ID: 1188505166

View in Genome Browser
Species Human (GRCh38)
Location X:30874610-30874632
Sequence GTGAGTAGCAAGGATGTTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 222}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188505163_1188505166 14 Left 1188505163 X:30874573-30874595 CCTAACGTAAAATAATTGTTCAA 0: 1
1: 0
2: 1
3: 43
4: 754
Right 1188505166 X:30874610-30874632 GTGAGTAGCAAGGATGTTGCTGG 0: 1
1: 0
2: 1
3: 27
4: 222

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188505166 Original CRISPR GTGAGTAGCAAGGATGTTGC TGG Intronic
900671783 1:3858845-3858867 GTGAGTGGCAAGGACTTTGGAGG + Intronic
901228922 1:7631184-7631206 GGGAGGACCAAGGATGTGGCTGG - Intronic
902551707 1:17223379-17223401 GTGAGGAGCAAGGAGGGTGGGGG - Intronic
903040740 1:20528259-20528281 GTAAGCAGCAAGGATTTTGGGGG + Intergenic
903229780 1:21914749-21914771 GGGAGGAGAAAGGATGGTGCTGG + Intronic
906810623 1:48823600-48823622 GTGAGCAGCAAGGAAGGGGCAGG - Intronic
909977780 1:82065472-82065494 TTGAGTAGCAAAGATGATGATGG + Intergenic
914825985 1:151138277-151138299 GTGAGAAGAAAGCATGTGGCTGG - Intronic
915955242 1:160215394-160215416 GTGAGTGACCAGGATTTTGCAGG + Intergenic
916208184 1:162335597-162335619 GTGTGTTGCAGAGATGTTGCTGG + Intronic
917213729 1:172657034-172657056 GGGAGTAGCGAGGATGGGGCAGG + Intergenic
917519963 1:175740100-175740122 GTAAGTAGCAAAGATGTGGGAGG - Intronic
917796609 1:178537561-178537583 CTGAGTGGCAAGGAAGTTGCAGG - Intronic
918718827 1:187826144-187826166 CTGATTAGCCAGGATGTTGCAGG + Intergenic
919281562 1:195496071-195496093 TTGGTTAGCCAGGATGTTGCTGG + Intergenic
923914383 1:238485804-238485826 GTGCGTACCAAAGATGTCGCAGG + Intergenic
1064040492 10:11958527-11958549 GTGATAAGGAATGATGTTGCAGG - Intronic
1064152806 10:12879025-12879047 GTGAGGGGCAAGAATGCTGCTGG - Intergenic
1064535209 10:16351102-16351124 GCAATTAGCAAGGATTTTGCAGG - Intergenic
1065042180 10:21708452-21708474 CTGAGGAGCAAGGAAGTTGAAGG + Intronic
1070950594 10:80428053-80428075 GGAAGTGGCAAGGAGGTTGCGGG + Intronic
1072871694 10:99126615-99126637 CTGGTTAGCCAGGATGTTGCAGG - Intronic
1074783755 10:116820929-116820951 GAGAGGAGTAAGGATGATGCTGG - Intergenic
1075062911 10:119269306-119269328 GTGAGAAGCAAGAATGGTACAGG + Intronic
1075734915 10:124658691-124658713 GTGAAGTGCAGGGATGTTGCTGG - Intronic
1077259300 11:1607298-1607320 GGGAGGAGCCAGGAGGTTGCGGG + Intergenic
1077964245 11:7110815-7110837 CTGATTAGCCAGGATGTTGCAGG + Intergenic
1078132412 11:8623825-8623847 CTGAGTAGTAAGGATTTTCCTGG - Intronic
1078687806 11:13549365-13549387 CTGGTTAGCCAGGATGTTGCAGG + Intergenic
