGGGTGTGGGTATAAAAGG + Intronic
1100503377 12:95195779-95195801 GGGGTGGGTGTGGGTATAAAAGG + Intronic
1101040647 12:100751915-100751937 GGAGCTGGTGAAGATATAGTTGG + Intronic
1101679261 12:106948937-106948959 GGGATTGGTGAAGATAGACAAGG - Intergenic
1103908352 12:124338935-124338957 TGGGTGGGTGAGAGTATAGATGG - Intronic
1106569587 13:30915150-30915172 GTGGGGGGTGAGGATACAGAGGG - Intronic
1110535812 13:76649595-76649617 AGTGTTGGTGAGGACATGGAGGG - Intergenic
1112733484 13:102393651-102393673 GTGGTTGGTGCTGAAATAGATGG - Intronic
1112912393 13:104503572-104503594 GGGGATGGTGAGGGGATATATGG + Intergenic
1114453690 14:22842359-22842381 GGGGTGTGTTAGGATAAAGAGGG - Intronic
1115513736 14:34164467-34164489 GGCTTTGGTGAGGAAACAGAGGG + Intronic
1119358941 14:74031680-74031702 GGGATTGGTGAAGAAAGAGATGG - Intronic
1121026186 14:90617931-90617953 GGGGTTGGTGAGGTTGTAGCAGG + Exonic
1121488556 14:94341258-94341280 GGGATTGGTGGGGATGGAGAAGG + Intergenic
1121510010 14:94505509-94505531 GGGGTTGCAGAGGAGACAGAAGG + Intronic
1122029112 14:98899718-98899740 GTGGTTGGTGAAGACATAGCCGG - Intergenic
1122453622 14:101832754-101832776 GGGGTGGATGAGGACACAGAGGG - Intronic
1124350086 15:28948893-28948915 GGGGTTGGTGAGGATAGGCAGGG + Intronic
1127005080 15:54559705-54559727 GGGGATGTAGAGGATAAAGAGGG + Intronic
1128108107 15:65058975-65058997 GGGGGTGGTGAGGACATGGGGGG + Intronic
1128315228 15:66655615-66655637 GGGGCTGGGGAGGATCTTGATGG - Intronic
1129254474 15:74326421-74326443 GGGGTTGCTGTGGAGAGAGAGGG - Intronic
1130104521 15:80919467-80919489 GGGGGTGGTGAGGCTCTATAGGG - Intronic
1130610647 15:85357841-85357863 GGGCTTGGAGAAAATATAGAAGG + Intergenic
1130693171 15:86104178-86104200 GGTATTGGGGAGGATAAAGATGG + Intergenic
1130785663 15:87093133-87093155 CAGGTTGGTGATGCTATAGATGG + Intergenic
1130913366 15:88285959-88285981 TGGGTGGGTGAGTAGATAGATGG - Intergenic
1132998252 16:2835309-2835331 TGGGTGGGTGAGGGGATAGATGG + Intronic
1133872318 16:9700975-9700997 AGGGTTGGTCAGGATGCAGAGGG + Intergenic
1134292743 16:12915490-12915512 GGAGTTGGTGACCATCTAGATGG + Intronic
1136536204 16:30901262-30901284 GAGGTTGGGGAGGATAGGGAAGG + Intronic
1136686059 16:31995637-31995659 GGGACTGGTGAGGATGTAGTTGG + Intergenic
1136786672 16:32939166-32939188 GGGACTGGTGAGGATGTAGTTGG + Intergenic
1136883098 16:33914624-33914646 GGGACTGGTGAGGATGTAGTTGG - Intergenic
1137983789 16:53091128-53091150 GGGGTTGGTGTGGATCCAGATGG - Intronic
1138499188 16:57428360-57428382 CAGGTTGGTGAGCATTTAGAGGG - Exonic
1138607737 16:58099609-58099631 GGGGCTGCAGAGGATAGAGACGG - Intergenic
