ID: 1188502194

View in Genome Browser
Species Human (GRCh38)
Location X:30839650-30839672
Sequence TAGGATGCTGATAATGGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 445
Summary {0: 1, 1: 0, 2: 5, 3: 53, 4: 386}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188502194 Original CRISPR TAGGATGCTGATAATGGGGC AGG Intronic
900079681 1:846505-846527 GGGGATGTTGATAATGGGGGAGG + Intergenic
900750515 1:4394038-4394060 GATGATGCTGATCATGGGGGAGG + Intergenic
901127063 1:6937047-6937069 TATGATGGTGATAATGGTGACGG - Intronic
901408384 1:9065700-9065722 TAGAATGGGGATAATGGGCCTGG + Intronic
901815798 1:11792772-11792794 TAGAATGCTGATAATACGGGAGG + Intronic
902070855 1:13735652-13735674 TAGGATGTTGATAATGGGGAAGG - Intronic
902957076 1:19932960-19932982 TATGATGGTGATAATGGTGATGG - Intergenic
902995740 1:20223419-20223441 TAGGGTGCTGATGGTGGGGATGG - Intergenic
904686654 1:32265730-32265752 TAGGTTGGAGATCATGGGGCTGG - Intronic
905272481 1:36796020-36796042 CAGGATGCTCCTCATGGGGCTGG + Exonic
906596684 1:47083825-47083847 TAGGTAGGTGATAATGGGGGTGG - Intronic
908238107 1:62166799-62166821 GAGGATGTTGATAATGGGAGAGG - Intergenic
908674771 1:66591535-66591557 GGGGATGTTGATAATGGGGGAGG - Intronic
908843852 1:68304857-68304879 TAGGATGAAGATAATGGTGGAGG - Intergenic
908917294 1:69143483-69143505 GGGGATGTTGATAATGGGGAAGG + Intergenic
909510361 1:76446265-76446287 ATGGATGTTGATAATGGGGGAGG - Intronic
910136121 1:83972043-83972065 GTGGATGTTGATAATGGGGGAGG - Intronic
910767946 1:90801289-90801311 TGGGATGTTGAGAATGGGGGAGG - Intergenic
911648108 1:100356912-100356934 TAGGATGGTGACAATGGTGATGG + Intronic
911809607 1:102258599-102258621 GAGGATGTTGATAATGGTGGAGG + Intergenic
912010916 1:104961201-104961223 GAGGATGTTGATAATGGGGAAGG + Intergenic
912136944 1:106672310-106672332 AAAGATGTTGATAATGGGGAAGG + Intergenic
912346954 1:108972526-108972548 GGGGATACTGATAATGGGGGAGG + Intronic
912768708 1:112442002-112442024 GATGATACTGATAATGGGGGCGG + Intronic
912970844 1:114281593-114281615 GGGGATGTTGATAATGGGGGAGG + Intergenic
913235476 1:116777469-116777491 GGGGATGTTGATAATGGGGAAGG + Intergenic
916949056 1:169760273-169760295 CGGGATGCTGATACTGGGGGAGG - Intronic
917001951 1:170370175-170370197 TGGGATTCTAATACTGGGGCAGG + Intergenic
918927297 1:190804895-190804917 TAGGCTGCTCAAAATGTGGCAGG - Intergenic
920162217 1:204007737-204007759 TGGGATGTTAATAATGGGGGAGG + Intergenic
920491190 1:206416700-206416722 TAGGATGCTGAGAGTTGGGCAGG - Intronic
920885341 1:209922193-209922215 TTGGATGCTGATAATGAAGGAGG - Intergenic
920945813 1:210527510-210527532 TATGATGCTGATAATGGTGATGG - Intronic
921564969 1:216705923-216705945 TAGGATGATGATAATGTACCTGG - Intronic
921582498 1:216911654-216911676 GGGGAAGCTGATAATGGAGCAGG + Intronic
922318297 1:224462097-224462119 GCGGATGGTGATAATGGGGGAGG - Intronic
923717681 1:236438775-236438797 CAGGATGCTGACAATGGGGGTGG - Intronic
924664609 1:246058284-246058306 GAGGATGCTGAGAATGAGGGAGG + Intronic
1062778332 10:175163-175185 TGGGATGTTGATAATAGGGGAGG + Intronic
1063644330 10:7864019-7864041 TAGGATACTGACAGTGGGGAAGG - Intronic
1063894986 10:10670527-10670549 GGGGATGCTGATAATGTGGGAGG - Intergenic
1064715102 10:18168300-18168322 TGGGAGGCTGTTAATGAGGCTGG + Intronic
1065244942 10:23747394-23747416 TATGAAGATGATAATGGGGTGGG + Intronic
1067397457 10:45935439-45935461 GGGGATGTTGATAATGGGGGAGG + Intergenic
1067761465 10:49050982-49051004 CAGGATGTTGATCATGGGGGAGG - Intronic
1067865775 10:49904525-49904547 GGGGATGTTGATAATGGGGGAGG + Intronic
1068345420 10:55771722-55771744 GAGGATACTGATAATGAGGGAGG - Intergenic
1068957072 10:62827821-62827843 TAGGATTCTTATAATGAGTCAGG - Intronic
1069107296 10:64398568-64398590 GAGGATGTTGATAATGGGGGAGG - Intergenic
1070204293 10:74241306-74241328 GGGGATGCTGAAAATGGGGGAGG - Intronic
1070334940 10:75446986-75447008 AAGCATGCTGATATTGGGGTAGG + Intronic
1070447449 10:76521428-76521450 TAAAATGGTAATAATGGGGCTGG - Intronic
