ID: 1188501709

View in Genome Browser
Species Human (GRCh38)
Location X:30834048-30834070
Sequence AACCATCTGCAGCTGCTGCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 299
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 267}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188501709 Original CRISPR AACCATCTGCAGCTGCTGCC TGG Exonic
900169385 1:1258880-1258902 AACCAACTCCAGGTGCAGCCTGG - Intronic
900631599 1:3639335-3639357 AACCCTCTGCAGATGCAGCCAGG - Intronic
901543389 1:9936833-9936855 AAAAATATGCAGCTGCGGCCAGG + Intronic
901735362 1:11309010-11309032 AATTGTCTGCAGGTGCTGCCTGG + Intergenic
902888722 1:19426020-19426042 AGCCTGCTGCACCTGCTGCCTGG - Intronic
903226048 1:21894691-21894713 AACCATCTCCAGCCCCTCCCCGG - Intronic
903674383 1:25055052-25055074 AACCATCTCCATCAGCTCCCTGG - Intergenic
904396775 1:30227612-30227634 ATCCCTCAGCAGCTCCTGCCTGG + Intergenic
905264835 1:36744465-36744487 AACTTTCTGCTGCTTCTGCCGGG - Intergenic
905515918 1:38561902-38561924 AGCCTCCTGCAGCTGCTGGCAGG - Intergenic
905664737 1:39756144-39756166 AGCCAGGTGCAGCTGCTGCATGG - Intronic
912747040 1:112253556-112253578 CTTCATCTGCAGCTGCTGCTGGG - Intergenic
914943542 1:152043707-152043729 TACAACCTACAGCTGCTGCCTGG + Intronic
916139637 1:161683960-161683982 ATTCACCTGCAGCTGCTGGCTGG + Intergenic
922055630 1:222040048-222040070 GACCATCTGCTGCTGATGTCAGG + Intergenic
922549521 1:226483679-226483701 ATCTATCTCCAGCTGTTGCCTGG + Intergenic
922740270 1:228010502-228010524 AGCCACCTGGAGTTGCTGCCAGG + Intronic
922775972 1:228214346-228214368 AACCATCTCCCAGTGCTGCCTGG + Exonic
923211469 1:231807699-231807721 AGCCAGCAGCAGCAGCTGCCTGG + Intronic
924043080 1:240002798-240002820 AACCAGCTGCAGGTGATGGCAGG + Intergenic
924246176 1:242087248-242087270 AGGCATCTGCTGCTGCTGCTTGG + Exonic
924309650 1:242726863-242726885 AACAATCACCAGCTCCTGCCTGG - Intergenic
1064092498 10:12396729-12396751 AACCAGCAACAGCTGCTGCGGGG - Intronic
1065976477 10:30846824-30846846 AAGCACCTGCTCCTGCTGCCTGG + Intronic
1066059141 10:31706960-31706982 CTGCATCTGCAGCTGGTGCCAGG + Intergenic
1066669148 10:37818405-37818427 AACCATGGGCAGCTCCAGCCAGG - Intronic
1067153217 10:43753383-43753405 CACCATTTGGAGTTGCTGCCGGG - Intergenic
1068436350 10:56996096-56996118 ATCCAACTACAACTGCTGCCTGG + Intergenic
1068721036 10:60246587-60246609 AAGCATTTGCTGCTGCTTCCTGG - Intronic
1068746092 10:60532358-60532380 AACCAAATGTAGCTGCTACCAGG - Intronic
1069884231 10:71613477-71613499 CACTGTCTGCAGCTTCTGCCTGG + Intronic
1070057367 10:72948335-72948357 AACCATCATCAGCTGCAGGCCGG - Intronic
1071693130 10:87843816-87843838 GAGCCGCTGCAGCTGCTGCCAGG - Intergenic
