ID: 1188489028

View in Genome Browser
Species Human (GRCh38)
Location X:30716978-30717000
Sequence ATGTATAAACAGAACAATTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 312
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 287}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188489028 Original CRISPR ATGTATAAACAGAACAATTG TGG Intronic
901542817 1:9931750-9931772 ATTTATAAAGAAAACAATTCTGG + Intronic
903633127 1:24792086-24792108 ATGTATATACAGTAAAACTGTGG - Intronic
903798901 1:25951855-25951877 TTGTATAAAGTGAACAATTCAGG - Intergenic
908375911 1:63540583-63540605 TTTAATAAACAGAAAAATTGAGG - Intronic
909187945 1:72513224-72513246 ATTTATATACAGTACAATTTGGG - Intergenic
909280686 1:73748290-73748312 ATGTATAAATAGGTCAGTTGTGG - Intergenic
909314569 1:74199191-74199213 ATTTATAAACAGCAACATTGAGG + Intronic
910039207 1:82827817-82827839 ATATATAAAAAGTATAATTGAGG - Intergenic
910904649 1:92162524-92162546 ATGTATCTACAAAACACTTGGGG + Intergenic
911211813 1:95148061-95148083 ATTTCTAAATAGAAAAATTGAGG - Intronic
911386638 1:97183674-97183696 ATGTATATACAGATCAATCCAGG + Intronic
912131194 1:106602959-106602981 ATGTAAAAAGAAAACATTTGGGG - Intergenic
913527466 1:119707778-119707800 AAGGAAAAACAGAACAAGTGTGG - Intronic
914342641 1:146773468-146773490 AAGCATAAACAGAACAAATGAGG + Intergenic
914853402 1:151331951-151331973 ATGTAAAAGCATAACATTTGCGG + Intergenic
915303190 1:154963072-154963094 ATGTATATACAGACCCCTTGGGG + Exonic
917297326 1:173534438-173534460 ATCTATAAAAAGAGCAATTCAGG - Intronic
917891105 1:179439212-179439234 CTGTATAATCAGCACAATTAGGG + Intronic
918705245 1:187652435-187652457 ATGAAAAAATAGAACAATAGAGG + Intergenic
918978550 1:191524799-191524821 ATAAATAACAAGAACAATTGTGG - Intergenic
919086037 1:192920730-192920752 ATGTATCTACAAAACAATAGTGG - Intergenic
919321952 1:196054162-196054184 ATGTACAAATAGAAAAATTAAGG - Intergenic
920713166 1:208314940-208314962 ATTTAGAAAAAGAACAGTTGGGG + Intergenic
921668746 1:217903425-217903447 ATGCAGAAATAGAACGATTGAGG + Intergenic
1065269506 10:24012856-24012878 TTTTATAAACAGAACTATTTTGG + Intronic
1065406123 10:25367709-25367731 ATTTAGATACAGAACAATTTGGG + Intronic
1065576841 10:27129308-27129330 TTGTATAAAGGGAACAATTGAGG - Intronic
1067795254 10:49316606-49316628 ATGTATTAAAAGAAAAATGGAGG + Intronic
1068054896 10:51999583-51999605 ATATATAAACAGAACTAAGGTGG + Intronic
1069172559 10:65252178-65252200 AAGGGTAAGCAGAACAATTGTGG + Intergenic
1071158781 10:82722142-82722164 ATTTAGAAACAGAACATGTGGGG + Intronic
1071923498 10:90377848-90377870 ATTTATAAATAGTAAAATTGTGG + Intergenic
1072461998 10:95627969-95627991 ATGTATCAACAGCACAGATGAGG - Intronic
1073285119 10:102382838-102382860 ATGGAAAAACAGAACAACAGTGG + Exonic
1074910846 10:117906909-117906931 AAGTATAAACAGAATGATGGAGG + Intergenic