1071534770 10:86419338-86419360 CAGGATGTTGATCATGGGGGAGG + Intergenic
1073213898 10:101826170-101826192 TGGGGTGCTGACAATGGGGTTGG + Intronic
1073260255 10:102184314-102184336 AAAAATGCTGATAATGGGTCAGG - Intergenic
1073638512 10:105224016-105224038 GAGGATGTTGATAATGGAGGAGG - Intronic
1074146620 10:110722349-110722371 GGGGATGCTGATAATGGGGGAGG - Intronic
1075447438 10:122523498-122523520 AGGGATGTTGATAATGGGGGCGG + Intergenic
1075501402 10:122978519-122978541 AAGGATGTTGATAGTGGGGGAGG + Intronic
1075574784 10:123570483-123570505 TGGGAGGCTGTTCATGGGGCAGG + Intergenic
1075870310 10:125767974-125767996 GAGGATGATGTTCATGGGGCAGG - Intronic
1076082092 10:127591443-127591465 GAGGATGTTGATAATGGGGAGGG + Intergenic
1077348027 11:2073341-2073363 TATGATGCTGAGAACGGGGGTGG - Intergenic
1078094608 11:8289124-8289146 TAGGATGCTGGGCATGGGGTTGG - Intergenic
1078420732 11:11210051-11210073 TAGCATGGTGGTAATGAGGCTGG - Intergenic
1079953477 11:26833488-26833510 TGGGATGTTGATAGTGGGGAAGG - Intergenic
1080720870 11:34847569-34847591 TAGGATACAGATATTGGGGGTGG + Intergenic
1080831928 11:35902645-35902667 TAGGATGCTGATATTGTTACTGG - Intergenic
1082635721 11:55591009-55591031 AAGGATGTTGATAATGGAGAAGG - Intergenic
1083898656 11:65633153-65633175 TAAGATGGAGCTAATGGGGCAGG - Intronic
1084924194 11:72498835-72498857 GGGGATGTTGATAATGGGGGAGG - Intergenic
1086326391 11:85705513-85705535 TGGGATGTTGATAGTGGGGGAGG - Intronic
1086663159 11:89446936-89446958 GGGGATGTTGATAATGGGGGAGG + Intronic
1087055568 11:93932618-93932640 GGGGAAGCTGATAATGGGGGAGG + Intergenic
1087663972 11:101020968-101020990 TATGATGATGATGATGAGGCAGG + Intergenic
1087803806 11:102533892-102533914 AGGGATGTTGATAATGGGGGAGG + Intergenic
1087955529 11:104282231-104282253 GAGGATGTTGATAATGGAGGAGG - Intergenic
1088523325 11:110723709-110723731 ACGGATGCTGATAATGAGGGAGG - Intergenic
1088753148 11:112862795-112862817 GAGGTTGCTGATTCTGGGGCTGG - Intergenic
1088991625 11:114958903-114958925 GAGGATGTTGATAGTGGGGAAGG + Intergenic
1089438972 11:118498656-118498678 GGGGATGCTGATCATGGGGGAGG - Intronic
1090314776 11:125776581-125776603 CAAAATGCTGATAATGTGGCAGG - Exonic
1090398178 11:126432731-126432753 TAGGATGGGGATAATGGTACCGG + Intronic
1090504509 11:127297144-127297166 GAAAATGCTGATAATGGGCCAGG + Intergenic
1090847251 11:130540615-130540637 AGGGATGCTGATAGTGGGGAAGG - Intergenic
1091295903 11:134473883-134473905 CAGTGTGCTGATAATGGGGTTGG + Intergenic
1091426044 12:390203-390225 TAGGATACTGGTAACGGGGATGG - Intronic
1091454462 12:596429-596451 GGGGATGTTGATAATGGGGGCGG + Intronic
1091668742 12:2437728-2437750 TTGGATGGTGGTAATGGGGATGG + Intronic
1092908739 12:13126091-13126113 TGGGATGCTGATAATGAGGCTGG - Intronic
1093176907 12:15922890-15922912 GGGGATGTTGATAATGGGGGAGG + Intronic
1093858620 12:24136087-24136109 TAGGATCCTGAAAATGGGAATGG + Intergenic
1094215341 12:27935021-27935043 GGGGATGTTGATAATGGGGAAGG + Intergenic
1096149707 12:49301187-49301209 TAAGATGTTGGTAATGGGGATGG - Intergenic
1097744979 12:63291693-63291715 TAGGATGCTGCTACTCTGGCAGG - Intergenic
1098069356 12:66655410-66655432 TGGGATGTTGATAGTGGGGGAGG - Intronic
1098656392 12:73035689-73035711 GAGGATGTTGATACTGGGGGAGG - Intergenic
1099017312 12:77359346-77359368 GAGGATGTTGATGATGAGGCAGG - Intergenic
1099151879 12:79124617-79124639 GAGGATGATGATAATGGCGATGG - Intronic
1099230397 12:80016944-80016966 CAGGATGCTGAGAATCGTGCAGG + Intergenic
1100636957 12:96443713-96443735 TAGGATGTTGATGGTGGGGGAGG - Intergenic
1100992091 12:100262096-100262118 CAGGATGTTGATAATGGGGAAGG + Intronic
1101430955 12:104626789-104626811 GAGGATGCTGATGACGGGGGAGG - Intronic
1101872617 12:108578561-108578583 GGGGCTGGTGATAATGGGGCTGG - Intergenic
1102203025 12:111070542-111070564 GGAGATGCTGATAATGGGGGAGG - Intronic
1102384485 12:112496668-112496690 TAGGTTGGTGATAATGAGACTGG - Intronic
1102677406 12:114668097-114668119 TCCGAGGCTGAGAATGGGGCTGG + Intergenic
1102821996 12:115916321-115916343 TAAGAAGGTGAAAATGGGGCCGG + Intergenic