1078826088 11:14931472-14931494 CTTAGTAGCAAGGATGATTCAGG + Intronic
1079348053 11:19670173-19670195 GTGAGTGGCAAGGAGTATGCAGG - Intronic
1079464129 11:20712992-20713014 CTGGTTAGCTAGGATGTTGCAGG + Intronic
1084692626 11:70735899-70735921 GTGAGCAGCTAGGATGGTGATGG - Intronic
1084701131 11:70786857-70786879 GTGACTAGCAATGATGCTGGTGG - Intronic
1086315647 11:85589192-85589214 CTGGTTAGCCAGGATGTTGCAGG + Intronic
1087898923 11:103618617-103618639 GTGAGTTACAAAGATTTTGCAGG + Intergenic
1088413700 11:109566564-109566586 CTGGGTAGCCAGGATGTTACAGG + Intergenic
1089429945 11:118414726-118414748 GTGAGAGGCAAGGAAGTTGAAGG - Intronic
1089460159 11:118648340-118648362 GTGGGTTGTAAGGATGTGGCAGG + Intronic
1089754981 11:120679927-120679949 GTGAGAGGCAAGGATGTTCTAGG - Intronic
1090682669 11:129077941-129077963 GTGGTTAGCCAGGATGTTACAGG - Intronic
1091345490 11:134850411-134850433 CTTAGTAACAAGCATGTTGCAGG + Intergenic
1092602590 12:10082820-10082842 CTGGTTAGCCAGGATGTTGCAGG - Intronic
1096810668 12:54167690-54167712 GTGAGGAGGAAGGATGTAGGAGG - Intronic
1098227970 12:68344360-68344382 TTGAGTACCAAGTATGCTGCAGG - Intergenic
1098654780 12:73013985-73014007 CTGATTAGCCAGGATGTTGCAGG + Intergenic
1099234173 12:80062521-80062543 GCAGGTAGAAAGGATGTTGCAGG - Intergenic
1099534366 12:83826851-83826873 GTTATTAGCCAGGATGATGCAGG + Intergenic
1100371712 12:93974811-93974833 GGGAGTAGCCAGGATCTTGCAGG + Intergenic
1102504420 12:113374646-113374668 GGGAGTGGCAAGGTTGATGCTGG - Intronic
1104454410 12:128898918-128898940 GAGAGAAGCAAGGAACTTGCTGG - Intronic
1104755110 12:131264388-131264410 GTGAGTAGCCAGGAGTGTGCAGG + Intergenic
1107361212 13:39619275-39619297 CTGGTTAGCCAGGATGTTGCAGG - Intergenic
1109058266 13:57580854-57580876 CTGACTAGCCAGGATGTTGCAGG + Intergenic
1109681620 13:65758669-65758691 TTGGGCAGCAAGCATGTTGCAGG - Intergenic
1110632505 13:77725673-77725695 GTGAGGAGCCAGAATGTTTCTGG + Intronic
1111526512 13:89477948-89477970 GGTGGTAGCAAGGATGTGGCTGG + Intergenic
1112684459 13:101807726-101807748 GTGAGTGGAAAGGAGGTGGCTGG + Intronic
1112987093 13:105464596-105464618 GTTCGTAGCAACTATGTTGCTGG - Intergenic
1113312922 13:109149745-109149767 GTGGGTAGAAAGGATTTTCCAGG - Intronic
1113643021 13:111971797-111971819 GTGAGTGGCAGGGATGTTCCAGG + Intergenic
1114454468 14:22846145-22846167 GAGAGAAGCAAGGAGGCTGCGGG - Exonic
1114694278 14:24612244-24612266 CTGTTTAGCCAGGATGTTGCAGG + Intergenic
1115699670 14:35939077-35939099 GTGTATATGAAGGATGTTGCTGG + Intergenic
1123839249 15:24229942-24229964 GTGAGAAGGAGAGATGTTGCGGG - Intergenic
1126464712 15:48951234-48951256 GGGGGTAGGAAGGATGTGGCTGG - Intronic