1075444188 10:122502489-122502511 ATGTAGAAACAGATCCAGTGAGG - Intronic
1075676961 10:124302405-124302427 ATGCAGAAACAGGACATTTGGGG - Intergenic
1076985046 11:229926-229948 ATGTACAAACAAACCAACTGTGG + Intronic
1077726119 11:4676533-4676555 ATTTATAAACATAAGAATTCTGG - Intergenic
1078499087 11:11851483-11851505 ATGTATTTACACAAGAATTGCGG + Intronic
1079757858 11:24288064-24288086 ATGCAAAAGCAGAACAGTTGAGG + Intergenic
1080451297 11:32381083-32381105 AAGGATGCACAGAACAATTGAGG + Intergenic
1085238897 11:75035618-75035640 ATATATACCCAGACCAATTGGGG - Intergenic
1086747101 11:90442279-90442301 ATGCTCAAACAGAATAATTGAGG - Intergenic
1087278825 11:96187390-96187412 ATGAATAAACAAAAGAATTGAGG + Intronic
1088055697 11:105573926-105573948 AAGTAGAAACAGAACAAAAGTGG + Intergenic
1088086188 11:105983570-105983592 ATGTAAAAACAGAATATTGGTGG - Intergenic
1089861717 11:121596094-121596116 ATGTACATACAGAAGAGTTGTGG - Intronic
1090806217 11:130203953-130203975 ATGTTTAAAGAGAACAAAGGTGG - Intronic
1091281105 11:134382210-134382232 ATGTAAAAACAGCAAAAATGAGG - Intronic
1093289357 12:17301971-17301993 ATGTATAGCCAGTACAACTGCGG - Intergenic
1093986124 12:25536035-25536057 ATGTAGAAACAGAAACATTTAGG - Intronic
1094672347 12:32582732-32582754 ATGTAAAAACAATACATTTGTGG - Intronic
1095397706 12:41779343-41779365 ATGTAGAGACAGAAAAAATGTGG - Intergenic
1098221909 12:68279039-68279061 ATTTTTAAATAGAACAATGGTGG + Intronic
1099279853 12:80629931-80629953 ATGTCTAAATAAAACAAATGTGG - Intronic
1099429863 12:82570731-82570753 ATTTATAAGCAGAACTGTTGTGG - Intergenic
1101869826 12:108556622-108556644 ATGAGGAAACAGAACAAGTGGGG - Intronic
1103420457 12:120777412-120777434 ATGTATAAACAGAGCATATAGGG - Intronic
1104248475 12:127065763-127065785 ATGTCTAAAATGAACAAATGTGG - Intergenic
1105771920 13:23620214-23620236 TTTTATAAACAGAAAAACTGAGG + Intronic
1106184337 13:27395601-27395623 TTACATAAGCAGAACAATTGAGG - Intergenic
1106442729 13:29791976-29791998 ATGTGGCTACAGAACAATTGTGG + Intronic
1106820027 13:33454505-33454527 ACTTATAGACAGAAAAATTGAGG + Intergenic
1107759150 13:43657711-43657733 ATGTATAGACAGAATTTTTGGGG - Intronic
1108840665 13:54610560-54610582 GTGGATAAAAAGAACAATTAAGG + Intergenic
1111518398 13:89364872-89364894 ATGTATGAAAAGAAAAACTGAGG - Intergenic
1112779191 13:102879479-102879501 ATGTATACACAGATGAATCGAGG - Intergenic
1112816559 13:103279920-103279942 ATGTGTAAACTAAACAATTAAGG + Intergenic
1112840833 13:103575845-103575867 GTTTATAAACAGAATGATTGTGG - Intergenic
1112990002 13:105501626-105501648 AAGTATACACAAAAGAATTGCGG - Intergenic
1114331802 14:21644801-21644823 ATTTATAAAATGAACATTTGAGG + Intergenic
1115041274 14:28932015-28932037 ATGGACAAACAGAAGAATAGTGG - Intergenic
1115180924 14:30624977-30624999 AATTTTAAACAGAATAATTGGGG - Intronic