1139705990 16:68741040-68741062 GGGGGTGGTGATGATGGAGATGG + Intronic
1140722620 16:77785009-77785031 GGGGTGGGGGGGGATGTAGAAGG - Intergenic
1141606485 16:85156872-85156894 TGGGTTGGTGGGTATATGGATGG - Intergenic
1141676280 16:85519218-85519240 GGTGATGGTGATGATACAGATGG - Intergenic
1142159032 16:88547480-88547502 GGGGAAGGTGAGGAGACAGAGGG + Intergenic
1142254373 16:89006815-89006837 GGGAGTGGGGAGGAGATAGAGGG - Intergenic
1203088908 16_KI270728v1_random:1200836-1200858 GGGACTGGTGAGGATGTAGTTGG + Intergenic
1142478616 17:204553-204575 GGGATGGGTGAGGAGATGGATGG - Intergenic
1143940758 17:10538722-10538744 GGCATTGCAGAGGATATAGAAGG - Intronic
1144624952 17:16839827-16839849 GGGGTTGGTCAGCTCATAGAGGG + Intergenic
1145233032 17:21188801-21188823 GAGGTTGGTGTGGATGTAGCCGG - Exonic
1145399742 17:22521706-22521728 TGGGTTGGTGAGGCCAAAGATGG - Intergenic
1146135775 17:30319663-30319685 GGGGTGGGTGAGGGAAGAGAGGG + Intronic
1146418485 17:32660088-32660110 GGTGGTGGAGAGGATATACAGGG - Intronic
1147139249 17:38452278-38452300 GGGGTTGGGGGGGAGATGGAGGG - Intronic
1147147021 17:38491305-38491327 GGGACTGGTGAGGATGTAGTTGG + Intronic
1147337387 17:39735786-39735808 GGGGTTGGGGAGGAGGGAGAGGG - Intergenic
1147627433 17:41909194-41909216 GGGGTTGCAGAGGAGATGGAAGG - Intronic
1147917300 17:43896449-43896471 GGTGATGGTAGGGATATAGATGG - Intronic
1147919368 17:43906844-43906866 GGGGGCGGTGCGGATAAAGACGG - Intronic
1148024902 17:44580233-44580255 GGGGTTTGTGGGGAGACAGATGG - Intergenic
1148457934 17:47820982-47821004 GGGGATGGTGAGGCTTTAGGGGG - Intronic
1151980602 17:77506338-77506360 GGGGTAGGTGAGGGGAGAGAGGG + Intergenic
1152659356 17:81535294-81535316 GGGGGTGGTGGGGATGGAGATGG - Intronic
1152659409 17:81535453-81535475 GGGGGTGGTGGGGATGGAGATGG - Intronic
1152659469 17:81535657-81535679 GGGGATGGTGGGGATGGAGATGG - Intronic
1152659546 17:81535879-81535901 GGGGATGGTGAAGATGGAGATGG - Intronic
1153185675 18:2483465-2483487 GGGATTCCTGAGGAAATAGAGGG - Intergenic
1153990137 18:10389459-10389481 GCTGTTGGTGAAAATATAGACGG - Intergenic
1156761737 18:40600222-40600244 AGGCTTAGTGAGAATATAGAAGG + Intergenic
1157085558 18:44577061-44577083 GGCAATGGAGAGGATATAGAGGG - Intergenic
1157321849 18:46640819-46640841 GACGTTGGAGAGGAGATAGAGGG - Intronic
1158368662 18:56771549-56771571 GGGGTGGGGGAGGGTAGAGATGG - Intronic
1158445059 18:57512305-57512327 GGGGGTGGTGCGGAGAGAGATGG - Intergenic
1158480559 18:57818005-57818027 CGGGATGGTGATGATAGAGATGG - Intergenic
1158565373 18:58550437-58550459 GGGGTTGTATATGATATAGATGG - Intronic
1158565384 18:58550491-58550513 GGGGTTGTATATGATATAGATGG - Intronic