1127574026 15:60272820-60272842 GGTGGTAGCCAGGATGTTGCAGG + Intergenic
1129899105 15:79131883-79131905 GTGAGTTGCAAGCAGGTTCCTGG - Intergenic
1130520894 15:84659833-84659855 GTGAGAAGCAAGGAGATTGGGGG - Intergenic
1132312574 15:100867840-100867862 GTTAGCAGAAAGGAAGTTGCTGG + Intergenic
1133435123 16:5772611-5772633 GTGAGTTGAAAGGATGGTGGCGG + Intergenic
1133522355 16:6571301-6571323 GGGAGGAGCAAGGAAGCTGCAGG + Intronic
1134050098 16:11131420-11131442 GTGAGGAGCAAGGCTGTTCTGGG - Intronic
1134413086 16:14019676-14019698 GTGAGTAGTAAGCATATTTCTGG + Intergenic
1136066559 16:27762771-27762793 GTGACTTGCCAGGATGTTGGGGG - Intronic
1138086277 16:54136478-54136500 GAGATTAGCCAGGATGCTGCTGG - Intergenic
1140249323 16:73281431-73281453 GAGAGTAGCATGGTGGTTGCAGG + Intergenic
1140739795 16:77930918-77930940 TTGAGTAGCTAGGATCTTCCAGG + Intronic
1143956545 17:10674549-10674571 CTGAGTAGCAAGGCTGTAGAGGG + Exonic
1144350922 17:14395496-14395518 GATAGTAGTAATGATGTTGCAGG + Intergenic
1148088907 17:45010830-45010852 GAGAGGAAGAAGGATGTTGCAGG + Intergenic
1148472987 17:47907076-47907098 TTGAGCAGCAAGGAGGTCGCTGG + Intronic
1148871848 17:50663070-50663092 GTGAGTGGCAAGGAGTTTGTGGG + Intronic
1149644640 17:58231197-58231219 TTGAGGAGCAAGGATGTAGTGGG + Intronic
1151374968 17:73681947-73681969 GTGAGAAGAAGGGATGTAGCTGG + Intergenic
1151599054 17:75095088-75095110 GGGAGTAGCCAGGAGGTAGCCGG - Intronic
1153234322 18:2971224-2971246 AAGAGGAGCAAGGATGTTTCAGG + Intronic
1153699393 18:7677662-7677684 GTGAGTAGGAGGGAAGTTGCAGG - Intronic
1153951805 18:10064138-10064160 GTGAGGAGGAAGGGTGATGCTGG - Intergenic
1156591237 18:38490967-38490989 GTCAGTGGCAAGGATGGTGCTGG - Intergenic
1157880288 18:51314905-51314927 GTGAGTAGCGAGGGTCTTGGGGG + Intergenic
1158973505 18:62689818-62689840 GTGTGTAGCAGTGATGTTGTGGG + Intergenic
1160596092 18:79975472-79975494 GTGAGGGGCAAGGAGGCTGCAGG - Intronic
1162099073 19:8328832-8328854 GAGAGCAGCCAGGAGGTTGCAGG + Intronic
1162587376 19:11568614-11568636 CTGAGAAGCAAGGATGATTCTGG + Intronic
1163758226 19:19119660-19119682 TTGAGTGGCAAGGGTGATGCTGG - Exonic
1164432224 19:28198445-28198467 GAGAGTGGGAAGGATTTTGCAGG - Intergenic
1165417709 19:35704871-35704893 CTGAGTAGGAAGGGTGTTGTGGG + Intronic
1166631150 19:44409182-44409204 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632027 19:44415309-44415331 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632455 19:44418994-44419016 GAGGGTTGCAAGGATGCTGCTGG + Intronic
1166637024 19:44459399-44459421 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
925771327 2:7285449-7285471 CTGGGTAGAAAGGATGTTGATGG + Intergenic
