ID: 1188511880

View in Genome Browser
Species Human (GRCh38)
Location X:30944965-30944987
Sequence TGCCCACTGGATCCACAATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 119}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188511880_1188511885 0 Left 1188511880 X:30944965-30944987 CCTCATTGTGGATCCAGTGGGCA 0: 1
1: 0
2: 0
3: 11
4: 119
Right 1188511885 X:30944988-30945010 GTGTCTCTGGGGACAATTCATGG 0: 1
1: 0
2: 1
3: 5
4: 138
1188511880_1188511887 12 Left 1188511880 X:30944965-30944987 CCTCATTGTGGATCCAGTGGGCA 0: 1
1: 0
2: 0
3: 11
4: 119
Right 1188511887 X:30945000-30945022 ACAATTCATGGGAGCGATAGAGG 0: 1
1: 0
2: 0
3: 6
4: 64
1188511880_1188511886 1 Left 1188511880 X:30944965-30944987 CCTCATTGTGGATCCAGTGGGCA 0: 1
1: 0
2: 0
3: 11
4: 119
Right 1188511886 X:30944989-30945011 TGTCTCTGGGGACAATTCATGGG 0: 1
1: 0
2: 2
3: 12
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188511880 Original CRISPR TGCCCACTGGATCCACAATG AGG (reversed) Intronic
900111177 1:1006237-1006259 GGCCCACTGGGTCCACTGTGTGG + Intergenic
901124966 1:6922794-6922816 AGCCTATTGGATCCACACTGTGG - Intronic
904474646 1:30757136-30757158 TCCCCACTGGAGGCACAAAGGGG + Intronic
907026292 1:51123277-51123299 TCCACACTTAATCCACAATGTGG - Intronic
908454209 1:64286050-64286072 TGCCCATTAAAGCCACAATGAGG - Intergenic
913189438 1:116400961-116400983 TGACCGCTGGATCAACGATGTGG + Exonic
913549401 1:119902896-119902918 GGCCCACTGGAGCCACACCGGGG - Intergenic
916781986 1:168043346-168043368 TGGCCACTGTGTCCACAAAGAGG - Intronic
920725171 1:208428258-208428280 TACCCAGAGGATCCACTATGGGG + Intergenic
921926021 1:220710650-220710672 AGCCCACTGGAGCCATATTGAGG + Intergenic
923869339 1:237974013-237974035 TTCCCACTGGGTCCATAATGAGG + Intergenic
1063960331 10:11301323-11301345 AGCCCACTGGAGCCCCTATGCGG + Intronic
1064003725 10:11683964-11683986 TGTCCCCTGGCTCCAGAATGGGG + Intergenic
1070870106 10:79744015-79744037 TGCACACTGAGTCCCCAATGGGG + Intergenic
1071588131 10:86845552-86845574 TGCCCACCAGAGCCACAGTGCGG + Intronic
1071637027 10:87266235-87266257 TGCACACTGAGTCCCCAATGGGG + Intergenic
1071658216 10:87471719-87471741 TGCACACTGAGTCCCCAATGGGG - Intergenic
1072458894 10:95601609-95601631 TGCTCACTGGATACTGAATGAGG + Intergenic
1072522741 10:96242981-96243003 TCCCCAGTGCATGCACAATGTGG + Intronic
1073143537 10:101264558-101264580 TGTGCAAAGGATCCACAATGTGG + Intergenic
1077794456 11:5477338-5477360 TGCCCACTGGTTCCCCACTGAGG - Intronic
1078765414 11:14292215-14292237 TGCCCACTAGAACCCCAAAGAGG - Intronic
1083144649 11:60749261-60749283 TTCCCACCTGATCCACAAAGTGG + Intergenic
1084365905 11:68698532-68698554 TGCACATTAAATCCACAATGAGG + Intergenic
1085290059 11:75391720-75391742 TGGCCACTGGATCCGCACAGTGG - Intergenic
1091048940 11:132350653-132350675 TGCCCCCTGTGTGCACAATGTGG - Intergenic
1093829048 12:23733009-23733031 TGACCACTACATTCACAATGTGG - Intronic
1101587353 12:106096490-106096512 TGCAGACTGGATCCAAACTGAGG - Intronic
1108166921 13:47702836-47702858 TGCCCACTTGGTTCACAAAGAGG + Intergenic
1109406778 13:61910705-61910727 TTCCCCCTGGATCCTCTATGTGG + Intergenic
1113531053 13:111027657-111027679 TACCCATGGGATCCACGATGTGG + Intergenic
1113647599 13:112010176-112010198 TGGCCACCGGATCCAGGATGAGG + Intergenic
1113813307 13:113154755-113154777 TGCCACCTCCATCCACAATGTGG + Intergenic
1115926474 14:38441366-38441388 TGCCCTCTGGACCTATAATGGGG + Intergenic