1158712405 18:59849029-59849051 GGGGGTGGTGGGGGTAGAGATGG + Intergenic
1159772709 18:72566169-72566191 GGTGTTGGCCAGGATATGGAGGG + Intronic
1161287614 19:3477066-3477088 GGGGTGGGTGAGTGAATAGATGG + Intronic
1161794149 19:6376674-6376696 CGGCTTGGTGAGGAAAGAGATGG + Intronic
1162309167 19:9895021-9895043 GGGGGTGGGGAGGATGGAGATGG - Intronic
1163786493 19:19277475-19277497 GGGGTGGGTGAGGGTACAGATGG - Intronic
1164451308 19:28367748-28367770 GGGGTTGGTGAAGATACAGGAGG - Intergenic
1164720598 19:30429077-30429099 GGGGTGGAGGAGGCTATAGAGGG + Intronic
1165783912 19:38449814-38449836 GTGGTTGGTGAGGAAAGAGAGGG + Intronic
1165794687 19:38511990-38512012 GCGGTTGGGGTGGATGTAGAGGG + Intronic
1166293673 19:41878749-41878771 GGGGTGGGTGAGGATATCCTGGG - Intronic
1166698444 19:44867702-44867724 GGGGCTGGTGAGGATAGGCAAGG + Intronic
1167262829 19:48468739-48468761 GGGGATGGGGAGGGCATAGATGG + Intronic
1167266610 19:48485911-48485933 GGGGTAGGTGAGGACAGAGAGGG - Intronic
1167358618 19:49018355-49018377 CGGGATGGTGAGGATACAGCTGG + Intergenic
1167366310 19:49056610-49056632 CGGGATGGTGAGGATACAGCTGG + Intronic
1167636703 19:50659782-50659804 GGGGTTGGGGAGGGTGTAGGGGG - Intronic
1167742137 19:51330102-51330124 GGGGTGGGTGTTTATATAGAGGG - Exonic
926853466 2:17226655-17226677 GGGGGTGGTGAGGAGAGGGAGGG + Intergenic
927931052 2:27044578-27044600 CGGGTTGGGGAGGAAATATATGG - Intronic
928457394 2:31434893-31434915 GGGGATGATTAGGATAAAGATGG + Intergenic
928610332 2:32986244-32986266 GATGTTGGTGAGGAGATGGATGG + Intronic
928707693 2:33968153-33968175 GGGGTTAGTGATGCTATAAAAGG - Intergenic
930695125 2:54403411-54403433 GGGGTTTGTGGGGAGAGAGAGGG - Intergenic
930762398 2:55050377-55050399 GGGGTTGGGGAGGACTGAGAGGG + Exonic
931800038 2:65749204-65749226 CCGGTAGGTGAGGAGATAGATGG + Intergenic
932224395 2:70028250-70028272 GGGGTAGGTGTGGAAATAGATGG + Intergenic
932779963 2:74553816-74553838 GGGGATGGAGAGGATGTGGAGGG - Intronic
934775330 2:96933656-96933678 GGGGTTGGGGAGGATAAGAATGG - Intronic
935284512 2:101552272-101552294 GGAGCTGGTGGGGATATAGACGG - Intergenic
936286632 2:111186351-111186373 GGGGGTGGCGCGGATAAAGATGG + Intergenic
937839492 2:126511281-126511303 GAGGGTGGTGAGGAAAGAGAGGG - Intergenic
938218759 2:129546964-129546986 GGGGTGGGAGAAGGTATAGATGG - Intergenic
938847902 2:135230497-135230519 AGTGCTGGTGAGTATATAGAAGG - Exonic
939427477 2:142058173-142058195 GGGGTTGCTGAGGGTGGAGAAGG - Intronic
940010509 2:149049851-149049873 GGGGATGGGGAGGATTCAGAGGG + Intronic
942232501 2:173873417-173873439 GGGGTAGGAGAGCATAGAGAAGG + Intergenic