1073192149 10:101659179-101659201 ACCCCTCTGCAGGTGCTGCTTGG - Intronic
1073206224 10:101770811-101770833 AACCATGTGTCACTGCTGCCTGG - Intronic
1074317153 10:112370451-112370473 CACCCTCTGCAGCCGCTGGCCGG - Intergenic
1074464660 10:113670756-113670778 AACCACCTGAAGCAGGTGCCAGG + Intergenic
1075732090 10:124642482-124642504 TCCCATCTGCAGAAGCTGCCCGG + Intronic
1076921655 10:133457496-133457518 CACCATCCGCAGCTGCAGACTGG + Intergenic
1077392167 11:2305172-2305194 CACCTCCTGGAGCTGCTGCCGGG + Intronic
1079689112 11:23400297-23400319 CACCCTCCGCAGCTGCTGGCTGG - Intergenic
1080503017 11:32888167-32888189 AGCCAGCTCCACCTGCTGCCTGG - Intergenic
1081534551 11:43987532-43987554 GTCCAGCTGCAGCTGCTGTCTGG + Intergenic
1081713671 11:45233868-45233890 AGCCAGCAGCAGCTGCTGCGCGG - Intronic
1083062068 11:59884236-59884258 GAACTGCTGCAGCTGCTGCCAGG + Intergenic
1083065788 11:59922650-59922672 CACAGTATGCAGCTGCTGCCTGG - Intergenic
1083462597 11:62824468-62824490 AATGAGCTGCAGCTGCTGGCTGG + Exonic
1083888663 11:65585083-65585105 TACCAGCTGCAGCTCCTGCCCGG - Exonic
1083899200 11:65635560-65635582 CACCAGCTCCTGCTGCTGCCCGG - Exonic
1085476591 11:76793157-76793179 AACTGTCTGCAGATGCTCCCAGG - Intronic
1086685794 11:89731798-89731820 AACCTTCTCCAGTTGCTTCCTGG - Intergenic
1089462906 11:118663120-118663142 AAACGCCTGCAGCTGCTCCCTGG + Exonic
1090333451 11:125948044-125948066 GACCAGCTGCAGCTGGGGCCAGG - Intergenic
1090340663 11:126017204-126017226 AACCTTCTCCAGTTGCTTCCTGG + Exonic
1090519700 11:127465075-127465097 AACCCTCTGCATCTGCATCCAGG - Intergenic
1093098651 12:15000976-15000998 CATAATCTGCAGCTGCTGCATGG + Intergenic
1093119659 12:15253560-15253582 TAGCAGCAGCAGCTGCTGCCTGG + Intronic
1093506889 12:19877663-19877685 CACCATGTGCACCTGCTGTCTGG - Intergenic
1094399724 12:30049148-30049170 AACCTATTGCAGCTGGTGCCAGG - Intergenic
1096447389 12:51705755-51705777 AACCATCTGCAGTTGTTACTTGG - Intronic
1096469002 12:51864609-51864631 CAGCTTCTGCAGCGGCTGCCGGG + Intergenic
1097794797 12:63850067-63850089 CACCCTGTGAAGCTGCTGCCTGG - Intronic
1099133342 12:78863922-78863944 ACCCATCAGCGGCGGCTGCCAGG - Intergenic
1099887067 12:88544628-88544650 ATACATCTGCTGCTGCTGCATGG + Intronic
1103553451 12:121751824-121751846 AACCAACTGCTGCTGCTGAAAGG - Intronic
1103594835 12:122018355-122018377 AACCATCTGCAGCACATCCCTGG + Intergenic
1103880236 12:124160342-124160364 TTCCAGCTGCAGCTGCAGCCGGG - Intronic
1104881871 12:132077441-132077463 GATCATCTGCACCTGCTGCCCGG - Exonic
1105510257 13:21045832-21045854 TCTCATCTGCTGCTGCTGCCTGG + Exonic
1105741181 13:23324595-23324617 CACGATGTGCAGCTGCTCCCTGG - Exonic
1112039680 13:95534297-95534319 AACCATATGAAGCTACTGCCAGG + Intronic