926910534 2:17848692-17848714 GTGAGTACCACAGATTTTGCAGG - Intergenic
927813632 2:26194889-26194911 GGGAGTATCTAGGATGTGGCAGG - Intronic
928707511 2:33966546-33966568 GTTAGAAGCCAGGAAGTTGCAGG - Intergenic
932925526 2:75969176-75969198 CTGATTAGCCAGGATGTTGCAGG - Intergenic
934111362 2:88746781-88746803 CTGGTTAGCCAGGATGTTGCAGG + Intronic
935509742 2:103956503-103956525 TTGAGTGGCAAGGAAGTTACAGG - Intergenic
936140885 2:109939064-109939086 CTGTTTAGCCAGGATGTTGCAGG - Intergenic
936177576 2:110237009-110237031 CTGTTTAGCCAGGATGTTGCAGG - Intergenic
936203808 2:110432422-110432444 CTGTTTAGCCAGGATGTTGCAGG + Intronic
936710423 2:115124361-115124383 GTGAATAGCAAAGATATGGCTGG - Intronic
938540996 2:132283388-132283410 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
938541821 2:132289293-132289315 GTGTGTTGCAAGGATGCTGCTGG - Intergenic
938900215 2:135793089-135793111 CTGGTTAGCCAGGATGTTGCAGG - Intronic
939919188 2:148087343-148087365 CTGGTTAGCCAGGATGTTGCAGG - Intronic
940387464 2:153090469-153090491 CTGGTTAGCCAGGATGTTGCAGG + Intergenic
940630369 2:156230338-156230360 CTGGTTAGCCAGGATGTTGCAGG - Intergenic
941099481 2:161280937-161280959 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
942852374 2:180504111-180504133 GTGGGTACCAAAAATGTTGCTGG + Intergenic
943226619 2:185186473-185186495 CTGAGAAGCAAGGATGGTACTGG - Intergenic
943479107 2:188395985-188396007 ATGATTAGCCAGGGTGTTGCAGG + Intronic
944263709 2:197701440-197701462 CTGGTTAGCCAGGATGTTGCAGG + Intronic
945338225 2:208618109-208618131 CTGGTTAGCCAGGATGTTGCAGG + Intronic
1171185222 20:23120085-23120107 CTCAGGAGCAAGGATGTTGCAGG - Intergenic
1171459568 20:25291124-25291146 GTGAGGAGCAAGGATGTGGGCGG - Intronic
1171870694 20:30522174-30522196 GTGGGTTGCAAGGATGCTGCTGG - Intergenic
1173096118 20:40030110-40030132 TTGAGTAGCATGGTTTTTGCAGG - Intergenic
1174797160 20:53531766-53531788 TTGAGAAGCAAGGATCTTGGCGG - Intergenic
1175308153 20:57992172-57992194 TTGAGTAGCAAGGTTGTGGAGGG - Intergenic
1176658645 21:9613232-9613254 CTGGTTAGCCAGGATGTTGCAGG + Intergenic
1177657311 21:24035336-24035358 CTGTTTAGCCAGGATGTTGCAGG - Intergenic
1177750268 21:25273178-25273200 GAGAGTAGGAAGGAGGTTACAGG + Intergenic
1178094079 21:29195466-29195488 GTGAGTTACAAGGAGATTGCTGG - Intronic
1178659906 21:34498723-34498745 CTGGTTAGCCAGGATGTTGCAGG + Intergenic
1178758407 21:35376019-35376041 GAGAGTAGAAAGGTGGTTGCCGG - Intronic
1179649284 21:42796355-42796377 GTGCGTTGCAAGGATGTAACAGG + Intergenic
1180896357 22:19336507-19336529 CTGGTTAGAAAGGATGTTGCAGG - Intronic