944101144 2:196029381-196029403 AGGGTGGGTGAGGAGGTAGAAGG + Intronic
945112382 2:206372891-206372913 AGTGTTGGTGAGGATGTGGAGGG - Intergenic
946040673 2:216780724-216780746 GAGGATGGTGAGGATGTGGAAGG + Intergenic
947758854 2:232588660-232588682 GGGGCTGGTGAGGATGTTGCAGG - Intergenic
1169561198 20:6802711-6802733 GGGGTTTGTGAGGAAATAATGGG + Intergenic
1169848154 20:10018618-10018640 GGTGTTGGTGAGGATGTGGATGG - Intronic
1170950312 20:20930754-20930776 GGGGATGGTGAGGATAGGGAGGG - Intergenic
1170950319 20:20930774-20930796 GGGGATGGTGGGGATAAGGAGGG - Intergenic
1170950327 20:20930794-20930816 GGGGATGGTGGGGATAGGGAGGG - Intergenic
1170950336 20:20930814-20930836 GGGGATGGTGGGGATAGGGAGGG - Intergenic
1170950345 20:20930834-20930856 GGGGATGGTGGGGATAGGGAGGG - Intergenic
1170950354 20:20930854-20930876 GGGGATGGTGGGGATAGGGAGGG - Intergenic
1170950371 20:20930894-20930916 GGGGATGATGGGGATAGAGAGGG - Intergenic
1170950377 20:20930914-20930936 GGGGATGGTGGGGATAGAGAGGG - Intergenic
1170950384 20:20930934-20930956 GGGGGTGGTGAGGATAGAGAGGG - Intergenic
1171213489 20:23334979-23335001 GGGTTTGGTGAGGATGCAGAAGG - Intergenic
1172603316 20:36198155-36198177 GGGGCTGGTGGGGATGGAGAGGG + Intronic
1173162696 20:40664251-40664273 GGGGATGGGGAGGATGGAGACGG - Intergenic
1173211648 20:41038171-41038193 TGGGGTGGTGGGGATGTAGAGGG - Intronic
1174192172 20:48748370-48748392 GGGGTTGGGGAGGGACTAGATGG - Intronic
1174289245 20:49496020-49496042 TTGGTTGCTGAGTATATAGATGG - Intergenic
1174700467 20:52603324-52603346 GGGGTTGTGAAGGATACAGAGGG - Intergenic
1174871098 20:54183128-54183150 AGTGTTGGGGAGGATGTAGAGGG - Intergenic
1175996141 20:62813110-62813132 GGGGTTGAGGAGGACACAGAAGG + Exonic
1176350861 21:5795389-5795411 GGGGTGGGTGAGGAAGTAGGAGG - Intergenic
1176357675 21:5915973-5915995 GGGGTGGGTGAGGAAGTAGGAGG - Intergenic
1176545182 21:8193459-8193481 GGGGTGGGTGAGGAAGTAGGAGG - Intergenic
1176564133 21:8376504-8376526 GGGGTGGGTGAGGAAGTAGGAGG - Intergenic
1178614954 21:34124561-34124583 GGGAGTGCTGAGGAGATAGACGG - Intronic
1182241992 22:28923581-28923603 GGTGATGGTGAGTATATGGAGGG - Intronic
1182403741 22:30105821-30105843 GGTGATGGGGAGGATATTGATGG - Intronic
1183043532 22:35201575-35201597 GGGGTTGGAGAAGGTATAGAAGG + Intergenic
1183123492 22:35751549-35751571 GGAGGTGGTGAGGAAAAAGAGGG - Intronic
1183521613 22:38298941-38298963 GGTGTTGCAGAGGATAGAGAAGG + Intronic
1184110635 22:42392063-42392085 GGGAGTTGTCAGGATATAGATGG + Intronic
1184131291 22:42518262-42518284 GGGGTTGGTGAAGGGATGGATGG - Intronic
