ID: 1188507952

View in Genome Browser
Species Human (GRCh38)
Location X:30903778-30903800
Sequence GAATTTCCCTCAGCCCTTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 112}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188507949_1188507952 10 Left 1188507949 X:30903745-30903767 CCTGCTATTTTCCAAGTGGTGGA 0: 1
1: 0
2: 0
3: 8
4: 115
Right 1188507952 X:30903778-30903800 GAATTTCCCTCAGCCCTTGTAGG 0: 1
1: 0
2: 0
3: 20
4: 112
1188507946_1188507952 27 Left 1188507946 X:30903728-30903750 CCAAAAGCAATCTAAAGCCTGCT 0: 1
1: 0
2: 2
3: 33
4: 937
Right 1188507952 X:30903778-30903800 GAATTTCCCTCAGCCCTTGTAGG 0: 1
1: 0
2: 0
3: 20
4: 112
1188507951_1188507952 -1 Left 1188507951 X:30903756-30903778 CCAAGTGGTGGACTGAAGGTGTG 0: 1
1: 0
2: 0
3: 11
4: 123
Right 1188507952 X:30903778-30903800 GAATTTCCCTCAGCCCTTGTAGG 0: 1
1: 0
2: 0
3: 20
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188507952 Original CRISPR GAATTTCCCTCAGCCCTTGT AGG Intronic
902654429 1:17857819-17857841 GAATTGTTCTCAGCCCTTTTGGG + Intergenic
907496050 1:54845495-54845517 CCAGCTCCCTCAGCCCTTGTGGG + Intergenic
912501518 1:110125597-110125619 GAATTTCCCTCTGGGCTGGTAGG + Intergenic
915751222 1:158212813-158212835 GAAGGTCCCCCAGCCCTTGCAGG + Intergenic
918327250 1:183421717-183421739 TAATTTCCCTGTGCCCCTGTAGG - Intergenic
918775285 1:188620852-188620874 GACTTGCCCCCAGTCCTTGTGGG + Intergenic
923303983 1:232671342-232671364 GATTTTCCCATAGCCCTGGTGGG - Intergenic
1063715703 10:8524441-8524463 GAATTTCCTATAGCCCTTTTGGG + Intergenic
1069075486 10:64034557-64034579 GACTTTCCCTCAGCTCTCCTAGG - Intergenic
1069729395 10:70601151-70601173 GAATTTCCCTAAGGCCTAATGGG + Intronic
1069957912 10:72062922-72062944 GAAGCTCCCTCACCCCCTGTTGG - Intronic
1070358235 10:75661287-75661309 GAAGTTCCCTCAGCCTCTGTTGG - Intronic
1078054532 11:7996664-7996686 GCATTTCCCAGAGGCCTTGTAGG + Exonic
1078290963 11:10009034-10009056 GAATGTCCCATAGCCCTTTTGGG + Intronic
1081156427 11:39698248-39698270 GAATTTAACTCACCCCATGTAGG + Intergenic
1081319349 11:41671720-41671742 GACTTTCTGTGAGCCCTTGTGGG + Intergenic
1083477226 11:62922413-62922435 CAATCTCCCTCAGCCCTACTGGG + Intergenic
1091668517 12:2436262-2436284 GAAATTCCTTCATCCCTTGAAGG + Intronic
1097644234 12:62216938-62216960 GCATTTCCCTGAACCCTTATAGG - Intronic
1098550309 12:71754961-71754983 GACTTTCCCTCAGCCCTTCCAGG + Exonic
1100081252 12:90854376-90854398 AAATTTTCCTCAGCCAATGTGGG + Intergenic
1103940022 12:124496424-124496446 GCATTTCCCTCAGCTCTGGGGGG - Intronic
1111034961 13:82659983-82660005 GAGTTTCCTTGACCCCTTGTGGG - Intergenic