1102824571 12:115937179-115937201 CAGGATGTTGATGATGGGGGAGG + Intergenic
1103295550 12:119883595-119883617 GAGGATAGTGATAATGGGGCAGG - Intergenic
1105654266 13:22418484-22418506 GAGGAGGTTGATAATGGGGAGGG + Intergenic
1105670478 13:22608005-22608027 CAGGATGCTGATAGTGGGGGAGG + Intergenic
1106110255 13:26771001-26771023 AAGGATGTGGATAATGGGGGAGG + Intergenic
1106173908 13:27312004-27312026 CAGGATGCTGCTAGTGGGGGAGG - Intergenic
1107270726 13:38613063-38613085 TAGGATGATGAGAATAGGGGTGG + Intergenic
1108092135 13:46859885-46859907 TAGGATGGTGATGATAGGCCAGG - Intronic
1109150481 13:58841774-58841796 GAAGATGCTGATAAAGAGGCAGG + Intergenic
1109453585 13:62551845-62551867 TAGGATTCCCATAATGGGGTGGG + Intergenic
1109676531 13:65682926-65682948 AGGGATGCTGATAATGAGGGAGG - Intergenic
1110292310 13:73821346-73821368 TAGGATGCTGGAAATGAGACTGG - Intronic
1110753432 13:79143103-79143125 TGGGATGTTGATAGTGGGGGAGG - Intergenic
1110873496 13:80480398-80480420 GGGGATGCTGATAATGGGGGAGG - Intergenic
1111533081 13:89565559-89565581 CAGGATGTTGACAGTGGGGCAGG + Intergenic
1111599957 13:90460382-90460404 GGGGATGCTGATAATGGGGGAGG - Intergenic
1111605039 13:90526890-90526912 CAGAATGTTGATAATGGGGGAGG + Intergenic
1111652563 13:91110372-91110394 AAGGTTGCTGATACTCGGGCTGG - Intergenic
1113371082 13:109726105-109726127 TAGGATTCTGAATGTGGGGCGGG + Intergenic
1114546165 14:23503216-23503238 GGGGATGTTGATAATGGGGGAGG - Intronic
1115061511 14:29196590-29196612 TAGGATGTTGATAAGGGATCTGG + Intergenic
1116218037 14:42045505-42045527 GGGGATGTTGATAATGGGGGAGG - Intergenic
1117651352 14:57909213-57909235 TGGGGTGCTGATAGTGGGGGAGG - Intronic
1117927996 14:60805339-60805361 CAGGATGTTAATAATGGGGGAGG - Intronic
1118534718 14:66748457-66748479 AAGAATGTTGATAATGGGGGAGG - Intronic
1118842487 14:69523726-69523748 TAGGATTTTGAAAATTGGGCAGG + Intronic
1119197743 14:72729983-72730005 GAGGATGTTGATCATGGGGGAGG + Intronic
1120751842 14:88204822-88204844 TGGGATGTTGATAGTGGGGAAGG - Intronic
1120837519 14:89054763-89054785 GGGGATGTTGATAATGGGGGAGG + Intergenic
1121075884 14:91067843-91067865 TAAGATATTGATAATGGGCCAGG - Intronic
1122360306 14:101156009-101156031 GGGGATGCTGATAATGTGGGAGG - Intergenic
1202829209 14_GL000009v2_random:8086-8108 TGGGATGCAGAGAGTGGGGCTGG + Intergenic
1202900921 14_GL000194v1_random:37938-37960 TGGGATGCAGAGAGTGGGGCTGG + Intergenic
1125262383 15:37842100-37842122 TGGGATGTTGATAGTGGGGCAGG - Intergenic
1125428265 15:39571380-39571402 AGGGATGCTGATAATGAGGCTGG - Intergenic
1125742440 15:41975116-41975138 CAGGATGTTGATAGTGGGGGAGG - Intergenic
1126408334 15:48345927-48345949 GGGGATGCTGATAATGGAGGGGG - Intergenic
1126419198 15:48453713-48453735 GAGGATGCTGATGATGGGGGAGG + Intronic
1127068042 15:55260989-55261011 TGGGATGTTGATAGTGGGGGAGG + Intronic
1128023183 15:64411370-64411392 AGGGATGCTAATAATGGGGGAGG + Intronic
1128711887 15:69878383-69878405 AAGGATGATGATAATGGAGGGGG + Intergenic
1129712644 15:77828436-77828458 TAGGATGCAGGAAATGAGGCAGG - Intergenic
1130418722 15:83719641-83719663 TGGGTTGCTGATTGTGGGGCTGG + Intronic
1130878967 15:88038596-88038618 GAGGATGCTGATCATGAGGGAGG + Intronic
1133734498 16:8603869-8603891 GGGGATGCTGATAATGGGAGAGG - Intergenic
1135159437 16:20080624-20080646 CAGGATGTTGATAATAGGGGAGG - Intergenic
1135839399 16:25860929-25860951 GGGGATGCTGATAATGAGGGAGG + Intronic
1136221500 16:28832246-28832268 CAGGAAGCTGAGATTGGGGCAGG - Exonic
1137673946 16:50294624-50294646 GAGGATGCTGGGGATGGGGCAGG - Exonic
1138356123 16:56381882-56381904 AGGGATGTTGATAATGGGGAAGG + Intronic
1139734228 16:68973467-68973489 AAGGTTGCTGAGTATGGGGCTGG + Intronic
1141119085 16:81336868-81336890 TGGTATACTGATAATGGGGGAGG - Intronic
1141140889 16:81496121-81496143 TAGAATGGGGATAATGGGACTGG + Intronic
1141162309 16:81637760-81637782 TGGCATGCTGAGCATGGGGCTGG + Intronic
1141618549 16:85224022-85224044 AATGGTGCTGATAATGGGGCTGG - Intergenic