1184141513 22:42580474-42580496 GGGGTTGGTGAAGGGATGGATGG - Intergenic
1184249032 22:43249805-43249827 GGGGGTGGCCAGGACATAGATGG + Intronic
1203250052 22_KI270733v1_random:109697-109719 GGGGTGGGTGAGGAAGTAGGAGG - Intergenic
949395722 3:3613029-3613051 TAGGTTGGTGAGGATGCAGAGGG + Intergenic
949968334 3:9379276-9379298 TGGGTGGGTGGGGATGTAGAGGG - Intronic
950583142 3:13876066-13876088 GGGGGTGGTGAGGAAAGTGAGGG + Intronic
951293208 3:20899908-20899930 GGGGATGGGGAGGAGATTGAGGG - Intergenic
951667592 3:25144394-25144416 GGGGTTGGTGAGGAGCTACAAGG + Intergenic
953883303 3:46702403-46702425 GGGGTTAGGGAGGCTACAGATGG - Intronic
954264448 3:49461687-49461709 GGGGTTGGGGAGGAGAGAGCAGG - Intergenic
958045851 3:88282701-88282723 GGGGTTGGTGAGGATAGGAATGG + Intergenic
958102261 3:89027761-89027783 GGGTTTGGTGAGAATATAGAAGG + Intergenic
959884332 3:111481286-111481308 AGGCTTTGTGAGGATATAGGTGG - Intronic
960428116 3:117534069-117534091 GTGGTTGGGGAGGGTAGAGATGG + Intergenic
960631631 3:119737955-119737977 AGAGTTGGTTAGGATTTAGAGGG + Intronic
960885553 3:122390532-122390554 GGGGTTGGAAAGGATATTTATGG + Intronic
961475924 3:127146324-127146346 TGGGTTGGTGAGTAGATAGTTGG + Intergenic
961475942 3:127146388-127146410 TGGGTTGGTGAGTAGATAGGTGG + Intergenic
962109083 3:132423340-132423362 AGGGTTGGTGAGGTTATGAATGG + Intronic
963057681 3:141200765-141200787 TGGATTGGTGAGTAGATAGATGG + Intergenic
964261407 3:154842322-154842344 GGGGAGGGTGAGGACATATAGGG - Intergenic
966186800 3:177234753-177234775 AGTGATGGTGAGAATATAGATGG - Intergenic
968183177 3:196612376-196612398 AGGGTAGGTGAGGCTAGAGATGG - Intergenic
970902750 4:21178570-21178592 GGGGTTGGTGATGATATTTAAGG + Intronic
972108767 4:35527876-35527898 AGGGTTGGTCAGGAGATACATGG - Intergenic
972200444 4:36708231-36708253 GTGTTTTGTGAGGATGTAGAAGG - Intergenic
972774704 4:42230243-42230265 GGGGTTGGTGAGGTCACACAGGG + Intergenic
973249465 4:48046417-48046439 GGGGTTGATGACAATATAGAGGG + Intergenic
975123981 4:70761168-70761190 GGTGTTTGGGAGGATATACATGG + Intronic
976381099 4:84399958-84399980 TGGATTTGGGAGGATATAGAGGG + Intergenic
977573707 4:98656274-98656296 GGGGGTGGTAAGGAAATAAAAGG - Intronic
978772705 4:112473843-112473865 CGGGTTGGTCAGGAGACAGAAGG - Intergenic
980098395 4:128517147-128517169 GGGGGTGGGGAGGACAGAGAAGG - Intergenic
981883492 4:149644931-149644953 AGTGTAGGTGAGGATACAGAAGG - Intergenic
982844000 4:160226445-160226467 GGGGAAGGGTAGGATATAGATGG + Intergenic
983143221 4:164179172-164179194 GGAGCTGGTGATGAGATAGAGGG + Intronic
983168593 4:164510090-164510112 GGTGTTGGTAAGGAGATGGAAGG + Intergenic