1112675422 13:101695778-101695800 CACCATCTTCATCTGTTGCCAGG - Intronic
1114349780 14:21836817-21836839 AGCCAGCTGCAGCTGCCGCTTGG + Intergenic
1116390530 14:44384883-44384905 CACCCTCTGCAGCCGCTGGCCGG - Intergenic
1121694405 14:95901105-95901127 CACCTTCTGAAGCTGTTGCCTGG - Intergenic
1121864640 14:97351253-97351275 CAACTTCTGCAGCTGCTGACAGG - Intergenic
1121896769 14:97655974-97655996 ACCTTTCTGCAGCTGCTGTCAGG - Intergenic
1122207640 14:100156041-100156063 GTCCATCTCCAGCTCCTGCCGGG - Intronic
1122636725 14:103133444-103133466 AGCCAGCTGCTGCTGCTGCTCGG - Exonic
1122786479 14:104166513-104166535 CCCCACCTGCAGCCGCTGCCGGG - Intronic
1122905055 14:104797780-104797802 CACCTTCTGCAGCTGCTGGCCGG + Intergenic
1122937553 14:104967059-104967081 CCCCAGCTGCACCTGCTGCCAGG - Intronic
1123052967 14:105556041-105556063 AAGCATCTTCAGCTGCAGCCAGG - Intergenic
1123077550 14:105676431-105676453 AAGCATCTTCAGCTGCAGCCAGG - Intergenic
1125172606 15:36783097-36783119 AACTGTATGCAGCTGCTGACAGG - Intronic
1126497352 15:49306858-49306880 AAGAATCTGAAGCTGCTCCCTGG - Intronic
1127289287 15:57555945-57555967 AACCATCTACAGCTTCGCCCTGG - Intergenic
1127603299 15:60560778-60560800 AAACATTAGCAGCTGCTGCTGGG - Intronic
1127717712 15:61665879-61665901 AACCATATGCAGATGCTGGTGGG + Intergenic
1129033515 15:72635824-72635846 AACCAGCTGCACCTGGTGCATGG + Intergenic
1129216370 15:74101410-74101432 AACCAGCTGCACCTGGTGCATGG - Intronic
1129408343 15:75334733-75334755 AACCAGCTGCACCTGTTGCATGG + Intergenic
1129471464 15:75757419-75757441 AACCAGCTGCACCTGGTGCATGG + Intergenic
1129522759 15:76196187-76196209 AAGCATCTGCACCTGCTCCCAGG - Intronic
1129733537 15:77945741-77945763 AACCAGCTGCACCTGGTGCATGG - Intergenic
1130648085 15:85745918-85745940 AGCCATCTGTATCTGCTTCCAGG - Intronic
1131642579 15:94308311-94308333 TACCATGTACAGCTGCTTCCTGG + Intronic
1133035429 16:3031404-3031426 ACTCACCTCCAGCTGCTGCCGGG + Intronic
1133513494 16:6483625-6483647 AAGCCTCTGCAGAAGCTGCCTGG - Intronic
1136540606 16:30925802-30925824 AACCCGCTGCCGCCGCTGCCGGG + Exonic
1137624380 16:49898507-49898529 GACCATCTGTGGCTGCTGCTTGG - Intergenic
1139000152 16:62499677-62499699 GACCATCTCTATCTGCTGCCTGG - Intergenic
1139060242 16:63241614-63241636 AACCTTCTCCAGGTGCTGTCAGG - Intergenic
1139583332 16:67885735-67885757 GGCCCGCTGCAGCTGCTGCCAGG - Exonic
1140377051 16:74452958-74452980 GACCAGCTGCTGCTGCTGCACGG + Intronic
1140486379 16:75296816-75296838 AGCCATCTGCAGCTGCTAACAGG + Intronic
1141435624 16:83998197-83998219 GACCAGCTGCAGGTGCTGCCGGG - Exonic
1142309328 16:89303144-89303166 AAGCATCTGCTTCTGCTTCCTGG - Intronic