1118601178 14:67472415-67472437 GGCCCTGTGGATCCACAGTGGGG - Exonic
1125830826 15:42716151-42716173 TACCCTCTGGATCTGCAATGTGG - Intronic
1126350271 15:47738766-47738788 TGGCCCCTGAATCTACAATGTGG + Intronic
1128667277 15:69547717-69547739 TGACCCCTGGTTCCACCATGTGG - Intergenic
1131400586 15:92122447-92122469 TGTACATTGGAACCACAATGAGG + Intronic
1131823121 15:96293069-96293091 TTCCCACTGGAGCCACACTGAGG + Intergenic
1133522931 16:6576402-6576424 TCCCAACTGGGTCCACTATGTGG - Intronic
1134020158 16:10915892-10915914 CGCCTACTGCATCCTCAATGTGG + Intronic
1136727862 16:32376206-32376228 TGCCCAGTGAATCCACGAAGTGG + Intergenic
1139410026 16:66751594-66751616 TGCCAACTGCAGCCACAAAGAGG + Exonic
1141698416 16:85631489-85631511 ACCCCACTGGAGCCACAATGGGG - Intronic
1202998573 16_KI270728v1_random:141548-141570 TGCCCAGTGAATCCACGAAGTGG - Intergenic
1203130170 16_KI270728v1_random:1677952-1677974 TGCCCAGTGAATCCACGAAGTGG - Intergenic
1142932473 17:3298720-3298742 TGGCCTCTGTATCCACAACGAGG - Intergenic
1143893717 17:10120941-10120963 GGCCCACTGGAACCCCAAGGTGG + Intronic
1144314476 17:14046852-14046874 TGCCCACTGGAGCTAGAGTGGGG + Intergenic
1147129307 17:38397252-38397274 TCCCCACTGGAACCACAGAGAGG - Intronic
1156525886 18:37766764-37766786 GGCCCACTGAAGCCACAATTTGG + Intergenic
1160065699 18:75572422-75572444 TGCACACTGAAACCACAATAAGG - Intergenic
1160622806 18:80182320-80182342 TGCCCCCAGTATCCACAAGGAGG + Intronic
1162554505 19:11378430-11378452 TGCCCACTGGCTCCAGCAGGGGG + Exonic
1164407518 19:27965390-27965412 TGCCCACAGCATCTAAAATGAGG - Intergenic
1164745863 19:30612435-30612457 TGCCCACTTGATTCTCACTGAGG + Intronic
1167669425 19:50841275-50841297 AGCCCAGTGGTTCCCCAATGGGG - Intergenic
1167809709 19:51818391-51818413 TGTCCAATGGAAACACAATGTGG - Intronic
925415842 2:3669676-3669698 TGCCCACTGGACCCAGAACATGG - Intronic
926834063 2:16998584-16998606 TGCCCACTGTAACCACTATCTGG + Intergenic
928920847 2:36525550-36525572 TGCCCACTGGAAAAACAATTGGG - Intronic
929921136 2:46172339-46172361 TGTGCACTGGATGGACAATGTGG + Intronic
932105486 2:68937444-68937466 GGCCTTGTGGATCCACAATGGGG - Intergenic
933851305 2:86368724-86368746 TGCCCACAGGAGCCAGCATGGGG + Intergenic
933887888 2:86737267-86737289 TGGCCACTGGATTTACAATGTGG - Intronic
933922290 2:87059445-87059467 TGGCCACTGGATTTACAATGTGG + Intergenic
942992752 2:182221388-182221410 CATCCACTGGATCCACGATGTGG - Intronic
946119332 2:217495765-217495787 TGCCCACTACATTCTCAATGTGG + Intronic
1171187429 20:23132932-23132954 TGGCCCTTGGTTCCACAATGTGG - Intergenic
1173164089 20:40674047-40674069 TGCTCACTGGAGCCAGAATGGGG - Intergenic
1175869482 20:62201520-62201542 AGACCTCTGGATCCACACTGGGG + Exonic
1178865739 21:36325817-36325839 TGTCCAGTGTATCCACACTGTGG + Intronic
1179632837 21:42689148-42689170 TGCCCACTGAAGCCTCACTGAGG - Intronic
1184110683 22:42392374-42392396 TGCCCATTGGTTTAACAATGTGG + Intronic
1184474787 22:44714582-44714604 TGCCCCCAGCATCCACAACGGGG + Exonic
950414062 3:12858353-12858375 TGCACACTGGGTAAACAATGGGG - Intronic
950877965 3:16294976-16294998 TGCCCTCTGGGTTCACAATACGG + Exonic
953280220 3:41547790-41547812 TGCCAGCTGGAACCATAATGTGG + Intronic
956286887 3:67620106-67620128 TTTCCACTGCATCCATAATGTGG + Intronic
962117527 3:132527392-132527414 TACCCACTGGACCCTCATTGAGG + Intronic
967521340 3:190436286-190436308 TCCCCACTGAATACAGAATGTGG - Intronic