950885166 3:16356495-16356517 GTGAGGAGCAAGGCTGTTGGGGG - Intronic
951334378 3:21404019-21404041 CTGAGTAGCTAGGATTTTACAGG + Intergenic
952183178 3:30941263-30941285 CTGGTTAGCCAGGATGTTGCAGG + Intergenic
952984832 3:38770081-38770103 CTGGTTAGCCAGGATGTTGCAGG + Intronic
953195730 3:40731544-40731566 CTGGTTAGCCAGGATGTTGCAGG + Intergenic
953382263 3:42480741-42480763 CTGGTTAGCCAGGATGTTGCAGG - Intergenic
955068683 3:55554468-55554490 GTGAGTAGCCAGGCTGAAGCCGG + Intronic
957392747 3:79598880-79598902 CTGGTTAGCTAGGATGTTGCAGG - Intronic
959904291 3:111693481-111693503 GTGACTTGCAAGGATGAGGCAGG - Intronic
961722662 3:128906999-128907021 GTGAGTTGCAGGGATGAGGCCGG + Intronic
962862134 3:139414239-139414261 CTGGTTAGCCAGGATGTTGCAGG + Intergenic
963023550 3:140896876-140896898 CTGGTTAGCCAGGATGTTGCAGG + Intergenic
963171180 3:142252554-142252576 CTGGTTAGCCAGGATGTTGCAGG - Intergenic
963609821 3:147453117-147453139 GTGAGTAGCTAGCATGTGTCAGG + Intronic
964423891 3:156532259-156532281 GTGGGTTGAAAGGATGTTCCTGG + Intronic
964728447 3:159839684-159839706 GTGGGTAGGAAGGATGATGCCGG + Intronic
965015587 3:163153162-163153184 CTGCTTAGCCAGGATGTTGCAGG + Intergenic
965613244 3:170566565-170566587 GTGAGTGGGATGGATGTGGCAGG - Intronic
967363284 3:188656512-188656534 GTGAGCAGAAAGGTTGTTGCTGG - Intronic
972735081 4:41832627-41832649 AGAAGTAGCAAGTATGTTGCAGG + Intergenic
974070917 4:57122764-57122786 GTGAGTATCAGGGAGGTTGTAGG + Intergenic
975521438 4:75305844-75305866 GAGAGAAGGAAGGATGCTGCAGG + Intergenic
975951066 4:79771958-79771980 CTGATTAGCCAGGATGTTACCGG - Intergenic
977762811 4:100759513-100759535 CTGATTAGCCGGGATGTTGCAGG - Intronic
977787254 4:101051035-101051057 GAGAGCAGCCAGGATGCTGCTGG + Intronic
979024714 4:115554506-115554528 ATGAGGAGCCAGGATGTTGAAGG - Intergenic
979584796 4:122403513-122403535 CTGCTTAGCCAGGATGTTGCAGG + Intronic
982625641 4:157762576-157762598 GTGAGTAAAAAGGATGGTGGAGG + Intergenic
983776175 4:171609966-171609988 CTGGCTAGCCAGGATGTTGCAGG - Intergenic
983807904 4:172018039-172018061 CTGATTAGCCAGGATGTTGCAGG + Intronic
983950702 4:173637616-173637638 GTGAGTAGAGAAGATGTTGCTGG - Intergenic
987434874 5:17882918-17882940 CTGGTTAGCCAGGATGTTGCAGG + Intergenic
988714593 5:33812316-33812338 GTGAGTAGGACAGATGTTGATGG + Intronic
989525969 5:42454319-42454341 CTGGTTAGCCAGGATGTTGCAGG + Intronic
990780701 5:59358767-59358789 AAGAGTAGAAGGGATGTTGCTGG + Intronic
991121465 5:63019900-63019922 GTGAGTTGCAATCATTTTGCTGG + Intergenic
992901358 5:81300383-81300405 GTGAGCACCAAGGATGTACCAGG + Intergenic
993343666 5:86755853-86755875 GTGAGTAGCAGGCATAATGCAGG - Intergenic