1115183944 14:30663417-30663439 AAGTAAAAATAGCACAATTGTGG - Intronic
1115357757 14:32466889-32466911 ATATAAAAACAAAACAATTGAGG + Intronic
1116645477 14:47523294-47523316 ATGTATATCCAGAACTATTTTGG - Intronic
1117011981 14:51480289-51480311 GTGTATTTACTGAACAATTGAGG + Intergenic
1118512971 14:66496470-66496492 AGGTATAAACAGACTAAGTGAGG - Intergenic
1118648599 14:67865836-67865858 ATTTATAAAAAGACCAATTTAGG - Intronic
1118886555 14:69871741-69871763 ATATATAAAGAGAAGAATTAGGG - Intronic
1119502122 14:75138007-75138029 ATATATAAACAGAATTATTAAGG - Intronic
1120716632 14:87847672-87847694 ATTTATAAAGAGAAGCATTGAGG - Intronic
1121064383 14:90948222-90948244 ATGTATCAACATAACTATTTTGG - Intronic
1121640093 14:95479603-95479625 ATGTAGAGACAGACCAAGTGTGG + Intergenic
1122452520 14:101821666-101821688 ATGTATACACAGTACAATACAGG - Intronic
1124185361 15:27521238-27521260 ATTTATAGCCAGAAGAATTGAGG + Intronic
1125033840 15:35100542-35100564 ATGAAAAACCAGAAAAATTGAGG - Intergenic
1127595260 15:60475153-60475175 ATGTATAAATACACCAAATGAGG - Intronic
1128795139 15:70461310-70461332 ATGTATTAACAGAAAAGTTGAGG + Intergenic
1132473069 16:117729-117751 ACGCATACTCAGAACAATTGAGG + Intronic
1134535592 16:15024398-15024420 AAAAATAAACAGAAGAATTGGGG - Intronic
1134611234 16:15610115-15610137 ATGAATAAACAAAAAAAGTGGGG - Intronic
1135148223 16:19982249-19982271 ATATATAACTAGAACAGTTGGGG + Intergenic
1137030839 16:35522777-35522799 CTGTATAATCAGTACAATTTGGG - Intergenic
1138637429 16:58352228-58352250 ATGAATAAACAGAAGCAATGAGG - Intronic
1138844337 16:60547069-60547091 CTGTATAAAGAGAAAAAATGAGG - Intergenic
1138936065 16:61725086-61725108 ATGTCTAAACAGATCATTAGAGG + Intronic
1139860449 16:70016379-70016401 AAAAATAAACAGAAGAATTGGGG + Intergenic
1139991342 16:70941860-70941882 AAGCATAAACAGAACAAATGAGG - Intronic
1140907341 16:79420204-79420226 ATCTATAAACAGCACATCTGAGG - Intergenic
1141750770 16:85956428-85956450 ATGAATAAACAGAAGTATTCTGG - Intergenic
1145192599 17:20857610-20857632 ATGTAAAAACAGAATAATATAGG + Intronic
1145403122 17:22560680-22560702 ATGTAAAAACAGAATAATATAGG + Intergenic
1203161290 17_GL000205v2_random:53298-53320 ATATAGCAACACAACAATTGCGG - Intergenic
1153473816 18:5474989-5475011 ATGTATAAAAAGAAAAACTAAGG - Intronic
1153596023 18:6725996-6726018 ATTTTTACACAGAACAATGGAGG - Intergenic
1154216061 18:12417048-12417070 ATATAGCAACAGAACAATGGAGG - Intronic
1155711694 18:28888287-28888309 ATGTACAAAAACAACATTTGTGG + Intergenic
1156917925 18:42483710-42483732 ATGAATAAACTGAACCATAGGGG - Intergenic
1158348741 18:56542525-56542547 ATGCCTAAATGGAACAATTGAGG - Intergenic
1158764922 18:60438304-60438326 ATGTGTAACCAGGATAATTGGGG - Intergenic
1158801180 18:60911354-60911376 AAATACAAACAGAACAATGGTGG + Intergenic
