ID: 1188513559

View in Genome Browser
Species Human (GRCh38)
Location X:30961603-30961625
Sequence TACTGGGCCCACTTCTGAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 91}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188513559 Original CRISPR TACTGGGCCCACTTCTGAAG TGG Intronic
900806033 1:4769061-4769083 TACCTGCCCCACTTCTGAAGTGG + Intronic
901077548 1:6564755-6564777 TACTGCGGCCTTTTCTGAAGAGG + Intronic
902763214 1:18597918-18597940 CACTGGGCCCAATTCTGGAAGGG - Intergenic
905487398 1:38312477-38312499 TCCTTTGCCCACTTCTTAAGGGG - Intergenic
909971572 1:81997309-81997331 TACTGGTCCCACTGCTGACTGGG - Intergenic
920991216 1:210941636-210941658 CACTGGGCATACTTCTGAGGAGG + Intronic
1063638517 10:7808796-7808818 TTCAGGAGCCACTTCTGAAGGGG + Intergenic
1069888834 10:71640457-71640479 TACTGGGCCCAGTCCGGGAGCGG + Intronic
1078982053 11:16546926-16546948 TCCTTTGCCCACTTCTGAATGGG - Intronic
1079149961 11:17889179-17889201 TACTGGGCAAAAGTCTGAAGAGG + Intronic
1081661142 11:44889212-44889234 TCTTGGGCCCACTTCCTAAGGGG - Intronic
1097153785 12:56997918-56997940 TACTGGGCCCAAACCTGAAAGGG + Intergenic
1104296350 12:127518159-127518181 TAAGTGGCACACTTCTGAAGTGG - Intergenic
1104846916 12:131851505-131851527 GACTGGGCACCCTTCTGGAGCGG - Exonic
1119246891 14:73117875-73117897 TACTCTGCTCCCTTCTGAAGGGG - Intronic
1120838574 14:89062996-89063018 CACTGAGCCCACTTCTGAGTGGG - Intergenic
1122985501 14:105209834-105209856 TCCTGGGCCCACAACTCAAGTGG + Exonic
1124633976 15:31353377-31353399 TAGAGGGCCCCCTTGTGAAGAGG + Intronic
1128419918 15:67482094-67482116 TCCTTGGGCCACATCTGAAGTGG - Intronic
1130537180 15:84794813-84794835 TAATTTGCCCACTTCTGAATTGG + Intronic
1131510940 15:93049142-93049164 TGCTGCTCCCCCTTCTGAAGGGG + Intronic
1133611617 16:7438940-7438962 CACTGGGCTGACTTCTGAAATGG - Intronic
1135752775 16:25070253-25070275 TGCTGGGCTCTCTTCTGATGTGG - Intergenic
1139009854 16:62618483-62618505 TCCTGGGCCCACTTTTTAATGGG - Intergenic
1139637492 16:68266660-68266682 TACTGGACCCATTTATGAGGAGG + Exonic
1140691678 16:77490657-77490679 TCCTGCTCCCACTTCTGCAGTGG + Intergenic
1141882401 16:86868595-86868617 TATTGGGCTCTCTACTGAAGCGG + Intergenic
1147896470 17:43755047-43755069 TGCTGGTCCCACTTCAGAGGAGG - Exonic
1147987029 17:44312685-44312707 CGCTGGGCCCACCTTTGAAGCGG - Exonic
1151226199 17:72650069-72650091 TCCTTGTCCCATTTCTGAAGTGG - Intronic
1152671909 17:81613436-81613458 TGCTGGGCCCTCATCTGAAATGG - Exonic
1162283144 19:9716558-9716580 TCCTGGGCCCCATTCTAAAGTGG - Intergenic
1163883846 19:19949174-19949196 TACTGCGGCCTTTTCTGAAGAGG - Intergenic
1164751757 19:30660986-30661008 CACTGGGCTCACGTCTGGAGTGG - Intronic
1168371012 19:55834549-55834571 TAGTGAAACCACTTCTGAAGAGG + Intronic
926544543 2:14223382-14223404 TCCTGGGCCCACTTCTCATTTGG - Intergenic
929785533 2:44988191-44988213 TCCTGGGGCCTCTTCAGAAGTGG - Intergenic
930067271 2:47337243-47337265 TACTGGGCTAAGGTCTGAAGAGG + Intergenic
932838828 2:75062133-75062155 TGCTGGGCCAATTTCTGAGGAGG - Intronic
935228784 2:101078028-101078050 TGCTGAGCCCACTTCTGCGGGGG - Intronic
943606192 2:189979740-189979762 TCCTTGGCTCACTTTTGAAGGGG - Intronic
944869648 2:203897095-203897117 TCCTTGCCCCAGTTCTGAAGGGG + Intergenic
945105150 2:206304744-206304766 TACTGGGTCATCGTCTGAAGTGG + Exonic
948261509 2:236607444-236607466 TCCTGGGCCCTTTTCTAAAGAGG + Intergenic
1168792557 20:589488-589510 TCATGTGCCCACCTCTGAAGTGG - Intergenic
1170506368 20:17029954-17029976 TTCTGGGCCCAGTTGTGAAGAGG + Intergenic
1171100005 20:22374005-22374027 ACCTGGGCCCACATCTGTAGTGG - Intergenic
1171274269 20:23842332-23842354 TCCTGGGGCCAATGCTGAAGGGG + Intergenic