1142540615 17:655856-655878 AACCACCTGCACATGCTGGCAGG - Exonic
1152742411 17:82024096-82024118 AAACACCTGCAGCCCCTGCCAGG - Intronic
1152785507 17:82245931-82245953 ACCCACCTGGCGCTGCTGCCTGG + Intronic
1152807349 17:82362456-82362478 ACCCTTCTGGGGCTGCTGCCAGG - Exonic
1153968479 18:10203284-10203306 AAACTTCTACAGCAGCTGCCAGG + Intergenic
1155545670 18:26912052-26912074 GACCATCTGCAGTGGCTGTCAGG + Exonic
1159564846 18:70036927-70036949 ATCTATCAGCAGCAGCTGCCTGG + Intronic
1159972116 18:74667546-74667568 CACCATATGCAGCTGCTGTGAGG - Intronic
1161027816 19:2044762-2044784 AACCATCTGCAGTGCCTGCTGGG - Intronic
1161156320 19:2733474-2733496 GACCTTCTGGAGCTGCAGCCGGG + Exonic
1163469458 19:17487976-17487998 AACCTCCTGTAGCTGCTGACAGG - Intronic
1164017782 19:21268080-21268102 AACCATCTGGAAATGCAGCCCGG - Intronic
1164027601 19:21366962-21366984 AACCATCTGGAAATGCAGCCTGG + Intronic
1165060534 19:33202928-33202950 TACCAGCTGCAGTTGGTGCCTGG - Exonic
1165491379 19:36125278-36125300 GACCACCTCCAGCTCCTGCCGGG - Intronic
1165771391 19:38382429-38382451 GCCCACCTCCAGCTGCTGCCAGG - Intronic
1165948482 19:39459221-39459243 ACCCAGCAGCAGCTGCTCCCAGG + Exonic
1166193756 19:41193394-41193416 AACCTCCTGCAGCTACGGCCCGG + Exonic
1167000312 19:46741875-46741897 AAGCTTCAGCAGCTGCTGGCAGG + Intronic
1168443498 19:56391980-56392002 AACCAGCTTTAGCTGCTGCAAGG + Intronic
925356084 2:3242306-3242328 AGCCATCGGTGGCTGCTGCCAGG - Intronic
926166629 2:10525230-10525252 CACCAGCTGGAGCAGCTGCCGGG - Intergenic
926307352 2:11648030-11648052 CTCCCTCTGCAGCTGCAGCCTGG + Intergenic
926348137 2:11968283-11968305 AACCATCTGCAAGTGCCGACAGG + Intergenic
927499608 2:23573952-23573974 GACCATCTGCAGGTGTTGCTGGG + Intronic
927638458 2:24832238-24832260 CTCCAGCTGCAGCTGCTGCCTGG + Intronic
929594575 2:43168247-43168269 ACCCTTCTGCAGCCTCTGCCTGG - Intergenic
934575133 2:95395453-95395475 AACCATGTGCAGAGGCAGCCAGG + Intergenic
935070453 2:99689281-99689303 AGCTGACTGCAGCTGCTGCCTGG + Intronic
937262922 2:120597899-120597921 GACCCTCTGCAGCCTCTGCCTGG - Intergenic
938374958 2:130798970-130798992 AAGCATCTCCAGCCTCTGCCAGG + Intergenic
940098083 2:150001418-150001440 ACCCATCTGATGCTTCTGCCAGG + Intergenic
941157718 2:161999621-161999643 AACCATCTGTAGCTGCTCGTTGG + Intronic
942552210 2:177131135-177131157 AACCGTCAGCAGCTGCAGCTTGG - Intergenic
943655805 2:190507370-190507392 AACAATCTGCTGGGGCTGCCAGG - Exonic
945810369 2:214542469-214542491 AAGCTTCTCCTGCTGCTGCCTGG + Intronic
946220189 2:218218866-218218888 AACCAACTGCAGCCCCTGGCAGG - Intronic
947178108 2:227387850-227387872 CACCACCTGCAGGTGCTACCGGG - Intergenic
947184322 2:227441613-227441635 AGTCATCTGCAGGTGCTGGCAGG + Intergenic
