ID: 1188523923

View in Genome Browser
Species Human (GRCh38)
Location X:31070050-31070072
Sequence CTTCAAGCACAGCAGGTAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188523923_1188523932 28 Left 1188523923 X:31070050-31070072 CCATTTACCTGCTGTGCTTGAAG No data
Right 1188523932 X:31070101-31070123 TGGATGGATGGTGCACTCTGGGG No data
1188523923_1188523930 26 Left 1188523923 X:31070050-31070072 CCATTTACCTGCTGTGCTTGAAG No data
Right 1188523930 X:31070099-31070121 GGTGGATGGATGGTGCACTCTGG No data
1188523923_1188523931 27 Left 1188523923 X:31070050-31070072 CCATTTACCTGCTGTGCTTGAAG No data
Right 1188523931 X:31070100-31070122 GTGGATGGATGGTGCACTCTGGG No data
1188523923_1188523929 16 Left 1188523923 X:31070050-31070072 CCATTTACCTGCTGTGCTTGAAG No data
Right 1188523929 X:31070089-31070111 GAAGACATGTGGTGGATGGATGG No data
1188523923_1188523927 8 Left 1188523923 X:31070050-31070072 CCATTTACCTGCTGTGCTTGAAG No data
Right 1188523927 X:31070081-31070103 CTGACAGTGAAGACATGTGGTGG No data
1188523923_1188523926 5 Left 1188523923 X:31070050-31070072 CCATTTACCTGCTGTGCTTGAAG No data
Right 1188523926 X:31070078-31070100 CCACTGACAGTGAAGACATGTGG No data
1188523923_1188523928 12 Left 1188523923 X:31070050-31070072 CCATTTACCTGCTGTGCTTGAAG No data
Right 1188523928 X:31070085-31070107 CAGTGAAGACATGTGGTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188523923 Original CRISPR CTTCAAGCACAGCAGGTAAA TGG (reversed) Intergenic
No off target data available for this crispr