1174733133 20:52937827-52937849 CACTGTGTCCACTTCTGAGGTGG + Intergenic
1175247497 20:57590735-57590757 CACTGTGTCCACTTCTGAGGGGG + Intergenic
1175668503 20:60880705-60880727 TACTGGGCACCCATCTGAAGTGG - Intergenic
1184152281 22:42646119-42646141 TACTTGGCCCACTGCTGGTGAGG - Intronic
949547097 3:5081612-5081634 TCCTGGGCTGGCTTCTGAAGGGG + Intergenic
950002996 3:9672002-9672024 CACTGAGCCCACTTCTGAACAGG - Intronic
951971922 3:28455306-28455328 TACTTGGCCCACTTTTAAATGGG + Intronic
953861647 3:46549388-46549410 TACTACCCCCATTTCTGAAGAGG + Intronic
953932634 3:47013322-47013344 TCCTGGGCCCTCTTCTGGAGGGG - Intergenic
959481022 3:106872833-106872855 AACTGGGCACACCTCTGGAGAGG + Intergenic
962381694 3:134903405-134903427 TCCTGGGCACACTGCTGAAGAGG - Intronic
962396988 3:135024619-135024641 TAGTGGGCCCACTTTGGAAATGG + Intronic
962840122 3:139225554-139225576 TACTGGAGCCCCCTCTGAAGGGG - Intronic
963242316 3:143019106-143019128 TACTTGGCCCACTTTTTAATTGG + Intronic
964722014 3:159776914-159776936 CACTGGGCCCACTGCTCCAGTGG - Intronic
964802091 3:160567920-160567942 CACTGGGCCCACTAGTGTAGGGG - Intergenic
982376661 4:154698123-154698145 TACTGTACCCACTTCTGAAAAGG - Intronic
983915019 4:173282517-173282539 TAGAGTTCCCACTTCTGAAGTGG - Intronic
985331692 4:188844352-188844374 AACTGGACCCGGTTCTGAAGGGG - Intergenic
986092617 5:4525018-4525040 TCCTGGCTCCACTTCTTAAGTGG + Intergenic
998043807 5:138970515-138970537 TACTGGGTCCCATTATGAAGAGG + Intronic
1000319874 5:160125805-160125827 TTCTGGGCCTATTTCTGATGAGG + Intergenic
1002522359 5:179798809-179798831 TACGAGGCCCACTTCAGATGCGG + Intronic
1008467379 6:51845921-51845943 TACTTAGCCTGCTTCTGAAGAGG - Intronic
1013114419 6:107090678-107090700 TACTCACACCACTTCTGAAGTGG + Intronic
1018036805 6:159888811-159888833 AACTCTGCCCACCTCTGAAGGGG + Intergenic
1019093924 6:169563776-169563798 TTCTGAGCCCACACCTGAAGGGG + Intronic
1019442167 7:1052923-1052945 AAAAGAGCCCACTTCTGAAGAGG + Intronic
1023834181 7:44058813-44058835 TACTGGGCCGACAGCTGGAGGGG + Intronic
1024086397 7:45895037-45895059 TACTGGGGCCCTTTCTCAAGGGG + Intergenic
1027548813 7:79564727-79564749 TACTGCCCCCACTGCTGAAGTGG - Intergenic
1027967414 7:85029665-85029687 TTCAGGGCCCACCACTGAAGAGG + Intronic
1028837850 7:95394678-95394700 TACTGGCTCCACTTCTCGAGAGG + Exonic
1034469384 7:151247447-151247469 TACTGGCCCATCTGCTGAAGAGG + Intronic
1035210966 7:157327738-157327760 CACTGTGCCCACTTCAGAACAGG - Intergenic
1038982551 8:32775802-32775824 TACTGTGCCTACGTATGAAGTGG - Intergenic
1044789482 8:95833173-95833195 TACTGGGCCCTCCTCTCAGGAGG + Intergenic
1049574357 8:143383576-143383598 TCCTGAGCCCACTGCTGTAGGGG - Exonic
1049602392 8:143513982-143514004 GACTGGGCCGACTTCAGAAAGGG - Intronic
1050026051 9:1335442-1335464 GACAGGGCCCACCTCTCAAGGGG + Intergenic
1056062516 9:82898249-82898271 TACAGGGCTCACTTTCGAAGAGG - Intergenic
1057939544 9:99269328-99269350 TACTGGGCTCCCAGCTGAAGGGG - Intergenic
1060104286 9:120863822-120863844 TACTGGGCTCAGCTCTGTAGGGG - Intronic
1060597841 9:124858752-124858774 CACAGGGCCCAGTCCTGAAGGGG - Intronic
1062028890 9:134353076-134353098 TACAGGGTCCCCTTCTGGAGGGG + Intronic
1062438270 9:136556739-136556761 TCCTGGGCCCACTGCAGATGGGG - Intergenic
1188513559 X:30961603-30961625 TACTGGGCCCACTTCTGAAGTGG + Intronic
1195922093 X:109994078-109994100 TTCTGGGCTCAGTTCTGATGGGG + Intergenic
1199939051 X:152606654-152606676 TCCTTTGCCCACTTTTGAAGGGG + Intergenic
1200013386 X:153138725-153138747 TCCTTGGCCCACTTTTTAAGGGG - Intergenic
1200026216 X:153261193-153261215 TCCTTGGCCCACTTTTTAAGGGG + Intergenic
1200970681 Y:9149343-9149365 TCCTGGGCCCTCTTCTAAACTGG - Intergenic