1159271503 18:66158544-66158566 ATCTAAAAAAAGAACAAATGCGG + Intergenic
1165283896 19:34821777-34821799 ATGTATAAAAAAAACACTTGAGG + Intergenic
1167063034 19:47163117-47163139 ATGTATATACAACAAAATTGGGG + Intronic
1167826680 19:51979629-51979651 CTGTATAATCAGCACAATTAGGG - Intronic
926138180 2:10352225-10352247 ATGGATAGGCAGAACACTTGCGG - Intronic
927013850 2:18934991-18935013 ATGTTTACACACAACAATGGAGG - Intergenic
927115329 2:19894883-19894905 TTGTAAAAACAAAAGAATTGTGG - Intergenic
928877613 2:36058815-36058837 AAGTATGAACATAACACTTGTGG + Intergenic
928902911 2:36340229-36340251 GTGAATAAACAGAGCAAATGAGG + Intergenic
930251619 2:49041097-49041119 ATGCAGAAACAGAACACTTAGGG + Intronic
930291895 2:49504926-49504948 ATGTATAAACAAAAAAATTCAGG + Intergenic
931079680 2:58754639-58754661 ATGTACAAATAGAAGAATAGAGG - Intergenic
932036265 2:68250450-68250472 CTTTATAAACAGCACATTTGAGG - Intronic
932050858 2:68396331-68396353 ATGTCTAAAGAGAACAAAAGAGG - Exonic
935115975 2:100136597-100136619 ATGGATAAACAGATCAATGGGGG - Intronic
935515710 2:104035924-104035946 ATGAATAAAAAGAATGATTGGGG + Intergenic
937519104 2:122689660-122689682 CTGTAGAAATAGAACAATTGAGG - Intergenic
938026382 2:127952527-127952549 ATATATAAACAGCACGTTTGAGG - Intronic
938977309 2:136492234-136492256 ATGTAAAAGGAGAACTATTGTGG - Intergenic
939298148 2:140296864-140296886 AAATATAAATAGAAGAATTGTGG + Intronic
942858243 2:180578010-180578032 ATATATAAACACAAAAATTTTGG - Intergenic
942938664 2:181590121-181590143 ATATATAAACAAAACCATTATGG - Intronic
943166575 2:184334479-184334501 TTGTATAAACAGAATATTTTTGG - Intergenic
944325671 2:198400790-198400812 CTCTGTAAACAGAACTATTGAGG - Intronic
944731558 2:202522568-202522590 ATCTATAATCCGAACAATTTGGG + Intronic
944842050 2:203634164-203634186 ATATATAAACAGCACAAGTTAGG + Intergenic
946535913 2:220628034-220628056 ATGTACAGACAGAATAAATGAGG + Intergenic
947813091 2:233016546-233016568 ATGTATATATAGAACATTTCTGG - Intergenic
948006549 2:234613967-234613989 ATGTATAAACAGAAAAGGTTTGG + Intergenic
1170253137 20:14308620-14308642 ATGTTTTAACAAATCAATTGTGG + Intronic
1170507550 20:17043480-17043502 GTGCATAAAGAGAACACTTGGGG + Intergenic
1170772365 20:19344117-19344139 GTGAATAAAGAGAACAATGGTGG + Intronic
1171015312 20:21535996-21536018 ATGTATAAATAAAACAATTGAGG + Intergenic
1171408584 20:24930528-24930550 ATGCAAAACCAGTACAATTGCGG - Intergenic
1173665461 20:44759844-44759866 AAGTAAAAACAGAACACTGGGGG - Intronic
1175186645 20:57183455-57183477 TTAAATAAACAGAACAATGGCGG - Intronic
1175514855 20:59562733-59562755 ATGGATAGACAGAGCAAATGTGG + Intergenic
1175644103 20:60656815-60656837 AGGTAAAAAGAGAACAATTCTGG + Intergenic
1176193916 20:63828131-63828153 ATCTATAAACAACACCATTGGGG + Intronic
1177095976 21:16833583-16833605 TAGTATACACAGAACAAATGTGG - Intergenic