985691133 5:1313231-1313253 AGGGTTGGTGAGGATACAAAGGG + Intergenic
986094482 5:4541118-4541140 TGGGTGGGTGAGAATAGAGAAGG - Intergenic
986477983 5:8155006-8155028 GGGGTTGAGAAGGAAATAGATGG + Intergenic
987078040 5:14402732-14402754 GGTGGTGATGAGGGTATAGATGG + Intronic
987226327 5:15845400-15845422 GGGGTTGGTTAGTATGTAAAGGG - Intronic
990928203 5:61053823-61053845 GGTCTTGGTGTGGATATAAAGGG + Intronic
991294441 5:65065661-65065683 GGGGCTGGGGAGGATAGACAGGG - Intergenic
993563641 5:89444951-89444973 GAGGTTGGTGGGGATATGGGGGG - Intergenic
993901833 5:93589061-93589083 GCAGTTGGTGAGGTTATTGAGGG + Intronic
994832795 5:104808037-104808059 GGAGTTGGTAAAGATAAAGATGG + Intergenic
994916791 5:105991117-105991139 GGGTTTGGAGAAGATAGAGATGG - Intergenic
995016083 5:107310594-107310616 AGTGTTGGTGAGGATGTAAATGG + Intergenic
995747417 5:115418233-115418255 GGGGTTGCTAAGCTTATAGATGG + Intergenic
997298938 5:132788226-132788248 GGGGTTGGGGGGAATATAGAGGG + Intronic
998479239 5:142448090-142448112 AGTGTTGGTGAGGATATGGGAGG - Intergenic
999113779 5:149143494-149143516 GGGGTGTGTGAGGAAATAGTAGG - Intronic
999444684 5:151629936-151629958 GGGGTTGTTGAGGAGATTAAAGG - Intergenic
999452201 5:151686815-151686837 GGGGTTGGTGCAACTATAGAAGG + Intronic
1000610398 5:163367367-163367389 GGGGGTGGTCAGGAAGTAGAGGG + Intergenic
1001243130 5:170085385-170085407 AGGCTTGGTGTGGATAGAGATGG - Intergenic
1001406014 5:171478160-171478182 GGTGTTGGTGAGCATCTAGGAGG - Intergenic
1001904167 5:175457265-175457287 GGTGTTGGTGAGGATGTAGAGGG + Intergenic
1002685586 5:181006937-181006959 AGTGTTGGTGAGGATGTGGAGGG + Intergenic
1003793191 6:9570247-9570269 GAGGTTTGAGAGGATACAGAAGG - Intergenic
1004684297 6:17927782-17927804 TGGGATGGTGAGGATATGGGAGG + Intronic
1006264162 6:32903292-32903314 GGGATTGGTGATGTTATAAAAGG + Intergenic
1006299883 6:33188080-33188102 TGGGTGGGTGAGGAGAGAGAGGG + Intronic
1006420312 6:33929651-33929673 AGTGTTGGTGAGGATGTGGAAGG + Intergenic
1007310357 6:40940530-40940552 AGGGTGGGGGAGGATAAAGATGG + Intergenic
1007396418 6:41580567-41580589 AGGGTTGGAGAAGAAATAGAGGG - Intronic
1008029538 6:46678645-46678667 GGATTTGGTTAGGTTATAGAAGG - Intergenic
1008420921 6:51298285-51298307 TGGGTTGGTGAAGATGTAGTAGG - Intergenic
1008527613 6:52421847-52421869 GGTGTTGGTGAGTATAGACAGGG + Intronic
1008643284 6:53486693-53486715 GAGGTTGGTGTGGTTATAAAAGG - Intergenic
1010169844 6:72961666-72961688 AGGGTTGGTGGGGATTTGGACGG + Intronic
1012260339 6:97081142-97081164 AGGGTTGGTGAGGAGGTAGAAGG + Intronic
1012839843 6:104316359-104316381 GGGGTTGATGAAGATACAAAAGG + Intergenic