993455951 5:88127089-88127111 GAGAGAAACTAGGATGTTGCGGG - Intergenic
994851220 5:105057305-105057327 GTGGGAGGCAAGGATGTTCCTGG + Intergenic
996317827 5:122180812-122180834 GTGAGTAGCTGGGATCTAGCAGG - Intergenic
996608965 5:125357295-125357317 CTGATAAGCCAGGATGTTGCAGG + Intergenic
997885100 5:137622849-137622871 GCAAGTAGGAAGGATGTTGACGG - Intronic
998703450 5:144731834-144731856 CTGGTTAGCCAGGATGTTGCAGG + Intergenic
1000730894 5:164832640-164832662 GTGAGCAGCAAAGATGTATCTGG + Intergenic
1001636979 5:173217451-173217473 CTAAGTAGCAAGGATGATGATGG + Intergenic
1001924315 5:175625326-175625348 GTGAGCAGCAAGGACGCTGTTGG - Intergenic
1003491093 6:6622436-6622458 CTGAGTGCCAAGGATGTAGCAGG + Intronic
1005259419 6:24042360-24042382 CTGGTTAGCTAGGATGTTGCAGG + Intergenic
1007438642 6:41838239-41838261 CTGGTTAGCCAGGATGTTGCAGG - Intronic
1008599001 6:53070910-53070932 TTGAGTAGCAAGGCTGTAGGGGG - Exonic
1008928403 6:56911384-56911406 TTGAGTAACAAGGATGTAGAAGG + Intronic
1009267149 6:61569554-61569576 CTGATTAGCCAGGATGTTGCAGG - Intergenic
1010330282 6:74615630-74615652 GTGAGTAGGAAGGATGTTCCAGG - Intergenic
1010879461 6:81150140-81150162 CTGGTTAGCCAGGATGTTGCAGG - Intergenic
1011589002 6:88952584-88952606 CTGGTTAGCCAGGATGTTGCAGG - Intronic
1013123465 6:107160689-107160711 GGGAGTAGCAAGGAAATTGTAGG + Intronic
1014420951 6:121245094-121245116 CTGGGTAGCCAGGGTGTTGCAGG - Intronic
1015258998 6:131212776-131212798 GTGAGAAGGAAGAATGTTGATGG + Intronic
1018177181 6:161187169-161187191 GTGAGTGGCAATGATGTTGGTGG + Intronic
1018851649 6:167644802-167644824 GTGATGAGGACGGATGTTGCCGG - Intergenic
1019748095 7:2711919-2711941 CTGAGTAGCAGGGATTTTACAGG - Intronic
1020332314 7:7032329-7032351 CTGGTTAGCCAGGATGTTGCGGG + Intergenic
1022289176 7:28984898-28984920 TTGTGAAGCAAGGATGTTCCTGG + Intergenic
1027728244 7:81834949-81834971 GTGAGCAGCATGGAGGTTGATGG - Intergenic
1028280818 7:88925749-88925771 GAGAGTAGAAAGGATGGTGCAGG + Intronic
1028304202 7:89241755-89241777 GTGACTAGCAATGGAGTTGCAGG - Intronic
1028930753 7:96410219-96410241 GTGAGAATCCAGGATGGTGCTGG + Intergenic
1030373293 7:108725343-108725365 TTGAGTAGGAAGGATATTCCTGG + Intergenic
1033462717 7:141562184-141562206 TTGGTTAGCCAGGATGTTGCAGG + Intronic
1034483944 7:151344886-151344908 GTGAGTAGGGAGGCTGATGCAGG + Intronic
1035044119 7:155952854-155952876 GTAGGAAGCAAGGATGTGGCTGG + Intergenic
1035136597 7:156709326-156709348 CTGGTTAGCCAGGATGTTGCAGG - Intronic
1037409653 8:18582949-18582971 CTGAGTAGCTAGGATTTTACAGG + Intronic
1040989549 8:53335442-53335464 CTGGTTAGCCAGGATGTTGCAGG + Intergenic