1177739783 21:25140189-25140211 AAGTATAAAAAGAATATTTGTGG + Intergenic
1178407087 21:32333954-32333976 TGGTATAAACAGAACAAGCGTGG + Intronic
1178579274 21:33824030-33824052 CTGTATAAACAGAAGTATTCTGG + Intronic
1179817781 21:43918503-43918525 ATTTAGAAACAGAAAAATGGGGG + Intronic
1182376228 22:29850344-29850366 CTGTTAAAACAGAACACTTGAGG + Intergenic
1182874411 22:33678433-33678455 ATGCATACACAGAACATTTGGGG + Intronic
1183531625 22:38358088-38358110 ATAGGTAAACAGAACACTTGTGG + Intronic
949181151 3:1133110-1133132 ATGAATAAACAAAATATTTGCGG - Intronic
949459842 3:4279316-4279338 ATGTAGAAACAAAACAATCAAGG + Intronic
952746776 3:36788882-36788904 ATTTATAAACAGTATGATTGAGG + Intergenic
953275898 3:41497415-41497437 ATCTATATACATAATAATTGGGG + Intronic
954094453 3:48313725-48313747 ATGAATAAATAAAAAAATTGTGG + Intronic
954949260 3:54454970-54454992 ATGAATGAACAGAGCAAATGTGG - Intronic
955210034 3:56932392-56932414 TTGTATATACAGTACAATTTGGG - Intronic
955982202 3:64538532-64538554 ATGTATAAACAGAAAAAGTCTGG - Intronic
957684295 3:83481007-83481029 AGGTTTAAACAGAAGAATTTTGG - Intergenic
957729815 3:84119446-84119468 ATGTTTGAGCAGAACTATTGAGG - Intergenic
960120141 3:113940906-113940928 ATTTATAAACAGAAAATTAGGGG - Intronic
960157621 3:114312365-114312387 ATGTATAAACACAAACATAGAGG - Intergenic
960478628 3:118161114-118161136 ATGAATAAACAGATAAAATGTGG + Intergenic
960606567 3:119512069-119512091 ATGTATAAAAAGATTATTTGTGG + Intronic
961622151 3:128232653-128232675 ATGTAGAAATAAAATAATTGTGG - Intronic
962606524 3:137036684-137036706 ATTTAAAAACAGCAAAATTGAGG + Intergenic
962760222 3:138505392-138505414 ATTTATAAACAGACCAAAGGGGG - Exonic
963144966 3:141984076-141984098 ATGGATAAACAGATAAAATGTGG + Intronic
963373490 3:144433491-144433513 ATGTATAAATATATCAGTTGTGG - Intergenic
963975669 3:151477395-151477417 AAGTATAAATAGAATAAATGGGG + Intergenic
964716017 3:159722547-159722569 ATGTATACATTAAACAATTGGGG - Intronic
965429440 3:168568318-168568340 ATTTATGAACAGAGCAATTAAGG + Intergenic
966483104 3:180433624-180433646 ATGTTTAAACAAAATAATTCAGG - Intergenic
968145833 3:196298292-196298314 ATAAATAAATAAAACAATTGGGG - Intronic
968826790 4:2904176-2904198 ATGAACAAACTGAACACTTGCGG - Intronic
968937308 4:3617830-3617852 ATGTAGAAAAACAAGAATTGGGG - Intergenic
969863057 4:10052782-10052804 ATGTATAATCAGCACAATATTGG + Intronic
970277577 4:14418320-14418342 ATGCAGAAACAGAGCAAATGTGG - Intergenic
971256336 4:25017059-25017081 ATGTATAAACTGAAAGTTTGTGG + Intronic
971789868 4:31155651-31155673 ATGTCTAAAAAGAACAACTAAGG - Intergenic
971924870 4:32995504-32995526 ATGTATAAACATAACTCTTAGGG + Intergenic
972736563 4:41847697-41847719 AAGTACAAATAGAAAAATTGAGG + Intergenic
972947558 4:44275523-44275545 ATCTATAAACTGTACAAATGAGG + Intronic
