ID: 1188509691

View in Genome Browser
Species Human (GRCh38)
Location X:30922004-30922026
Sequence CTCATTCTTGATCATGCGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 71}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188509691_1188509694 29 Left 1188509691 X:30922004-30922026 CCTGACGCATGATCAAGAATGAG 0: 1
1: 0
2: 0
3: 4
4: 71
Right 1188509694 X:30922056-30922078 TAGAATTCTCTGATACTTCTTGG 0: 1
1: 0
2: 2
3: 47
4: 1619

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188509691 Original CRISPR CTCATTCTTGATCATGCGTC AGG (reversed) Intronic
914864094 1:151411296-151411318 CTCATTCTTATTCATCCCTCAGG + Intronic
916046933 1:161006827-161006849 CTCATTCTTGAACAGGCCCCTGG + Intronic
916838142 1:168570450-168570472 CTCATTCTTCATCCTGCAGCTGG + Intergenic
917472715 1:175339548-175339570 CTCATTCTTGACCTGGCCTCTGG + Intronic
919746332 1:201011157-201011179 CTGATTCTTGCTCATCCTTCTGG + Intronic
924555977 1:245118961-245118983 CTCATTCTTGATGATGGGGCAGG + Intronic
924803544 1:247345186-247345208 CTCATCCTCCATCATGCCTCTGG + Intergenic
1063515664 10:6692574-6692596 CTCAATCTTGAGCATGCTCCAGG + Intergenic
1070554388 10:77516706-77516728 CTCATGCCTCATCATGTGTCTGG + Intronic
1071908562 10:90203480-90203502 CTAATTCATGATCATGCTTCAGG + Intergenic
1078087703 11:8244048-8244070 CTCATTCATGTTTATGTGTCAGG - Intronic
1085325230 11:75601612-75601634 CTCTTGCTTGCTTATGCGTCAGG - Intronic
1086231909 11:84579539-84579561 GTCATTCTTTCTCATGCTTCTGG - Intronic
1087605039 11:100366804-100366826 CCCATTCTTGGTCTTGGGTCTGG + Intergenic
1100030844 12:90189026-90189048 CTCATTATTGATCAAGAGCCTGG + Intergenic
1102428689 12:112864638-112864660 ACCATTCTTGAGCATGCATCAGG + Intronic
1111969803 13:94900251-94900273 CTGACTCTTAATCATGCTTCTGG - Intergenic
1122148258 14:99706984-99707006 CTCATTCTTGAGCAAGGGACAGG + Intronic
1127738361 15:61869899-61869921 CTCAAACTTGAGCATGTGTCAGG - Intronic
1129799369 15:78402014-78402036 CCAATACTTGATCATGCATCGGG + Intergenic
1137412965 16:48244786-48244808 CTCATTCATGGTCATGGGGCAGG - Intronic
1139200599 16:64972515-64972537 CTCAAACTTGATCATGCATCAGG - Intronic
1143559715 17:7686336-7686358 CTCATTCTTGAAAATACCTCCGG + Exonic
1159674772 18:71268867-71268889 CTCATTCTGAATCATGGATCAGG + Intergenic
925585627 2:5461397-5461419 CTCTTTCCTGAACATGCCTCAGG - Intergenic
925770760 2:7281005-7281027 CTCATTTTTGCCCATGTGTCAGG + Intergenic
927761604 2:25761140-25761162 CTCATTCTTGAGCTTCAGTCAGG - Intronic
931825950 2:66001165-66001187 CTCAAACTTGAGCATGCATCAGG - Intergenic
935394406 2:102590710-102590732 CTCATTCTTGATCACATGTATGG + Intergenic
937815084 2:126242515-126242537 CTGGTCCTTGTTCATGCGTCTGG - Intergenic
941606046 2:167597649-167597671 CTCATTCTAATTCATGTGTCAGG - Intergenic
946754596 2:222931579-222931601 CTCTTACTTGATCATTGGTCAGG + Intronic
947029719 2:225780233-225780255 ATCATTCTTGATCATGTGAGTGG - Intergenic
948921159 2:241066534-241066556 CCCATTCTTGCTCCTGTGTCTGG - Intronic