1013212524 6:107999783-107999805 GGGGTGGGATAGGATTTAGAGGG + Intergenic
1013418175 6:109943189-109943211 GGAGTTTGTGAGCATAGAGAAGG - Intergenic
1015450966 6:133365577-133365599 GGGTTTGGTCAGGATGCAGAAGG + Intronic
1016115080 6:140271012-140271034 GGTGATGGTGAGGATAGTGATGG + Intergenic
1016348915 6:143146489-143146511 GGGGGTGTTGGGGAGATAGAGGG - Intronic
1016704086 6:147086788-147086810 AGTGTTAGTGAGGATATAGAGGG + Intergenic
1018336353 6:162794108-162794130 AGTGTTGGTGAGGATATGGAGGG - Intronic
1018362746 6:163087889-163087911 AGTGTTGGTGAGGATGGAGAGGG + Intronic
1018410936 6:163547718-163547740 GAACTTGGTGATGATATAGATGG - Intronic
1018871913 6:167790219-167790241 GGGGTTGGGGAGGATGGTGAGGG - Intronic
1018904809 6:168069619-168069641 GGAGTTGGTAAGGATACAGTGGG - Intronic
1018961011 6:168448498-168448520 GGGGATGGTGAGGATGGTGATGG + Intronic
1019357602 7:588914-588936 GGTGATGGTGGGGATAGAGATGG + Intronic
1019369625 7:654660-654682 GGTGATGGTGAAGATATTGATGG - Intronic
1019369632 7:654714-654736 GAGGATGGTGATGATGTAGATGG - Intronic
1020023942 7:4885324-4885346 GAGGTTGGTGTGTATACAGAGGG - Intergenic
1021825368 7:24545582-24545604 GAGGGTGGTGAGCATTTAGAGGG - Intergenic
1024088963 7:45920340-45920362 GGGGATGGGGGGGATATAGGCGG - Intronic
1025776826 7:64568100-64568122 GGGGTGGGTGTTTATATAGAGGG + Intergenic
1027808714 7:82864397-82864419 GGGGCTGGTGGGTGTATAGATGG + Intronic
1030880650 7:114874215-114874237 GGGAATGGTGAGGCTAAAGAAGG - Intergenic
1031392454 7:121232255-121232277 GGGGAAGGTGAGGAGATGGAGGG + Intronic
1031606880 7:123779540-123779562 GGTGGTGGTAAGGGTATAGATGG + Intergenic
1031869281 7:127074727-127074749 GGGAGTGGTGAGCATATAGAAGG - Intronic
1032689108 7:134265048-134265070 GGGGTTGGTGAGGGTGGAGCGGG + Intergenic
1034778348 7:153852984-153853006 GGGGTTGACCAGGAGATAGAGGG - Intergenic
1034937525 7:155209650-155209672 GGGGTTGGTGATGACATTGAGGG - Intergenic
1035161489 7:156953511-156953533 GGGGTGGGTGAGGCCATGGAGGG - Intronic
1037317371 8:17611605-17611627 GGGTTTGGTGAGGAGCTAGATGG + Intronic
1037670223 8:21008964-21008986 GAGGTTGATGTGGATATAAAAGG + Intergenic
1037693517 8:21204253-21204275 GTGGGTGGTGAGTATAAAGAAGG - Intergenic
1042748237 8:72131102-72131124 AGGTTTGGTGAGGAGACAGAGGG + Intergenic
1043566631 8:81556250-81556272 TGATTTGGTGAGGATACAGAAGG + Intergenic
1044352866 8:91186801-91186823 GGGGGTGGTGAGGAGGTGGATGG + Intronic
1044613591 8:94117997-94118019 GGGGTAGGTGGGGATAGAGTTGG - Intergenic
1045654344 8:104371523-104371545 GGGGAGGGTGAGGACCTAGAAGG - Intronic