947197958 2:227587404-227587426 CACCACCTGCAGGTGCTACCGGG - Intergenic
947199130 2:227599066-227599088 CACCACCTGCAGGTGCTACCGGG + Intergenic
947201004 2:227614705-227614727 CACCACCTGCAGGTGCTACCGGG - Intronic
947201388 2:227617626-227617648 CACCACCTGCAGGTGCTACCGGG + Intronic
947206602 2:227666872-227666894 CACCACCTGCAGGTGCTACCGGG + Intergenic
947212946 2:227724631-227724653 CACCACCTGCAGGTGCTACCGGG - Intergenic
947213438 2:227728436-227728458 CACCACCTGCAGGTGCTACCGGG + Intergenic
947215478 2:227746013-227746035 CACCACCTGCAGGTGCTACCGGG + Intergenic
948004212 2:234593927-234593949 AACTCTCTGCAGCTGCAGTCAGG - Intergenic
1169473020 20:5904531-5904553 AACCAGCAGCATCTGCTGCAGGG + Intergenic
1172775384 20:37403894-37403916 GACCCTCTGCCGCTGCTTCCAGG + Exonic
1174578593 20:51555097-51555119 AGCCATCTTCATCTCCTGCCTGG + Intronic
1175441628 20:58996344-58996366 AACCGTCTCCAGATGGTGCCTGG - Intronic
1175627766 20:60503140-60503162 AGGCTTCTGCAGCTGCTGCTGGG + Intergenic
1176028607 20:62999263-62999285 AAGCGTCTTCACCTGCTGCCGGG - Intergenic
1176239403 20:64068959-64068981 GGGCAGCTGCAGCTGCTGCCTGG - Intronic
1178105827 21:29318230-29318252 AGCCATCATCAGCTCCTGCCTGG - Intronic
1178601534 21:33999039-33999061 ACCCATCCCCAGCTGCGGCCAGG + Intergenic
1180204510 21:46249806-46249828 AAGCCTCTGCAGGTGCTGTCTGG - Intronic
1180994340 22:19957816-19957838 AACCTTCTGCACCGGCTGCCTGG - Intronic
1181892650 22:26077366-26077388 AAACCCCTGCAGCTGCTCCCAGG - Intergenic
1182148934 22:28014938-28014960 CCCACTCTGCAGCTGCTGCCTGG - Intronic
1182524289 22:30906042-30906064 TCCGAGCTGCAGCTGCTGCCCGG - Exonic
1183187458 22:36300208-36300230 CTCCAGCTGCAGCTTCTGCCGGG + Exonic
1183338048 22:37262210-37262232 CACCATCTGCTGCTGCTGGGTGG - Intergenic
1184375310 22:44108324-44108346 CCCCATCTGCAGCTGGTGTCTGG + Intronic
1184700906 22:46171911-46171933 AACCACCTATAGCTTCTGCCCGG - Intronic
949258977 3:2083768-2083790 CACCATCCGCAGCCGCTGGCCGG - Intergenic
949355828 3:3179620-3179642 AACCACCTGCCGCTCCTGCCTGG - Exonic
949432995 3:3998734-3998756 ATCCATAGGCAGCAGCTGCCTGG + Intronic
950092376 3:10305032-10305054 CACCATCGCCAGCTGCTCCCAGG - Exonic
951551880 3:23882755-23882777 CACCCTCTGCAGCTGCTGGCTGG + Intronic
952382713 3:32817386-32817408 CACGAGCTGCAGCTGCTGCGGGG + Intergenic
952977013 3:38705109-38705131 AGCCATCTGCAGGTGCTGCTTGG + Intronic
953024535 3:39137286-39137308 ACCCAGCTGCGGCTGCTGCAGGG + Exonic
953252589 3:41260324-41260346 AAGCATCCTGAGCTGCTGCCAGG + Intronic
953844829 3:46418940-46418962 AGCCATCTGCAGCTGCTAGAAGG + Intergenic
954783770 3:53078715-53078737 CAGGATCTGGAGCTGCTGCCTGG - Intronic