1170768247 20:19310249-19310271 CTCAGTCTTGCTGATGCCTCTGG - Intronic
1175612317 20:60361926-60361948 CTCAAACTTGAGCATGCATCAGG - Intergenic
1175963488 20:62648550-62648572 CTCATTCTGGAGCAGCCGTCAGG + Intronic
1181507232 22:23367857-23367879 CTCAAACTTGAACATGCATCAGG - Intergenic
949725428 3:7039050-7039072 CTCAAACTTGACCATGCATCAGG - Intronic
953380036 3:42463004-42463026 CTCATTCTTGGTCATGAACCTGG - Intergenic
954693103 3:52406310-52406332 CTCATACTTGATCCTGCGGTCGG + Exonic
955680291 3:61493082-61493104 CTCATTTTGTAGCATGCGTCAGG + Intergenic
955689014 3:61572418-61572440 CTCGTTCTGGATCTTGTGTCTGG + Intronic
961667376 3:128501690-128501712 CTCTTTCTTGCTCATGTGTGAGG - Intergenic
961954185 3:130783887-130783909 CTAATTCTTGATCACGAGCCAGG - Intergenic
963408088 3:144894139-144894161 ATCATTCTCGATGATGCATCAGG - Intergenic
965120086 3:164543040-164543062 CTCATAATTGACCATGTGTCCGG + Intergenic
965159475 3:165113448-165113470 ATCATTCTTGATAATGTGTATGG - Intergenic
966188596 3:177250155-177250177 CTCATTCTTCATCTTCCTTCAGG - Intergenic
966927510 3:184654994-184655016 CTCAAGCTTGAGCATGCATCAGG + Intronic
971060280 4:22960474-22960496 CTCTTTCTTGATCTTGTCTCAGG + Intergenic
975451431 4:74531388-74531410 CTTATTCTGGATGATGCCTCAGG - Intergenic
975769105 4:77701716-77701738 CTCATTCCTGTTTATGCGTTAGG - Intergenic
981235263 4:142408129-142408151 CTCATTATTTATCAGCCGTCTGG - Intronic
984185320 4:176536510-176536532 ATCATTCCTAATCATCCGTCAGG - Intergenic
988961309 5:36374311-36374333 CTCATTCTTTATCCTGCCACTGG - Intergenic
990035899 5:51319534-51319556 CTCAGTCTTCATCTTGCTTCAGG + Intergenic
993540797 5:89148859-89148881 CTTATTCTTGACCATGCATCAGG - Intergenic
1020851133 7:13353880-13353902 CTCATTTTTAATCATCCCTCTGG - Intergenic
1021843444 7:24741986-24742008 TTTATTCTTTATCATGCTTCTGG + Intronic
1022762735 7:33374249-33374271 CTCATGCTTTATCAAGCATCAGG - Intronic
1024449600 7:49524056-49524078 CTTATTCTGGATGATGAGTCAGG - Intergenic
1029268704 7:99363002-99363024 GTCATGCTTCATCATGCCTCTGG + Intronic
1036920027 8:12843714-12843736 AACATTTTTGATCATGCTTCTGG + Intergenic
1043328857 8:79088073-79088095 TTCATTCTTGATGTTGAGTCTGG + Intergenic
1043807811 8:84695151-84695173 CTGTTTCTTGATAATGTGTCAGG + Intronic
1043908084 8:85830920-85830942 CTCATTCATGCTAATGCTTCTGG + Intergenic
1044051230 8:87507540-87507562 CTCAATCTTGATTGTGCATCAGG - Intronic
1047850005 8:128846656-128846678 CTCATTCCTGGTCATGCTTGGGG - Intergenic
1047944208 8:129858759-129858781 CTCAGTCTTGCTCATGCTTTAGG - Intronic
1052459724 9:28747141-28747163 CTCCTTCTGGATCCTGGGTCTGG - Intergenic
1056998225 9:91483734-91483756 CTCATTCTTGCTCTTGCGGGGGG - Intergenic
1186130665 X:6462021-6462043 CTCTTTCTAGATCATGCCTGTGG + Intergenic
1188509691 X:30922004-30922026 CTCATTCTTGATCATGCGTCAGG - Intronic
1193948499 X:87767066-87767088 CATCTTCTTGATCATGCATCTGG + Intergenic
1196881240 X:120199925-120199947 CTCATTCTTGTTTATCCTTCAGG + Intergenic