975320118 4:73000470-73000492 ATATATAAACTGTACAATTTGGG + Intergenic
976032976 4:80780063-80780085 AAGCATAAAATGAACAATTGTGG - Intronic
976055879 4:81066445-81066467 AAGCATAAACAAAACAATTTTGG + Intergenic
976212976 4:82690825-82690847 AAGAACAAACAGGACAATTGAGG + Intronic
976505064 4:85836891-85836913 ATGTACAAACAAAACATCTGGGG - Intronic
977001429 4:91509388-91509410 ATGTAATAAGAGAAAAATTGAGG - Intronic
977018480 4:91727012-91727034 ATGAATAAACAGAAAAATCGAGG - Intergenic
977042500 4:92031581-92031603 ATGTAAAATCAGAAAAAATGGGG + Intergenic
977173469 4:93791306-93791328 ATACATAATCAGAACAATTTTGG - Intergenic
977484834 4:97630275-97630297 ATTTTGAAACAAAACAATTGTGG + Intronic
977800348 4:101222417-101222439 ATGGCTAAAAAGAACAATTATGG - Intronic
979142752 4:117199235-117199257 ATGTATAGAAAAAATAATTGAGG + Intergenic
979424453 4:120548321-120548343 AAGAATAAACAAAACATTTGAGG + Intergenic
980220996 4:129915137-129915159 GTGTATAAAGATAAAAATTGAGG + Intergenic
981648728 4:147030525-147030547 AAATAGAAATAGAACAATTGTGG - Intergenic
981921163 4:150086126-150086148 AAGGATAAACAAGACAATTGTGG - Intronic
983670894 4:170236745-170236767 ATGTATAAACATACCAATCCCGG + Intergenic
984056428 4:174935375-174935397 ATGTATACACAGGACACTTTTGG + Intronic
984640156 4:182156195-182156217 ATGTTAAAACACAACAATTTTGG + Intronic
985148993 4:186927242-186927264 ATGTTTTAACAGAAGAATTTTGG - Intergenic
986024749 5:3840228-3840250 ATGTTAAAAGGGAACAATTGGGG - Intergenic
986793711 5:11189070-11189092 ATCTATTAACAGAACCATTGTGG - Intronic
987296366 5:16555440-16555462 ATGTAAAAACAGGCCAAGTGTGG - Intronic
987395862 5:17422750-17422772 GTGAATAAAGAGAAGAATTGGGG - Intergenic
987890375 5:23868230-23868252 ATTTATAAAAAGTAAAATTGTGG - Intergenic
989213140 5:38877655-38877677 ATCTACAAAAAGAAAAATTGAGG + Intronic
989731793 5:44657522-44657544 ATGTTTACACACAACAACTGAGG + Intergenic
991982536 5:72248041-72248063 ATGTAAAGACAGAAAAATTAAGG + Intronic
992391317 5:76333585-76333607 ACGTATATACAGTACAATAGGGG - Intronic
993069215 5:83137667-83137689 AATTATAAACAAAACAATTGAGG - Intronic
993256554 5:85598089-85598111 ATTTATAAATAAAACAATTGAGG - Intergenic
994202221 5:96990477-96990499 ATGTGTGAACAGAATATTTGTGG - Intronic
994356940 5:98803332-98803354 ATGTATAAACAGAAGAAGGAAGG + Intergenic
994803478 5:104412036-104412058 ATATATTAACAGAAAAAATGTGG + Intergenic
995452977 5:112322891-112322913 ATGAATAACCAGAACAAATAGGG + Intronic
995829703 5:116342047-116342069 ATGTATATACATAACTTTTGGGG - Intronic
996159283 5:120143124-120143146 ATGAATAAACAAATAAATTGTGG + Intergenic
999197052 5:149789256-149789278 ATGAATCAACTGAACAAATGAGG + Intronic
1000451430 5:161392974-161392996 ATGTGTTAACAGTACAATTCTGG + Intronic
1003896523 6:10613290-10613312 TTATATAAACAGAGCATTTGAGG - Intronic
