ID: 1188493134

View in Genome Browser
Species Human (GRCh38)
Location X:30756594-30756616
Sequence GCACACTTGTTAGCTGCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188493134_1188493138 12 Left 1188493134 X:30756594-30756616 CCTGCTGCAGCTAACAAGTGTGC No data
Right 1188493138 X:30756629-30756651 TGCTGCTGGCATGTATGAACGGG No data
1188493134_1188493137 11 Left 1188493134 X:30756594-30756616 CCTGCTGCAGCTAACAAGTGTGC No data
Right 1188493137 X:30756628-30756650 CTGCTGCTGGCATGTATGAACGG No data
1188493134_1188493135 -2 Left 1188493134 X:30756594-30756616 CCTGCTGCAGCTAACAAGTGTGC No data
Right 1188493135 X:30756615-30756637 GCACACAGCTCCGCTGCTGCTGG No data
1188493134_1188493139 17 Left 1188493134 X:30756594-30756616 CCTGCTGCAGCTAACAAGTGTGC No data
Right 1188493139 X:30756634-30756656 CTGGCATGTATGAACGGGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188493134 Original CRISPR GCACACTTGTTAGCTGCAGC AGG (reversed) Intergenic
No off target data available for this crispr