1141838337 16:86557794-86557816 CAGGATGTTGATAGTGGGGGAGG - Intergenic
1142125910 16:88410344-88410366 TATGATGCTGTTGATGGTGCAGG + Intergenic
1142125913 16:88410389-88410411 TATGATGCTGTTGATGGTGCAGG + Intergenic
1142125929 16:88410562-88410584 TATGATGCTGTTGATGGTGCAGG + Intergenic
1142125943 16:88410761-88410783 TATGATGCTGTTGATGGTGCAGG + Intergenic
1142821628 17:2473055-2473077 GGGGATGCTGATAATGGAGAAGG + Intronic
1143567672 17:7734354-7734376 TCGGATGCTGACAATGGAGTTGG + Intronic
1144203994 17:12966335-12966357 GAGGAGGCTGATAAGGGGCCTGG - Intronic
1145408536 17:22633532-22633554 GAGGATACTGATAATGAGGGAGG - Intergenic
1146349476 17:32083378-32083400 GACGGTGCTGCTAATGGGGCGGG - Intergenic
1147188855 17:38727293-38727315 TAGGGAGCTGATAATGGAGGGGG + Exonic
1148023166 17:44567003-44567025 AGGGATGTTGATAATGGGGAAGG - Intergenic
1148034474 17:44648484-44648506 CAGGATGCTGATATTGGGGGAGG + Intergenic
1148831356 17:50434017-50434039 CAAGATGCTGAAAATGGGCCAGG + Intronic
1150386470 17:64765526-64765548 TCAGATGCTGAGAATGGGGAGGG - Intergenic
1151087429 17:71396958-71396980 GAGGATTTTGATAATGGGGGAGG + Intergenic
1151427834 17:74042625-74042647 GAGGATGCTGAGACTGGGGGAGG - Intergenic
1151516031 17:74596513-74596535 GGGGATGTTGATAATGGGGGAGG - Intergenic
1151532925 17:74718963-74718985 GAGGGTGTTGATAATGGGGAAGG + Intronic
1153239342 18:3016267-3016289 GAGGATGCTTAGAATTGGGCAGG - Intergenic
1153404999 18:4727852-4727874 TGGGATGTTGCTAATGGGGGAGG + Intergenic
1153792618 18:8593768-8593790 GAGGATGCTGCTAATGGGGGAGG + Intergenic
1153945039 18:10010496-10010518 TTTGATGCTGATAATTGAGCTGG - Intergenic
1155856013 18:30835467-30835489 GAGAATGTTGATAATGGGGAAGG + Intergenic
1157640695 18:49210751-49210773 CAGGATGTTGATAGTGGGGGAGG + Intronic
1158519505 18:58159444-58159466 CAGGATGTTGATCATGGGGGAGG + Intronic
1159625728 18:70691815-70691837 TAGGATGCCTAGAATGAGGCAGG - Intergenic
1159736511 18:72105611-72105633 TGGAATGTTGATAATGGGGGAGG + Intergenic
1161670967 19:5609186-5609208 TAAGATGCTGCTCATGGGGGTGG - Intronic
1161899397 19:7106823-7106845 TAGGATGGTGATGATGGTGATGG + Intergenic
1166675373 19:44737754-44737776 CAGGATACTGAGGATGGGGCAGG - Intergenic
1167839990 19:52107979-52108001 GAGGATGTTGACAATGGGGAAGG + Intergenic
1202643486 1_KI270706v1_random:119703-119725 TGGGATGCAGAGAGTGGGGCTGG - Intergenic
925483001 2:4297323-4297345 TGGGATGTTGATAATGGAGAAGG - Intergenic
926204728 2:10828037-10828059 TGGGATGTTGATAGTGGGGAAGG - Intronic
926384540 2:12323401-12323423 GAGGATGCTGTTAATGGAACAGG + Intergenic
926780874 2:16470770-16470792 GGGGATGTTGATAATGGGGGAGG + Intergenic
927557602 2:24047171-24047193 GAGGATGAGGAGAATGGGGCGGG - Intronic
931276815 2:60751369-60751391 CAGGATGTTGATAATGGAGGAGG + Intergenic
932406929 2:71519506-71519528 TGGGATGATGATAGTGGGGAAGG - Intronic
933531130 2:83513740-83513762 GTGGATGTTGATAATGGGGGAGG + Intergenic
934505869 2:94893162-94893184 TGGGATGCAGAGAGTGGGGCTGG - Intergenic
935195858 2:100815725-100815747 GGGGATGCTGATAGTGGGGGAGG + Intergenic
935209245 2:100924179-100924201 GGGGATGCTGATAATGGGGGAGG - Intronic
935506273 2:103908057-103908079 AAGGATGCTGATAATGGAGGAGG - Intergenic
936919414 2:117672212-117672234 GGGGATGTTGATAATGGGGGAGG + Intergenic
936958772 2:118050783-118050805 TAGGATGTTAATAATGCTGCGGG - Intergenic
937564186 2:123263535-123263557 TAGGCTGCTGACAAGGGGGCAGG - Intergenic
939173817 2:138726709-138726731 CAGGATGCTGACAATGGGGGAGG - Intronic
939255959 2:139745064-139745086 TAGGATGGTGGTAATGGTGGGGG + Intergenic
939857850 2:147382033-147382055 TGGGATGTTGATAATTGGGGAGG + Intergenic
939940550 2:148345097-148345119 CAAGATGTTGATAATGGGGGAGG + Intronic
941089553 2:161159283-161159305 AGGGATGTTGATAATGGGGAAGG + Intronic
942287018 2:174429555-174429577 TGGGATGTTGATAGTGGGGGAGG - Exonic
942919028 2:181348300-181348322 GGGGATGTTGATAATGGGGGAGG + Intergenic
944194500 2:197038214-197038236 GAGGATGATGATAATGGAGGAGG + Intronic