968657576 4:1785338-1785360 TGCCCCTTTGATCCACACTGAGG + Intergenic
971386942 4:26149495-26149517 TGCAAACTTGATCCCCAATGTGG + Intergenic
972149040 4:36065439-36065461 TGCCCAGTGTATTCACTATGTGG + Intronic
973844309 4:54894912-54894934 TGGCTGCTGGCTCCACAATGTGG + Intergenic
974165388 4:58195345-58195367 TGCCCAGAGGATCCAAAAGGAGG + Intergenic
977067210 4:92333247-92333269 AGCCCACTGGAGCCACGATTAGG + Intronic
977165334 4:93687626-93687648 TGACCACTGGATTCATAATGAGG + Intronic
977612868 4:99054573-99054595 TTCCCTCTGCATTCACAATGTGG + Intronic
978069254 4:104446403-104446425 TGCAGACTGGATACACCATGAGG - Intergenic
979827822 4:125261318-125261340 TGACCACTGGATTGGCAATGTGG - Intergenic
983516100 4:168658146-168658168 TTTCCACTGCATCAACAATGAGG + Intronic
987606625 5:20144166-20144188 TGCCCTCTGGAACCTCAAAGAGG - Intronic
995557634 5:113345427-113345449 GGCCCACTGTAACCACTATGTGG - Intronic
995779002 5:115755901-115755923 TGCACACTGGATCCAGCCTGTGG - Intergenic
995883793 5:116870750-116870772 GGCCCACTGGATCTAAAATCTGG - Intergenic
998137892 5:139684020-139684042 AGGCCTCTGGATCCAGAATGGGG + Intergenic
998884038 5:146675670-146675692 TGCCCACTGGCTCCAGAAAGGGG - Intronic
1000020320 5:157312588-157312610 TGCTCACTGCTTCCACCATGTGG + Intronic
1004510276 6:16279043-16279065 TGCCCACGGATTCCACAGTGAGG + Intronic
1007088844 6:39169453-39169475 TGCCGTCTGGAAGCACAATGGGG - Intergenic
1014023730 6:116619564-116619586 TGCCTACTGAATCTACAATGTGG + Intronic
1030387663 7:108885179-108885201 TGCCCACTGTTTCCACTCTGTGG + Intergenic
1032489434 7:132313072-132313094 TGCCCCCTGGATGCACATGGGGG + Intronic
1033228646 7:139580101-139580123 TGCCTTCTGCAGCCACAATGTGG + Intronic
1038574091 8:28688974-28688996 TTCCCAATGGATGCAGAATGGGG - Intronic
1038944557 8:32343770-32343792 TGTCTTCTGTATCCACAATGAGG - Intronic
1040923326 8:52648992-52649014 TGTCCAGTGTATCCACACTGTGG - Intronic
1042903955 8:73754545-73754567 TGACCACTGGATGCACAGAGAGG - Intronic
1044782700 8:95759779-95759801 TGTCCAGTGTATCCACACTGTGG + Intergenic
1045945273 8:107788645-107788667 AGCCCACTGGAACCAGATTGAGG + Intergenic
1047714704 8:127584963-127584985 AGACCACTGGATCCCAAATGTGG + Intergenic
1048423724 8:134303317-134303339 TGCCCACAGCATCCAGAGTGTGG + Intergenic
1048523627 8:135180385-135180407 TGGCCAATGGATCCATAATTTGG - Intergenic
1049488171 8:142877122-142877144 TGGCCACTGCATCCACCATCGGG + Exonic
1049493057 8:142915145-142915167 TGGCCACTGCATCCACCATCGGG + Exonic
1051927430 9:22345968-22345990 TGCCCACTAAATGCACAATTTGG + Intergenic
1052903670 9:33816771-33816793 AGGCCCCTGGATCCACAGTGGGG + Intergenic
1056310899 9:85339870-85339892 TGCCCACTGGACCCTCAGTGGGG - Intergenic
1056911476 9:90704832-90704854 TGGCCACTGGATTCACTCTGGGG - Intergenic
1057966250 9:99506204-99506226 TTCCCACTTGATAAACAATGGGG + Intergenic
1060022262 9:120141927-120141949 AGCCCACTGGTCCCACAAGGTGG + Intergenic
1061279110 9:129586892-129586914 TGCCCACTGGAGCCACAGCCTGG - Intergenic
1185955331 X:4482872-4482894 TGTCCACTGTATCCAATATGTGG - Intergenic
1186090858 X:6047767-6047789 TGCCCACTCCATCTAAAATGAGG + Intronic
1186107713 X:6225956-6225978 TGCGAGCTGGATCCACAAGGTGG - Intronic
1187288637 X:17931010-17931032 TTCCCACTGAATACACAAGGGGG + Intergenic
1187396123 X:18921086-18921108 TACCCACTGGATCCACTTGGGGG - Intronic
1188511880 X:30944965-30944987 TGCCCACTGGATCCACAATGAGG - Intronic
1190501071 X:51078973-51078995 GGCCCACTAGATCCAGAATCCGG + Intergenic