954893664 3:53956766-53956788 AACCATGTGCAAATGCTGCCTGG - Intergenic
955090706 3:55748010-55748032 TTCCTTCTGCAGCTGCTGTCTGG - Intronic
956205745 3:66753060-66753082 TACCATCTCCACCTGTTGCCTGG + Intergenic
956438822 3:69260415-69260437 CACCCTCCGCAGCTGCTGGCTGG - Intronic
959622220 3:108410830-108410852 CTCCAGCTGCAGCTGGTGCCTGG + Exonic
960479545 3:118171537-118171559 CACCCTCTGCAGCTGCTGGCCGG - Intergenic
960814473 3:121658675-121658697 AACCACCTCCAGCCACTGCCTGG - Intronic
962200740 3:133399454-133399476 AAGGACCTGAAGCTGCTGCCAGG + Intergenic
962525702 3:136235680-136235702 CACAATCTACAGCTGCTGCCAGG + Intergenic
962637838 3:137349115-137349137 GAGCAGCAGCAGCTGCTGCCTGG + Intergenic
962826032 3:139101671-139101693 AAGCACCTGCAGCTGCTCCTGGG + Intronic
966473328 3:180317125-180317147 AAGCAGCTCCAGCTGCTTCCTGG + Intergenic
967194272 3:187012968-187012990 AGCCCTCTGCAGCCCCTGCCTGG - Intronic
968149216 3:196323931-196323953 AGCCCTCTGCAGCTGTTGTCTGG - Exonic
968985799 4:3873700-3873722 AACCAAATGCATCTGCTGCGAGG - Intergenic
970013016 4:11481231-11481253 AACACTCTGCAGCTGAAGCCTGG + Intergenic
977483975 4:97618194-97618216 AAAAATCTACAGCTTCTGCCTGG + Intronic
979727785 4:123985064-123985086 CATCATCAGCAGCTGCTGCAGGG + Intergenic
983251036 4:165346782-165346804 AACCAGGTGCAGGGGCTGCCGGG + Intergenic
984268201 4:177519686-177519708 AATCATATGAAACTGCTGCCTGG - Intergenic
984732227 4:183078725-183078747 ACCCATCTGCAGGTACTGCAGGG - Intergenic
985324706 4:188754640-188754662 CCCCCTCTGCAGCTGCTGGCTGG - Intergenic
986052534 5:4103508-4103530 AACCCTCCACAGCTGCAGCCTGG - Intergenic
986589002 5:9349362-9349384 AACCAACTGTAGGTACTGCCTGG + Intronic
987298393 5:16574626-16574648 AACAGTCTGCAACTGCTGCCAGG + Intronic
987475884 5:18392176-18392198 TGCCAGCTGCAGCTGCTGCCTGG + Intergenic
992179501 5:74182901-74182923 TACCAACTGCAGCTCATGCCGGG + Intergenic
992182050 5:74207121-74207143 CAGCATGTGCAGCTCCTGCCTGG + Intergenic
997349335 5:133219235-133219257 AACCTTCTCCAGCTCCTGCTTGG + Intronic
997528815 5:134569915-134569937 CACCACCTCCAGCTGCTCCCAGG + Intronic
998168210 5:139856438-139856460 TACCCTCTGCTGCTGCTGCTGGG + Intronic
1003013371 6:2447434-2447456 ACCCAGCTCTAGCTGCTGCCTGG - Intergenic
1005118755 6:22367632-22367654 AACCTTCTGAAGCTCCTCCCTGG + Intergenic
1005903547 6:30240653-30240675 AATAATCTGGAGTTGCTGCCAGG + Intergenic
1006173360 6:32108021-32108043 AACCATTTTCAGCTGGGGCCTGG - Intronic
1006326762 6:33360119-33360141 AACCACATGCCTCTGCTGCCAGG - Intergenic
1006388641 6:33746222-33746244 CAGCATCTACAGCAGCTGCCTGG - Intronic
1007421231 6:41720932-41720954 AAGCATGGGCAGCTCCTGCCAGG + Intronic