944671264 2:201996208-201996230 TGGAATGCTGATACTGGAGCGGG - Intergenic
945659611 2:212669452-212669474 TTGGATGGTGAAAATGAGGCAGG + Intergenic
946174638 2:217915011-217915033 GAGGATGCTGAGCATGGGGAGGG - Intronic
946671748 2:222112137-222112159 GAGGATGTTGATAATGGGGGAGG + Intergenic
947383090 2:229563922-229563944 GAGGATGATGATAATGGTGATGG - Intronic
947731769 2:232435229-232435251 CAGGTTGCTGCTGATGGGGCCGG - Intergenic
948844357 2:240676136-240676158 TGGGATGCTGAGGATGGTGCTGG - Intergenic
1169591511 20:7147857-7147879 TATGATGGTGATAGTGGGACAGG + Intergenic
1170417042 20:16155675-16155697 GAGGATGTTCATAATGGGGGAGG + Intergenic
1170757436 20:19216839-19216861 TTGGATGGGGGTAATGGGGCTGG + Intronic
1171384522 20:24761156-24761178 TGGGATGTTGATAATGGGGAAGG + Intergenic
1174444460 20:50581189-50581211 AAGGATGCTGCTATTGTGGCAGG - Intronic
1174714539 20:52743725-52743747 TAGTATGTAGATTATGGGGCAGG - Intergenic
1175911834 20:62408677-62408699 TAGGGTGCTGAGGCTGGGGCAGG + Intergenic
1176608393 21:8852926-8852948 TGGGATGCAGAGAGTGGGGCTGG + Intergenic
1176620295 21:9052716-9052738 TGGGATGCAGAGAGTGGGGCTGG + Intergenic
1176889148 21:14293371-14293393 GAGGATGTTGATAATGGGGGAGG + Intergenic
1177001123 21:15614493-15614515 GGGGATGTTGATAATGGGGAAGG + Intergenic
1177935587 21:27341308-27341330 CAGGATGTTGATAATGAGGCAGG + Intergenic
1178136438 21:29633059-29633081 TAGGAATCTTATAAAGGGGCTGG + Intronic
1178381157 21:32110040-32110062 GGGGATGTTGATAATGGGGAAGG + Intergenic
1178861057 21:36290109-36290131 CAGGATGTTGATAATACGGCAGG + Intronic
1179192626 21:39136353-39136375 GAGGATGTTGATAATGGCGGAGG + Intergenic
1179227644 21:39469198-39469220 GGGGATGTTGATAATGGGGGAGG - Intronic
1180019330 21:45111396-45111418 ACGGATGTTGATAATGGGGGAGG - Intronic
1180153154 21:45962780-45962802 CAGGAGGCAGATAATGGGGAGGG - Intergenic
1180237399 21:46471431-46471453 TGGGATGCTGATAATGCGGGAGG - Intronic
1180358476 22:11862730-11862752 TGGGATGCAGAGAGTGGGGCTGG + Intergenic
1180379786 22:12129600-12129622 TGGGATGCAGAGAGTGGGGCTGG - Intergenic
1183070543 22:35393086-35393108 AAGCATGGTGATGATGGGGCAGG - Intronic
1183487483 22:38097332-38097354 AAGGCTGCTGATGATGGGGCAGG - Intronic
1184215689 22:43065773-43065795 GGGGATGCTGATAAGGGGGGAGG + Intronic
1185013485 22:48330186-48330208 TAGGATGCTGGTAATGGTGGAGG - Intergenic
949428853 3:3950511-3950533 CAGGATATTGATAATGGGGAAGG + Intronic
951066214 3:18268735-18268757 TAGGATGTTGAAAGTGGGGGTGG + Intronic
951829691 3:26912250-26912272 CAGGATGCTGATAATGGGGGAGG + Intergenic
953569792 3:44062397-44062419 TAGGATGTTGATAATATCGCAGG + Intergenic
954348101 3:50017982-50018004 CAGGATGCTGATAGTTGGGGAGG - Intronic
954555240 3:51512508-51512530 TAGGATGTTGATAATGGAGGAGG + Intergenic
955279270 3:57578772-57578794 TAGAATTCTAATAATGGGCCAGG - Intronic
955572026 3:60318086-60318108 TAAGATGCCCAGAATGGGGCGGG - Intronic
955677975 3:61469331-61469353 CAGGATGTTGATAATAGGGGAGG - Intergenic
957828332 3:85480568-85480590 TATAATGCTTATAATGGGACAGG - Intronic
958889974 3:99772514-99772536 CAGGATGTTCATAATGGGGGAGG + Intronic
959933512 3:112007184-112007206 GGGGATGTTGATAATGGGGAAGG - Intronic
961810755 3:129520254-129520276 CAGGATGCTGGTCATGGGCCAGG - Exonic
963824951 3:149943456-149943478 CAGGATGTTGATAATAGGGGAGG - Intronic
964413757 3:156426407-156426429 AAGGATGCTGATAACGAGGGAGG - Intronic
965884768 3:173431653-173431675 TAGGATGCTGATAATAGAAGAGG - Intronic
966734293 3:183176672-183176694 CAGGATGCTGACAGTGGGGGTGG - Intergenic
968023284 3:195415174-195415196 CAGGATGTTGATAGTGGGGAAGG + Intronic
970226579 4:13864575-13864597 TAGGATATTGATAATGAGGGAGG - Intergenic
970923994 4:21428909-21428931 TAAGATATTGATAATGGGGTAGG - Intronic
971189218 4:24411451-24411473 TGGGATGTTGATAGTAGGGCAGG - Intergenic
971190060 4:24419433-24419455 TAGGATGCTGCTAAGGGGAAGGG - Intergenic
971212909 4:24637169-24637191 AGGGATGCTGGTAATGGGGGAGG - Intergenic
971991728 4:33906758-33906780 GAGGATGTTGATAATGAGGGAGG + Intergenic