1003992179 6:11497144-11497166 ATGATTAAATAAAACAATTGTGG - Intergenic
1004904131 6:20220429-20220451 ATGTTTCAACATAACAATTTTGG + Intergenic
1005330405 6:24744506-24744528 AAGTATAAAACGAACAATAGTGG - Intergenic
1005865108 6:29931617-29931639 AAGTAAAAACAGAAAAATTTCGG + Intergenic
1006965608 6:37981178-37981200 ATGTATAGGTAGAACAATTTTGG + Intronic
1010348923 6:74848291-74848313 ATGCAGAAACAGAAATATTGTGG + Intergenic
1010920080 6:81670116-81670138 ATGTATAATCAGAAAATTTGTGG - Intronic
1012566662 6:100664526-100664548 ATATATAAACATAACAAAAGAGG + Intronic
1013333606 6:109132487-109132509 ATGGATAAACAGATAAACTGTGG - Intronic
1013701197 6:112771631-112771653 TTGTATAATCAGAACTCTTGGGG + Intergenic
1013973917 6:116054762-116054784 ATCTAGATAAAGAACAATTGTGG + Intronic
1014363673 6:120512287-120512309 ATGTATGAAGAGAACTAATGTGG + Intergenic
1014895480 6:126894946-126894968 CTGTATAAGCAGAAAAATTCTGG + Intergenic
1015033125 6:128620351-128620373 ATGGAAAAACAGAACAATGTAGG + Intergenic
1015439319 6:133230271-133230293 ATGTATAAACAGTGCTGTTGTGG + Intergenic
1015656197 6:135522040-135522062 ATATTGAAACAGAACAACTGCGG + Intergenic
1015678390 6:135776978-135777000 ATGTATTACTAGAACAATTTTGG - Intergenic
1017663277 6:156694626-156694648 ATGAATAAACAGATAAATGGTGG + Intergenic
1018130334 6:160724596-160724618 ATGTTTACACAGAAGAATAGTGG + Intronic
1018593661 6:165454824-165454846 TTGTCTAAACAGAAAAGTTGTGG + Intronic
1020531099 7:9336455-9336477 ATGTTTGAACAGTAAAATTGAGG + Intergenic
1020534444 7:9377518-9377540 AAGAATAACCAGAACATTTGGGG + Intergenic
1021074497 7:16285653-16285675 AGGTATTAACAGAAAAATTTGGG - Intronic
1021262131 7:18471433-18471455 ATGTTGAAACAGCACAATTAAGG - Intronic
1021643935 7:22768969-22768991 ATGTGAAAACAGAACAATACAGG + Intergenic
1021877400 7:25061559-25061581 TTTTAGAAACAGAACAATTTAGG - Intergenic
1022124339 7:27341019-27341041 ATGCATAAACAGAAGCCTTGAGG - Intergenic
1023213024 7:37829083-37829105 ATGGAAAAACAGAAAAACTGGGG - Intronic
1024392070 7:48826855-48826877 ATGTATAAATAGACCTATTTGGG + Intergenic
1025706445 7:63869432-63869454 ATGTATAAAGTGAACAATTAGGG - Intergenic
1028906550 7:96160702-96160724 AGGTTTAAACATAGCAATTGTGG + Intronic
1029636177 7:101785762-101785784 ACATAAAAACAGAACATTTGTGG + Intergenic
1031277859 7:119753887-119753909 ATGAATAAACTGAAAAACTGAGG + Intergenic
1031631989 7:124054256-124054278 ATGTATAAACGGAAGAAAAGAGG + Intergenic
1032314935 7:130828980-130829002 ATCTACAATCAGAATAATTGGGG - Intergenic
1033633212 7:143181864-143181886 ATGGATAAACAAATCAAATGAGG + Intergenic
1040506354 8:48052309-48052331 ATGTAAAAACAAAACAGTAGTGG - Intronic
1040829652 8:51662853-51662875 ATGTATAAACATAAAAACTAAGG + Intronic
1041032676 8:53754313-53754335 ATCTATAAACACAACACTTGTGG + Intronic