1113999801 14:16403493-16403515 GAATTTGTCTCTGCTCTTGTGGG - Intergenic
1114232803 14:20799304-20799326 TCATCTCCCTCAGCCCTTGGGGG - Intergenic
1118003663 14:61545978-61546000 GAATTTCCCACAGGCCATCTGGG + Intronic
1124347936 15:28934789-28934811 GAAATCCGCTCAGCCCATGTGGG - Intronic
1124423272 15:29540471-29540493 GAGTTTCACTGAGCCCTGGTGGG - Intronic
1125431021 15:39593555-39593577 GAGTATCCCTGAGCCCTCGTGGG - Exonic
1125850372 15:42897447-42897469 GTATTTCCTTCAGCTATTGTCGG - Intronic
1128665115 15:69532091-69532113 TAATGCCCCTCAGCCCTTCTGGG + Intergenic
1130337506 15:82969530-82969552 TAAGCTCCCTCAGCCTTTGTGGG + Intronic
1136564239 16:31060649-31060671 GAAATTCCCTGTGCCCTTCTTGG - Intergenic
1138197732 16:55064883-55064905 GAATTTTCTCCAGCTCTTGTCGG + Intergenic
1138640091 16:58378783-58378805 GAACTTCCCTCACTCCTTGGTGG + Intronic
1139325624 16:66150619-66150641 CCAGTTCCCTCATCCCTTGTTGG + Intergenic
1142292270 16:89198621-89198643 GAATCTCCCTCCTCCCTGGTAGG + Intronic
1148992479 17:51678506-51678528 GAAAATCCCTCAGTCCATGTGGG + Intronic
1156240784 18:35251948-35251970 TAATTGCCCTCAGCAATTGTGGG + Exonic
1158335089 18:56407305-56407327 GTATTTTCCTGAGCCCTTCTAGG + Intergenic
1161328018 19:3672756-3672778 GAAGGTGCCTCAGCCCCTGTGGG + Intronic
1163738859 19:18998507-18998529 GAATTTCCCTCCGCCTTTGAAGG - Intronic
1164140492 19:22457320-22457342 CAATTTTCATAAGCCCTTGTAGG - Intronic
1164854561 19:31511106-31511128 GCATATCCCTCAGCCCCTGATGG - Intergenic
927868012 2:26605317-26605339 AAATGTCCTTCACCCCTTGTTGG + Intronic
928727282 2:34189325-34189347 GTATTTCTCAAAGCCCTTGTTGG - Intergenic
929096623 2:38268615-38268637 ACATGTGCCTCAGCCCTTGTGGG - Intergenic
929826605 2:45313748-45313770 CTATTTCCCTAAGGCCTTGTGGG - Intergenic
931458747 2:62432635-62432657 AAATTTCCCTGACCCCTTGTGGG - Intergenic
932141804 2:69285488-69285510 GAATTTCAATCTGCCCTTGTTGG + Intergenic
939871834 2:147534621-147534643 GATTTTCCAGCAGCTCTTGTTGG - Intergenic
940526173 2:154817321-154817343 GAATTTCCATCAGACATTGAAGG - Intronic
940797188 2:158092442-158092464 GATTTTCCCTCAGCACTCATGGG - Intronic
941588339 2:167387488-167387510 TAATTTCCCTCAGTCTTTTTTGG - Intergenic
943624712 2:190185611-190185633 GTATTTCCCTAAGCCCTTCTGGG - Intronic
944015139 2:195026853-195026875 GAATTTCCCTCACATTTTGTAGG - Intergenic
946500298 2:220240052-220240074 GATTTTGTCTAAGCCCTTGTTGG - Intergenic
948109497 2:235443398-235443420 AGATGTACCTCAGCCCTTGTTGG - Intergenic
1171727220 20:28635643-28635665 GAATTTGTCTCTGCTCTTGTGGG - Intergenic
1171856401 20:30347928-30347950 GAATTTGTCTCTGCTCTTGTGGG + Intergenic