971992682 4:33920363-33920385 GGGGATGTTGATAATGGGGGAGG - Intergenic
973289172 4:48453404-48453426 GGGGATGTTGATAATGGGGGAGG + Intergenic
973565687 4:52184845-52184867 TAGGATGGTGAGGATGGGACTGG - Intergenic
973930115 4:55783622-55783644 GAGGATGCTGATGATGGGGTAGG - Intergenic
974394026 4:61311950-61311972 TGGGATGTTAATAATGGGGGAGG + Intronic
974509581 4:62821262-62821284 GAGGATGTTGATAATAGGGAAGG - Intergenic
975124500 4:70766660-70766682 TGGGATGTTGATAATGAGGGAGG - Intronic
976409737 4:84699730-84699752 TAGGATGACCATAATGGGGTGGG - Intronic
976688974 4:87847504-87847526 CAGGAAGCTGATGATGGAGCTGG - Intergenic
977100215 4:92802225-92802247 TATGATGTTGATAATGGAGAAGG - Intronic
977374282 4:96181453-96181475 TAGAATGCTGTTCATGGGGAGGG - Intergenic
977822192 4:101486049-101486071 CAGGATGTTGATAATGGAGGAGG - Intronic
978129552 4:105178629-105178651 TGGGATGTTGATAATGGGGAAGG + Intronic
978135412 4:105251967-105251989 AAGGATGTTGATAATGAGGGAGG - Intronic
978243668 4:106547414-106547436 TGGGATGTTGATAATGGGGGAGG + Intergenic
978373941 4:108055940-108055962 TAGGAAGCTGATAGTTGGGGTGG - Intronic
979035926 4:115717423-115717445 TGGGATGGTGATAATGGGTGAGG - Intergenic
981655759 4:147110906-147110928 TAGCATGCAAATGATGGGGCTGG + Intergenic
982033855 4:151326248-151326270 GGGGATGTTGATAATGGGGGAGG + Intergenic
982429250 4:155303707-155303729 GGGGATGCTGATAACGGGGGAGG + Intergenic
982491243 4:156032129-156032151 GAGGATGTTGATAATGGAGGAGG - Intergenic
982993403 4:162309206-162309228 TAGGATAGTGATCATGGGGTTGG + Intergenic
983376032 4:166929066-166929088 GAGTATGTTGATAATGGGGAGGG + Intronic
984313617 4:178097368-178097390 GGGGATGTTGATAATGGGGAAGG + Intergenic
984382573 4:179014592-179014614 TGGGATGCTGTCAATGGGGGAGG - Intergenic
985294892 4:188426078-188426100 TATGATGTTGATAATGGTGGTGG - Intergenic
1202770857 4_GL000008v2_random:205617-205639 TGGGATGCAGAGAGTGGGGCTGG - Intergenic
985700095 5:1365986-1366008 TAGGGGGCGGATAAGGGGGCAGG + Intergenic
985857281 5:2439510-2439532 TAGGATGATGATTATGGTGATGG - Intergenic
986021824 5:3811819-3811841 GGGGATGCTCATAATGGGGGAGG + Intergenic
986344831 5:6824609-6824631 CAGGGTGCTGATAGTGGGGGAGG + Intergenic
986538521 5:8817724-8817746 TAAGATGTTGATAGTGGGGGAGG - Intergenic
987668302 5:20974580-20974602 AAGCATGATGTTAATGGGGCAGG - Intergenic
988203354 5:28098843-28098865 TATGATGCTGACATTTGGGCAGG - Intergenic
989711870 5:44407964-44407986 CAGGATGTTGATAGTGGGGGCGG + Intergenic
989809003 5:45649350-45649372 GGGGATGTTGATAATGGGGAGGG - Intronic
989822526 5:45811305-45811327 TAGGATGTTGGTAATGGGAAAGG + Intergenic
990255878 5:53968584-53968606 TAGGATGCTGCTAATTGAGTAGG - Intronic
992382344 5:76250615-76250637 TAGGCTGCTGTCAGTGGGGCAGG - Intronic
992483232 5:77171735-77171757 TAGGCAGGTGGTAATGGGGCAGG + Intergenic
992852776 5:80827993-80828015 GGGGATGCTGAAAATGGGGGAGG - Intronic
994439663 5:99786308-99786330 TAGGATGCTGATAGTTGGATAGG - Intergenic
994658333 5:102621872-102621894 CAGGATGCTGTTACTGGGGAAGG + Intergenic
995239791 5:109872911-109872933 TAGGACTCTGATAATGTGGCTGG - Intergenic
995577000 5:113547553-113547575 GGGGATGTTGATAATGGGGGAGG + Intronic
995930529 5:117437000-117437022 TAGGATGCAGAGGATGGGGTAGG + Intergenic
996002434 5:118380827-118380849 AGGGATGTTGATAATGGGGTGGG - Intergenic
996580063 5:125021824-125021846 GAGGATATTGATAATGGGGGAGG + Intergenic
997342421 5:133155217-133155239 TTAGATACTGATAATGTGGCTGG - Intergenic
998311119 5:141133355-141133377 GAGGATGTTGATAATGGGTGAGG + Intronic
999318440 5:150599022-150599044 CAGGAAGCTGATTCTGGGGCCGG + Intergenic
999740843 5:154550238-154550260 TAGGATGCTGGTAGTGGGGGAGG - Intergenic
1000225571 5:159257907-159257929 TGGGATGCTGGTAGTGTGGCGGG - Intergenic
1001143771 5:169166645-169166667 TAGGAAGGTGATATTGGGGATGG - Intronic
1001460579 5:171909540-171909562 TGCAATGCTGATAGTGGGGCAGG + Intronic
1001636803 5:173216183-173216205 TGGGGTGCTGATAGTGGGGCGGG - Intergenic
1002319816 5:178368377-178368399 GGGGATGCTGATCATGGGGGAGG - Intronic