1007919826 6:45596660-45596682 AATCATCTCCAGCTGCTGCCGGG + Intronic
1008449929 6:51638927-51638949 AACCATCTTGAGTTTCTGCCTGG + Exonic
1019377141 7:698906-698928 CACCAGCTGCTGCTGCTGCGTGG - Intronic
1019576510 7:1740195-1740217 GCCCATCTGCACCTGCTCCCAGG - Intronic
1019634688 7:2069296-2069318 CTCCTCCTGCAGCTGCTGCCTGG + Exonic
1019733115 7:2638215-2638237 AGCCCTCTGCACCAGCTGCCTGG - Intronic
1019982099 7:4629353-4629375 AGCAAGCTGCTGCTGCTGCCAGG + Intergenic
1020213419 7:6171620-6171642 CACCATCTCCTGCTGCTGCCAGG + Intronic
1020438355 7:8189803-8189825 AGGCTCCTGCAGCTGCTGCCTGG - Intronic
1023258403 7:38334851-38334873 AACAAGGTGCAGCTGCTGCCAGG + Intergenic
1023259534 7:38344841-38344863 AACAGGGTGCAGCTGCTGCCAGG + Intergenic
1023260469 7:38353526-38353548 AACAGGGTGCAGCTGCTGCCAGG + Intergenic
1023260978 7:38358323-38358345 AACAGGATGCAGCTGCTGCCAGG + Intergenic
1023261443 7:38362675-38362697 AACAGGGTGCAGCTGCTGCCAGG + Intergenic
1023261946 7:38367412-38367434 AACAGGGTGCAGCTGCTGCCAGG + Intergenic
1026867301 7:73831662-73831684 ACCCATCTCCCGCTTCTGCCCGG - Exonic
1026878534 7:73893758-73893780 TCCCAGCTGCAGCTGCTGCCAGG + Intergenic
1028727176 7:94101034-94101056 CCCCCTCTGCAGCTGCTGGCTGG - Intergenic
1029105218 7:98169464-98169486 AACCAACAGCAGCTGCTGGCAGG - Intronic
1029881832 7:103821339-103821361 AGCCAACTGCAGCATCTGCCTGG - Intronic
1031977708 7:128104352-128104374 TGCCATCTCCAGCTGCAGCCCGG - Intergenic
1033238748 7:139659480-139659502 CACAAGCTGCAGCTGCAGCCGGG - Intronic
1034266741 7:149784816-149784838 AACCTCCTGCAGCATCTGCCAGG + Intergenic
1034938560 7:155215271-155215293 AAGCAGCAGCAGCTGCTGGCAGG - Intergenic
1035233451 7:157480839-157480861 AACCACCGCCCGCTGCTGCCTGG + Intergenic
1036453937 8:8892447-8892469 CACCAGCTGCAGCAGCTGCCGGG + Exonic
1037518088 8:19653496-19653518 CACAATCTTCAGCTGCGGCCAGG + Intronic
1038591022 8:28838065-28838087 ACCCTTCGGCAGCTGCTGCCAGG + Intronic
1039465415 8:37782059-37782081 TCCCATCTGCACCAGCTGCCTGG + Intergenic
1039800655 8:40951844-40951866 CAGCATCTTCTGCTGCTGCCTGG - Intergenic
1041197777 8:55418298-55418320 AACCATCAGGAGCTCCTGTCAGG - Intronic
1042532498 8:69830702-69830724 TACCCTCTGCAACTGCTGCCTGG + Intronic
1046198203 8:110890413-110890435 AGCTGTCTGCAGCTGCTGCTGGG + Intergenic
1047583454 8:126242575-126242597 GAACCTGTGCAGCTGCTGCCTGG - Intergenic
1047630881 8:126706849-126706871 AACCAGCTTCACCTGTTGCCAGG + Intergenic
1048231074 8:132642672-132642694 TACCATCTGGAGCTGCTTCTGGG - Intronic
1049097537 8:140557839-140557861 GGCCATCTGCAGCCTCTGCCAGG + Intronic
1049180393 8:141219183-141219205 AAGAAACTGCAGCTGCTGCTGGG + Intronic