1173125132 20:40329698-40329720 GAATTCCCCAAAGCCCTTTTGGG - Intergenic
1173533278 20:43787205-43787227 GATTTTCTTTCAGCCCTTCTTGG - Intergenic
1174277511 20:49414586-49414608 GCATTTCCCTCCTTCCTTGTGGG - Intronic
1174770749 20:53297868-53297890 GAATATCCCTCAACCCTGGAAGG + Intronic
1176313740 21:5221956-5221978 GAATTTGTCTCTGCTCTTGTGGG - Intergenic
1177747786 21:25242019-25242041 GAAATTCTCTCAGCCTTTGTTGG + Intergenic
1179135267 21:38674865-38674887 GAATCCACCCCAGCCCTTGTTGG + Intergenic
1180391559 22:12288065-12288087 GAATTTGTCTCTGCTCTTGTGGG - Intergenic
1180408186 22:12576689-12576711 GAATTTGTCTCTGCTCTTGTGGG + Intergenic
949433835 3:4006815-4006837 GAATTTATCTCAGCCCTAGAGGG - Intronic
951430890 3:22605728-22605750 AAATTTCTCTCAGTCCCTGTGGG - Intergenic
951942164 3:28091528-28091550 GAATTTTTCTCAGCCCTTGAAGG + Intergenic
957625787 3:82650678-82650700 GGCTTTCCTTCTGCCCTTGTAGG + Intergenic
961367659 3:126410769-126410791 GAATGTCCCTCCACCCATGTAGG - Intronic
962820090 3:139039974-139039996 GAATTACCCTCAGCCTCTGTGGG - Intronic
963075600 3:141343621-141343643 TAATTATCCTCAGCCCCTGTTGG + Intronic
963341657 3:144042400-144042422 GCATTTCCCTCAGACCTAATAGG - Intronic
964777571 3:160294778-160294800 GAATTTCCCTAAACTCTTGAGGG + Intronic
979586399 4:122423356-122423378 GAATTTACCTCAGCCCTTTCAGG - Intronic
981227552 4:142314397-142314419 TAATTTCCCTCACCTCCTGTTGG + Intronic
981860697 4:149352633-149352655 GATTTTCCCTCAGTGCTGGTAGG - Intergenic
982062839 4:151621965-151621987 GGATTTCCAACAGCCCATGTTGG - Intronic
983687119 4:170423575-170423597 AAATTTCCCTGAGCCCTGGGAGG - Intergenic
984007605 4:174332116-174332138 CTACTTCCCTCAGCCATTGTTGG - Exonic
985156670 4:186996263-186996285 GAATTTCCCTCAACTCTGGTTGG + Intergenic
986785597 5:11111434-11111456 GAATTTCGGTCAGCTCTGGTGGG + Intronic
987823299 5:22993210-22993232 GAAAATCCCTCAGCCTTTGCTGG - Intergenic
988782542 5:34535983-34536005 AAATTTCCCTCTTCACTTGTGGG + Intergenic
992208166 5:74451539-74451561 GGCTTTCCCTGAGCCTTTGTTGG - Intergenic
992962795 5:81972311-81972333 GTATTCCCCACAGCCCTTGCCGG + Intronic
996511667 5:124323279-124323301 GTATTTCCCTCACCCCTTCTAGG - Intergenic
997463566 5:134071793-134071815 GCCTTGCCCTTAGCCCTTGTGGG + Intergenic
1002304140 5:178273563-178273585 GACTTCCCTTCAGCCCTTGGTGG - Intronic
1003112905 6:3264076-3264098 GAAGTGCCCACAGCCCCTGTGGG + Intronic
1007282427 6:40722373-40722395 CTATTTCCCTCAGCCTTTGTTGG + Intergenic
1007747224 6:44050737-44050759 GAATTTCCATGTGCACTTGTGGG - Intergenic