1003358378 6:5397505-5397527 GAGGATGCTGATAGTGGAGGAGG + Intronic
1004059557 6:12179270-12179292 GAGGAAGGTGATAATGGAGCAGG + Intergenic
1004167554 6:13270314-13270336 CAGGTTGCTGACCATGGGGCTGG - Intronic
1004982587 6:21042636-21042658 TAGGATAGTGACAGTGGGGCAGG - Intronic
1005712521 6:28515641-28515663 TAGGAAGGTGAGCATGGGGCAGG - Exonic
1005833276 6:29687956-29687978 TAAGATGTTAACAATGGGGCTGG - Intergenic
1006750604 6:36374425-36374447 TAAGGTGCTGATAGTAGGGCAGG + Intronic
1006825403 6:36931016-36931038 AGGGATGCTGATAGTGGGGGAGG - Intergenic
1009532066 6:64830344-64830366 AGTGATGCTGATAATGGGGAGGG + Intronic
1010163687 6:72890205-72890227 TAGTATGCTGATTATGGTGATGG - Intronic
1010837311 6:80605529-80605551 TTTGAGGCTGATAATGGGGCTGG + Intergenic
1012320906 6:97844390-97844412 AGGGATGTTGATAATGGGGAAGG - Intergenic
1013289091 6:108705596-108705618 CAGGATGGTGGCAATGGGGCTGG - Intergenic
1013844618 6:114434648-114434670 TAGAAAGCTGAAACTGGGGCTGG - Intergenic
1014333798 6:120105669-120105691 GAGGATGTTGATAATGGGGGAGG - Intergenic
1014701042 6:124688410-124688432 GAGGATGCTGATAATGGGGGAGG - Intronic
1014716442 6:124869826-124869848 GAGGATGTTGATAGTGGGGAAGG + Intergenic
1014978377 6:127917419-127917441 TAGGATGCTGAAAACAGGACAGG + Intronic
1016271789 6:142298588-142298610 TAGGATAATGATAATAGGTCGGG + Intergenic
1016322693 6:142864238-142864260 TAGGCTGCTGGTGATGGGACTGG - Intronic
1016370793 6:143371932-143371954 TAGAAAGGTGAAAATGGGGCCGG - Intergenic
1018627534 6:165793864-165793886 TTAGATGCTTATAATGGGCCAGG + Intronic
1019438839 7:1036562-1036584 CAGGGTGTTGATAATGGGGGAGG + Intronic
1020602338 7:10291774-10291796 TAGGAGGCAGATAATATGGCTGG + Intergenic
1020874980 7:13681818-13681840 GGGGATGTTGATAATGGGGGAGG + Intergenic
1021341040 7:19463067-19463089 GGGGATGTTGATAATGGGGGAGG + Intergenic
1022987501 7:35672153-35672175 TGGGATGCTGATAGTGGGGCAGG + Intronic
1023133503 7:37027360-37027382 TAGGTTCCTGTAAATGGGGCAGG - Intronic
1024035958 7:45507627-45507649 GGGGATGTTGATAATGGGGGAGG - Intergenic
1025964865 7:66259696-66259718 TAGGATACTGATATTGGGGGAGG - Intronic
1028101209 7:86823303-86823325 TGGGATGCTGAGAATGGGGATGG - Intronic
1028770188 7:94610418-94610440 GGGGATGTTGATAATGGGGGAGG + Intronic
1029000637 7:97151071-97151093 GGGGATGCTGATAATGGGAGAGG - Intronic
1029030869 7:97465219-97465241 CTGAATGCTGACAATGGGGCAGG - Intergenic
1029920930 7:104262539-104262561 TGGGATGTTGATAGTGGGGGAGG - Intergenic
1030631015 7:111895894-111895916 TAAGTTGCAGATAAGGGGGCAGG - Intronic
1031430239 7:121659038-121659060 GAGGATGTTGATAATTGGGATGG - Intergenic
1031542396 7:123010208-123010230 CAGGATGTTGATAATGGGGAAGG + Intergenic
1032178446 7:129653379-129653401 CAGGATGTTGATAGTGGGGGAGG - Intronic
1032435025 7:131893617-131893639 TAGGATATAGAAAATGGGGCAGG - Intergenic
1033049034 7:137987577-137987599 CAGGATGCTGATGGTGGGACAGG + Intronic
1033985027 7:147214759-147214781 AAGGATGTTGATAATGGAGGAGG - Intronic
1034669733 7:152848948-152848970 CATGATGCTGATCCTGGGGCAGG + Intronic
1035525823 8:312411-312433 GGGGATGTTGATAATGGGGGAGG - Intergenic
1036064819 8:5368096-5368118 GAAGATGTTGATAATGGGGTAGG + Intergenic
1036703223 8:11027888-11027910 TGGGATGTTGATAATGGGGGAGG - Intronic
1037120332 8:15277480-15277502 GAGGATGTTGATAATAGGGAAGG + Intergenic
1038473879 8:27848224-27848246 GGGGATGTTGATAATGGGGAAGG - Intergenic
1038477955 8:27881801-27881823 GGGGATGTTGATAATGGGGGAGG - Intronic
1039078465 8:33713392-33713414 AAGGATGGTGATAATAGGGGAGG - Intergenic
1039333363 8:36563230-36563252 AGGGATGTTGATAATGGGGGAGG + Intergenic
1040004847 8:42611227-42611249 TGGGATGTTGATAATGGGGAAGG + Intergenic
1040418708 8:47219424-47219446 TGGGATGGTGATGATGGTGCTGG + Intergenic
1042127356 8:65551876-65551898 GAGGATGTTGATAGTGGGGGAGG - Intergenic
1042427800 8:68669232-68669254 GGGGATGTTGATAATGGGGGAGG + Intronic
1042560193 8:70068187-70068209 TCTGCTGCTGAAAATGGGGCGGG - Intronic