1049745458 8:144261308-144261330 GTCCACCTGCGGCTGCTGCCTGG - Exonic
1049944508 9:580990-581012 CACCCTCCGCAGCTGCTGGCTGG + Intronic
1050674760 9:8039218-8039240 AACCATCATCATCTGTTGCCTGG - Intergenic
1051180761 9:14409501-14409523 AGCCGTCTGTTGCTGCTGCCTGG - Intergenic
1052122534 9:24736107-24736129 TATCTTCTGCAGCTGCTGTCTGG + Intergenic
1055159080 9:73102629-73102651 CAACATCTGTAGTTGCTGCCTGG - Intergenic
1055453990 9:76456260-76456282 AACCAGCTGTTGCTGCAGCCAGG - Intronic
1055874608 9:80927001-80927023 AATTTTCTGCAGCTGCTGTCTGG + Intergenic
1055925621 9:81507514-81507536 CACCCTCCGCAGCTGCTGGCCGG - Intergenic
1056691866 9:88814721-88814743 AATCAGCTGCAGCTGCTGCTGGG - Intergenic
1057005636 9:91556148-91556170 AACCATCTGCAGGTGGTCACTGG - Intergenic
1057118164 9:92545390-92545412 CACCCTCCGCAGCTGCTGGCCGG - Intronic
1059697810 9:116745340-116745362 AAACAAATACAGCTGCTGCCTGG - Intronic
1060996796 9:127878573-127878595 CACCATCTGGGGCTGCTGCCTGG - Intergenic
1061513093 9:131072687-131072709 CAGCCTCTGCAGCTGCTCCCGGG - Exonic
1062137838 9:134939029-134939051 ACCCCTCTGCTGCTGCAGCCTGG + Intergenic
1062162210 9:135086957-135086979 GACCTTATGCAGCTCCTGCCGGG + Intronic
1062602387 9:137323724-137323746 AGACATCTTCAGCCGCTGCCAGG - Exonic
1062671493 9:137712408-137712430 AGCCCTCTGCAACTGCTGCAGGG - Intronic
1062714852 9:138004009-138004031 AACCATCCTCTGCTGCTGGCGGG + Intronic
1186463365 X:9765666-9765688 GGCCTTCTGCAGCTGCTGCCCGG - Exonic
1188501709 X:30834048-30834070 AACCATCTGCAGCTGCTGCCTGG + Exonic
1189023833 X:37370769-37370791 AAGTATCTGCTCCTGCTGCCTGG + Intronic
1191016939 X:55819124-55819146 AACCCTTTTCACCTGCTGCCTGG - Intergenic
1191189786 X:57654760-57654782 AATTATCTGCAGATCCTGCCAGG + Intergenic
1193960519 X:87919659-87919681 TAGCATCTGCATCTGCTGACTGG + Intergenic
1194621421 X:96177180-96177202 AACCATTTGCAGCTGCAGTGGGG + Intergenic
1195871118 X:109487243-109487265 GACAATCTGCAGCTGGTGACAGG - Intergenic
1196010345 X:110880295-110880317 ATCCATCTGCAGATGGTGACAGG + Intergenic
1196018505 X:110964946-110964968 CACAAGCAGCAGCTGCTGCCTGG - Intronic
1197033369 X:121845971-121845993 AAGCTTCTGCTGCTGCTGTCTGG - Intergenic
1197294940 X:124707431-124707453 AATCATGTGAAACTGCTGCCTGG - Intronic
1198167230 X:134070051-134070073 ATGCAGCTGTAGCTGCTGCCTGG + Intergenic
1198256134 X:134925785-134925807 CACCCTCCGCAGCTGCTGGCCGG - Intergenic
1199861154 X:151801397-151801419 AAGCACCTGCTCCTGCTGCCTGG - Intergenic
1199964741 X:152810597-152810619 ACCCATCTGGAGCTGTTGCTAGG - Intergenic
1200179075 X:154139430-154139452 CTCCATCTGCAGCTGCATCCCGG + Intergenic
1200281322 X:154779324-154779346 GTCCTTCTGCAGCTGCTGCAGGG + Exonic