1041763617 8:61393922-61393944 CTGGTTAGCCAGGATGTTGCAGG + Intronic
1042466674 8:69136189-69136211 CTGGTTAGCTAGGATGTTGCAGG + Intergenic
1042608035 8:70565931-70565953 CTGGTTAGCCAGGATGTTGCAGG - Intergenic
1043108057 8:76140245-76140267 ATGAGTTGCAAGGGAGTTGCTGG + Intergenic
1045952273 8:107865554-107865576 CTGGTTAGCAAGGATGTTGCAGG + Intergenic
1046033851 8:108817256-108817278 CTGGTTAGCCAGGATGTTGCAGG + Intergenic
1046205657 8:110992751-110992773 GGGAGTAGAATGGTTGTTGCTGG + Intergenic
1046448739 8:114359336-114359358 CTGGTTAGCCAGGATGTTGCAGG - Intergenic
1047227289 8:122967669-122967691 CTGGTTAGCCAGGATGTTGCAGG + Intronic
1047937462 8:129796912-129796934 GTGGTTATCCAGGATGTTGCAGG + Intergenic
1049649387 8:143757772-143757794 TTGAGTAGCTAGGATTTTACAGG + Intergenic
1050708872 9:8436794-8436816 GTGAGTAGTAAAGATGTTTTAGG + Intronic
1050867110 9:10515763-10515785 GTGAGTAGCATGGTGGTTGCTGG - Intronic
1051613746 9:18987146-18987168 GTGATTAACAAGGATGTTACTGG + Intronic
1051881219 9:21841396-21841418 CTGGTTAGCCAGGATGTTGCAGG - Intronic
1052052101 9:23860309-23860331 GTGAGTGGGAAGGATGTCGGGGG - Intergenic
1056716585 9:89036370-89036392 AGGAAGAGCAAGGATGTTGCTGG + Intronic
1057833898 9:98428721-98428743 GGGACTAGCAGGGATTTTGCTGG + Intronic
1058940734 9:109810499-109810521 TTTAGTAGCAAGGAGGTTACTGG + Intronic
1059289787 9:113212494-113212516 GTTAGTAGCAAAGAAGTTGTTGG - Intronic
1059730630 9:117053599-117053621 GAGAAGAGCCAGGATGTTGCTGG - Intronic
1203636372 Un_KI270750v1:116811-116833 CTGGTTAGCCAGGATGTTGCAGG + Intergenic
1186998697 X:15152069-15152091 GTGAGTAGAAAGGATTTCACAGG - Intergenic
1188505166 X:30874610-30874632 GTGAGTAGCAAGGATGTTGCTGG + Intronic
1192639296 X:72847252-72847274 GTGGGTTGCAAGGCTGGTGCAGG - Exonic
1192642415 X:72873553-72873575 GTGGGTTGCAAGGCTGGTGCAGG + Exonic
1192905191 X:75544031-75544053 CTGATTAGCCAGGGTGTTGCAGG + Intergenic
1193924147 X:87464698-87464720 CTGGTTAGCCAGGATGTTGCAGG - Intergenic
1194278272 X:91913870-91913892 CTGGTTAGCCAGGATGTTGCAGG - Intronic
1194384490 X:93236417-93236439 CTGGTTAGCCAGGATGTTGCAGG - Intergenic
1194553838 X:95333188-95333210 CTGGTTAGCCAGGATGTTGCAGG - Intergenic
1194815852 X:98440256-98440278 CTGGTTAGCCAGGATGTTGCAGG - Intergenic
1196977867 X:121180032-121180054 CTGATTAGCCAGGATGTTGCAGG + Intergenic
1197472153 X:126877354-126877376 CTGGTTAGCCAGGATGTTGCAGG + Intergenic
1198770276 X:140123541-140123563 CTGGTTAGCCAGGATGTTGCAGG + Intergenic
1200595609 Y:5135946-5135968 CTGGTTAGCCAGGATGTTGCAGG - Intronic
1201981170 Y:19911718-19911740 GTGATTAGCAAGGAGGTTGGAGG - Intergenic