1043038801 8:75232549-75232571 GAAGATGTTGATAATGGGGGGGG + Intergenic
1043828883 8:84963743-84963765 AAGGATGTTGATAATGGGACAGG + Intergenic
1043830880 8:84987422-84987444 GAGGATGTTGATAATGGGGGAGG - Intergenic
1043987688 8:86713950-86713972 GGGGATGTTGATAATGGGGAAGG - Intronic
1044325302 8:90851708-90851730 GGGGATGTTAATAATGGGGCAGG - Intronic
1044664713 8:94623311-94623333 TAGGATGCTGAAAAAGAGGCTGG + Intergenic
1044848107 8:96401460-96401482 GAGGATGTTGACAATGGGGGAGG + Intergenic
1047640650 8:126817978-126818000 GGGGATGTTGATAATGGGGGAGG - Intergenic
1048318644 8:133381166-133381188 GGGGATGTTGATAATGGGGGAGG + Intergenic
1048385914 8:133912408-133912430 TTGCTTGCTGAAAATGGGGCAGG + Intergenic
1048414350 8:134209741-134209763 TGGGATGTTGATAGTGGGGCAGG - Intergenic
1048961426 8:139582704-139582726 TAGTATCCTGAGAATGGGGAGGG - Intergenic
1050038105 9:1459345-1459367 TGGGCTGCTTACAATGGGGCTGG + Intergenic
1050111386 9:2220166-2220188 GAAGATGTTGATAATGAGGCAGG - Intergenic
1050777353 9:9282286-9282308 GGGGATGTTGATAATGGGGCAGG + Intronic
1051442178 9:17097087-17097109 TGGGATGTTGATAGTGGGGGAGG - Intergenic
1052139486 9:24961409-24961431 GAGGATGTTGATAACGGGGGAGG + Intergenic
1052310329 9:27060660-27060682 TAAAAAGCTGAAAATGGGGCCGG + Intronic
1053040846 9:34870143-34870165 CAGGATGTTGATAGTGGGGAAGG - Intergenic
1053410166 9:37911070-37911092 GAGGATGCTGAGAAAGGGGATGG + Intronic
1054355182 9:64054070-64054092 TGGGATGCAGAGAGTGGGGCTGG + Intergenic
1055092244 9:72374784-72374806 TGGGATGTTGATAATGGGGAAGG + Intergenic
1055781512 9:79826278-79826300 GAGGATGCTCATAATGGGGGAGG + Intergenic
1055931997 9:81568628-81568650 TGGGATGTTGATAGTGGGGAAGG - Intergenic
1056084345 9:83130347-83130369 TGGGATGTTGATAATTGGGGAGG - Intergenic
1056096927 9:83264520-83264542 TGGGATGTTGATGATGGGGGAGG + Intronic
1056701467 9:88914634-88914656 TGGGATGTTGATAGTGGGGGAGG + Intergenic
1056717024 9:89040081-89040103 GATGATGCTGATGATGGTGCTGG - Intronic
1057309981 9:93936269-93936291 GGGGATGCTGATTATGGGGAAGG + Intergenic
1057858687 9:98623009-98623031 GGGGATGTTGATAATGGGGGAGG + Intronic
1058863801 9:109143377-109143399 CAGGATGTTGATAATGGGGGAGG + Intronic
1060866138 9:126999261-126999283 GAGGACGCTGATAGTGGGGGAGG - Intronic
1061038838 9:128128194-128128216 TAGGAAGCGGACAATGAGGCGGG - Exonic
1061076941 9:128347429-128347451 TAGGATGCTGAAAGGGGGCCTGG + Intronic
1203743510 Un_GL000218v1:23175-23197 TGGGATGCAGAGAGTGGGGCTGG + Intergenic
1203703792 Un_KI270742v1:18136-18158 TGGGATGCAGAGAGTGGGGCTGG + Intergenic
1203566602 Un_KI270744v1:96344-96366 TGGGATGCAGAGAGTGGGGCTGG - Intergenic
1186248233 X:7637663-7637685 GAGGATGTTAATAATGGGGGAGG - Intergenic
1186593906 X:10960254-10960276 TAGCATGTTGATGTTGGGGCAGG - Intergenic
1186695617 X:12028413-12028435 TGAGATGCTGATAATGGCGAAGG - Intergenic
1188269050 X:28116092-28116114 GGGGATGTTGATAATGGGGGAGG - Intergenic
1188502194 X:30839650-30839672 TAGGATGCTGATAATGGGGCAGG + Intronic
1189941778 X:46131158-46131180 TAGGATGCTGAGATTGAGGAAGG + Intergenic
1192187645 X:68962863-68962885 GGGGATGTTGATAATGGGGGAGG - Intergenic
1193347308 X:80419109-80419131 TATGATGCTTATAATGTGTCAGG - Intronic
1195587481 X:106581812-106581834 GAGGATGTTGATAATGGGTGAGG + Intergenic
1195943462 X:110184117-110184139 CAGGATGTTGATAGTGGGGTAGG + Intergenic
1198069431 X:133133482-133133504 TAGGATGCTGAGACTTCGGCTGG + Intergenic
1198255587 X:134921649-134921671 GAGGCTGTTGATAATGGGGGAGG + Intergenic
1198502376 X:137264252-137264274 GAGGATGTTGATAATGGGGGAGG + Intergenic
1199088090 X:143652623-143652645 GAGGATGTTGATAAAGGGGAAGG - Intergenic
1199498839 X:148486676-148486698 GAGGATGTTGATAATGGGGAAGG + Intergenic
1199686218 X:150267894-150267916 TAGCAAGCTGATACTGAGGCAGG + Intergenic
1199702496 X:150392885-150392907 CAGGATGCAGGTAATGGGGGAGG - Intronic
1200342822 X:155417035-155417057 TAAGATGGTGATAACTGGGCTGG - Intergenic
1202116171 Y:21470483-21470505 GAGGATACTGGGAATGGGGCAGG + Intergenic