1043155921 8:76779044-76779066 ATATATAAACAGGACACTTTAGG - Intronic
1043712053 8:83433108-83433130 ATGTAAAAACAAAACTATTAAGG - Intergenic
1045722323 8:105128027-105128049 ATGTATACATAGAACAAGAGTGG - Intronic
1048755188 8:137730706-137730728 ATGTTTCAACACAACATTTGAGG - Intergenic
1050475743 9:6039201-6039223 ATGTACAAAAATAAGAATTGAGG - Intergenic
1050551396 9:6751681-6751703 ATGCATAATCAGAACACTTAAGG + Intronic
1050581139 9:7058395-7058417 ATGTGCAAACACAACAAATGAGG - Intronic
1050911229 9:11073820-11073842 AGGTATAAACACAACTCTTGAGG + Intergenic
1054453845 9:65419842-65419864 ATGTAGAAAAACAAGAATTGGGG + Intergenic
1055379726 9:75693091-75693113 AGGAATAAAAAGAATAATTGGGG + Intergenic
1056867706 9:90244360-90244382 CTGGATAAATAGCACAATTGAGG - Intergenic
1057841840 9:98492383-98492405 ATTTGAAAACAGAAAAATTGTGG + Intronic
1057877552 9:98769266-98769288 ATGTTTAAACAGAGCCATTCTGG + Intronic
1058145400 9:101405562-101405584 GTGTATATACAGAACAAGTAAGG + Intronic
1058559904 9:106216094-106216116 ATATATAAAGATAACAATTTAGG + Intergenic
1058783088 9:108358810-108358832 ATGTATAATGTTAACAATTGAGG + Intergenic
1062077921 9:134602179-134602201 TTTTATAAACAGAGAAATTGAGG - Intergenic
1185752168 X:2621373-2621395 TAGTATAAACAGAAAAATAGTGG - Intergenic
1186007259 X:5086277-5086299 ATGTATAAAGAAACCAATTCTGG - Intergenic
1187868716 X:23746957-23746979 TTGTATAATCTGAATAATTGAGG - Intronic
1188489028 X:30716978-30717000 ATGTATAAACAGAACAATTGTGG + Intronic
1188576301 X:31654943-31654965 ATGTATAAATAGAAAAAATCAGG + Intronic
1189325881 X:40110257-40110279 ATGTATAAACAGCACTATTTGGG + Intronic
1190882952 X:54506405-54506427 AATTATAAACAAAACAATTGTGG - Intergenic
1191032962 X:55995016-55995038 ATGGGTAAACACAACAATAGTGG - Intergenic
1192277625 X:69649380-69649402 TTGTGTAAACAGTGCAATTGTGG + Intronic
1194303331 X:92213531-92213553 ATGTATAAATATAAGAATAGAGG - Intronic
1194621679 X:96181023-96181045 GTGTATAAACATACCAATTGAGG - Intergenic
1195565822 X:106338213-106338235 CTTTTTAAACAGGACAATTGGGG - Intergenic
1195800100 X:108699193-108699215 ATGTATCTTCAGAAAAATTGAGG + Intergenic
1196547745 X:116983692-116983714 AATTATAAACAGAACACATGAGG + Intergenic
1197556223 X:127958366-127958388 AGGTATAATCTCAACAATTGAGG + Intergenic
1198015110 X:132602567-132602589 AAGTATTAACACAACAAATGAGG + Intergenic
1198568545 X:137931429-137931451 ATGTTTTAAAAGAACAATTCTGG - Intergenic
1199672643 X:150159951-150159973 TTTTATAAATAGACCAATTGAGG - Intergenic
1201440733 Y:14005681-14005703 ATGTATTAACAGAATATTTCTGG + Intergenic
1201443838 Y:14037027-14037049 ATGTATTAACAGAATATTTCTGG - Intergenic
1201673268 Y:16549977-16549999 ATGTATAAAGAAAACAATTCTGG + Intergenic
1202345300 Y:23916825-23916847 AATTATAAACAGCAAAATTGTGG - Intergenic
1202525470 Y:25753264-25753286 AATTATAAACAGCAAAATTGTGG + Intergenic