1045870738 8:106924105-106924127 GGGGTTAGTGAGGATGAACAGGG + Intergenic
1046747177 8:117888754-117888776 GGGGCTGGAGATGATATGGAAGG - Intronic
1048531853 8:135257020-135257042 GGGGTTGGGGAGGGTGGAGAGGG + Intergenic
1048870431 8:138792704-138792726 GGGGTTGGTGAGTTTATCCACGG - Intronic
1049566629 8:143343606-143343628 GGTGTTGGTGGGGACAGAGATGG - Intronic
1051590348 9:18771092-18771114 GGGGGTGGTGTGGAGATAGAAGG - Intronic
1052079637 9:24188209-24188231 GGGGTTGTGGGGGATATAGTTGG + Intergenic
1052793657 9:32902294-32902316 GGGGTGGGTGGGGAGCTAGAAGG - Intergenic
1053133509 9:35634322-35634344 TGGGATGGGGAGGAAATAGAAGG - Intronic
1053308957 9:37003103-37003125 GGGGATGGAGAGGAGAAAGAGGG + Intronic
1055230258 9:74055136-74055158 GTGGTGGGTGAGTAGATAGATGG - Intergenic
1057673027 9:97112149-97112171 GTGGTTGTTGAGGATCTTGATGG - Intergenic
1058271504 9:102977172-102977194 GGGGTTGGTGTTGTTATAAAGGG - Intergenic
1058720253 9:107757888-107757910 GGGGATGGTGAGGGTACAGAGGG - Intergenic
1059054053 9:110960005-110960027 TGGGGAGGTGAGGATAAAGAGGG + Intronic
1060213394 9:121724006-121724028 GGGGATGATGAGGATGTTGATGG + Intronic
1060600043 9:124871160-124871182 GGGGTTGGGGAGGGCAGAGAGGG + Intronic
1061145164 9:128793400-128793422 GGGCTAGGTGAGGAGCTAGAAGG + Intronic
1061492742 9:130955332-130955354 GAGGATGGTGGGGATAAAGATGG - Intergenic
1203774381 EBV:64672-64694 GGGGGTGGTGAGGATGCAGCTGG - Intergenic
1203466452 Un_GL000220v1:92964-92986 GGGGTGGGTGAGGAAGTAGGAGG - Intergenic
1186400481 X:9254166-9254188 GGGGTGGGTGAGAATGAAGAAGG + Intergenic
1187036250 X:15543207-15543229 AGGCTTTGTGGGGATATAGAAGG + Intronic
1187568478 X:20476332-20476354 GGGGTTTGTGAGGATAAAGTGGG + Intergenic
1188048400 X:25454487-25454509 GTGTTTGGTGAGGAGATGGAGGG - Intergenic
1188485777 X:30680431-30680453 GGGGTTGGTGAGGATATAGAGGG + Intronic
1189722341 X:43933181-43933203 GAGGTTGGAGAGGATTCAGAGGG - Intergenic
1189826273 X:44921492-44921514 GGGATTGGTGTGGCTATAAAGGG - Intronic
1190626819 X:52344921-52344943 GGGGCTGATGAGAATACAGAAGG - Intergenic
1190701181 X:52990933-52990955 GGGGCTGATGAGAATACAGAAGG + Intronic
1192173243 X:68869884-68869906 GGGGTTGGGGAGGGTGTAGTGGG + Intergenic
1194318397 X:92411418-92411440 GGGGTTGGTGGGAAAAAAGAGGG - Intronic
1194996362 X:100595519-100595541 TGGGTTGGTGAGAATCAAGATGG - Intronic
1196375382 X:115027274-115027296 GAGGGTGGTGAGGAGATTGAAGG + Intergenic
1196699177 X:118648855-118648877 GTTTTAGGTGAGGATATAGAGGG + Intronic
1200488565 Y:3795753-3795775 GGAGTTGGTCAGGAGACAGAGGG + Intergenic
1200626567 Y:5524710-5524732 GGGGTTGGTGGGAAAAAAGAGGG - Intronic