1007941744 6:45787981-45788003 GAATTTCCCTGAGGTCTTGTTGG - Intergenic
1015860847 6:137678250-137678272 GATTTTCCCTCACCTTTTGTAGG - Intergenic
1019409008 7:898572-898594 GAAGTTCCCACAGCCGTGGTGGG + Exonic
1021124687 7:16837629-16837651 TAATTTCTCTCAGCACTTGTTGG - Intergenic
1021311901 7:19106975-19106997 AAGTTTCCCTCATCCCTTCTTGG + Intronic
1024609908 7:51055308-51055330 GAGTTTCCCGCAGCCCTTGAGGG - Intronic
1025018873 7:55464905-55464927 GAGAGCCCCTCAGCCCTTGTGGG - Intronic
1025779747 7:64590595-64590617 CAATTTCCATCAGCACTTTTTGG - Intergenic
1026845044 7:73693985-73694007 GATTTTCACTCAGCCCCTGCAGG - Exonic
1028181559 7:87730615-87730637 GAATTGTCTTCAGCCCTGGTTGG - Intronic
1029592857 7:101518810-101518832 GAATGTCCCTCAGGACTTGACGG - Intronic
1030686758 7:112494833-112494855 GAATTTCCCTCACCACTTAAGGG + Intergenic
1030931708 7:115532518-115532540 CAAATTCACTCAGCCTTTGTTGG + Intergenic
1031260147 7:119507662-119507684 GAATTGCCTTCAGCCCTGGTTGG - Intergenic
1038269925 8:26066814-26066836 GAATTTCCCTCAGGCTTTCATGG + Intergenic
1041056401 8:53990749-53990771 AAGTTTCCCTCAGCCCATATGGG - Intronic
1041499759 8:58527932-58527954 TATTATCCCTCAGCCCATGTGGG + Intergenic
1041539844 8:58971277-58971299 GAATTTCCCACACGCCATGTGGG - Intronic
1044274587 8:90285247-90285269 TAATTTCCCTCATCCCTTCATGG + Intergenic
1044299724 8:90569451-90569473 AAATTTACCTCTGCCCTTCTAGG - Intergenic
1048405702 8:134118072-134118094 GGATTTCCCTCAGCTGTTCTCGG - Intergenic
1048531877 8:135257165-135257187 GGTTTTCCCTCAGCCCCTTTAGG + Intergenic
1054905762 9:70412905-70412927 GACTTTCCCACAGCCACTGTAGG + Exonic
1056462304 9:86819399-86819421 GAATTTTGCTCAGGCCTTTTGGG - Intergenic
1061314033 9:129782991-129783013 GAATTTCCCTGAACCCCTGTTGG + Intergenic
1062360055 9:136183354-136183376 GATTCTCCCCCAGCCCTTGGAGG - Intergenic
1203452647 Un_GL000219v1:134519-134541 GAATTTGTCTCTGCTCTTGTGGG - Intergenic
1186986232 X:15016833-15016855 GAATATCCCTCAGCCAATGATGG - Intergenic
1187676141 X:21718441-21718463 GAATTTTCCTCAGCCCTCGATGG - Intronic
1188507952 X:30903778-30903800 GAATTTCCCTCAGCCCTTGTAGG + Intronic
1188848408 X:35102698-35102720 GGATTTCCCTTATCCCTTATTGG + Intergenic
1189496346 X:41512565-41512587 GAATTTCCCTCAGAACTTTCTGG - Intergenic
1192092346 X:68173224-68173246 GTATTTCCAACAGCCCCTGTCGG + Intronic
1192321721 X:70095340-70095362 AAGTTTCCCTCAGCCCTTGGGGG + Intergenic
1195215605 X:102698392-102698414 GACTTCTCATCAGCCCTTGTGGG + Intergenic
1197278148 X:124504056-124504078 GTATTTCTCTCTGCCTTTGTAGG + Intronic
1199360087 X:146907439-146907461 GAATGTCCCCCTGCCCTTGCAGG - Intergenic