ID: 1188528637

View in Genome Browser
Species Human (GRCh38)
Location X:31113289-31113311
Sequence AAAGGAGTCAAGAGTATTTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 313
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 294}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188528632_1188528637 18 Left 1188528632 X:31113248-31113270 CCAGTTGAATTTGCTGATGCTAT 0: 1
1: 0
2: 0
3: 12
4: 179
Right 1188528637 X:31113289-31113311 AAAGGAGTCAAGAGTATTTAAGG 0: 1
1: 0
2: 1
3: 17
4: 294

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188528637 Original CRISPR AAAGGAGTCAAGAGTATTTA AGG Intronic
900846813 1:5110538-5110560 AAGGAAGTCAAGAGAATTTTTGG + Intergenic
901131809 1:6966592-6966614 AAAGGTTTCAAAAGTGTTTAGGG - Intronic
905101157 1:35523192-35523214 AAAGGAGTCAAGAGAGTTCTAGG - Intronic
905348677 1:37329269-37329291 AAAGGAGTCCAGAGTGTCCAAGG + Intergenic
906570208 1:46831399-46831421 AAATGAGTCAAGAGGGTTTCAGG - Intergenic
906630921 1:47367375-47367397 AAAGGAGTAAAGAATATATATGG + Intronic
907149214 1:52266975-52266997 AAATGTGTCAAGACTATTTCTGG + Intronic
907352071 1:53840203-53840225 AAAGGAGACTTGATTATTTATGG + Intergenic
907717291 1:56938974-56938996 AGAGGAGGCAAGAGTGTTGACGG - Intronic
908010103 1:59767445-59767467 ATAGCAGTTAAGTGTATTTATGG - Intronic
908976087 1:69900231-69900253 AAGAGAGTCAATAGTTTTTATGG + Intronic
909828567 1:80156659-80156681 AAAGAAGGCAAAATTATTTAAGG + Intergenic
910735701 1:90454125-90454147 AAAGGATTCAACATCATTTAGGG + Intergenic
911372961 1:97016197-97016219 AAAGGAGTCAGGGGTATGCAGGG - Intergenic
912574641 1:110656657-110656679 AAAGGAGTCAAGAGATCATAAGG + Intergenic
917843903 1:179004385-179004407 AAAGGGGTTAAGAGTACTTCCGG - Intergenic
917886790 1:179394097-179394119 AAGGGAGTAAAAAATATTTAGGG + Intronic
917985397 1:180312049-180312071 AAAGGAGCCAGGAATATCTAAGG - Intronic
918448127 1:184634455-184634477 CAAGGATTAAAGAGGATTTAGGG - Intergenic
919566001 1:199189473-199189495 AAAGCAGTCAGGAGACTTTATGG + Intergenic
919660660 1:200241999-200242021 AAAGGTGTCCAGCTTATTTATGG - Intergenic
921333885 1:214066862-214066884 AAAGGAGAAAGGAGTTTTTAAGG + Intergenic
922545104 1:226450828-226450850 GGAGGAGTCATGAATATTTATGG - Intergenic
923039366 1:230308803-230308825 AAAGGAGTCAACAGCCTTTCTGG - Intergenic
923451333 1:234120434-234120456 AAAGGATTCAAATGTATATATGG - Intronic
924012971 1:239686205-239686227 CATGGAATCAAGAGTTTTTAAGG - Intronic
924244248 1:242066549-242066571 AAGGGAGTCAACACTATTCACGG - Intergenic
924957216 1:248941073-248941095 GGAGGAGTCATGAATATTTATGG + Intergenic
1062883980 10:1002303-1002325 AAAGGGGTCAATAATATTTGGGG - Intronic
1063267174 10:4465795-4465817 AAAGGTGCCAGGAGTATTTATGG - Intergenic
1064157846 10:12918457-12918479 GAAGGAATCAAGTGTCTTTAAGG - Intronic
1064766491 10:18679943-18679965 AAAGGAGTGAAGACTGATTAGGG + Exonic
1064809342 10:19177291-19177313 AAAAGATTCACGAGTTTTTAAGG + Intronic
1067655930 10:48191196-48191218 AGAGGAGTCAAGACTACTCACGG + Intronic
1068000570 10:51329332-51329354 AAAGGCACCAAGAGTATATAAGG - Intronic
1068530761 10:58183262-58183284 AAAGGAATCAAGAGTAGAAAAGG + Intergenic
1071696769 10:87883845-87883867 AAATGAGTCCAAAGTATATAAGG - Intronic
1071926024 10:90410051-90410073 TAAGGAGTAAAGAGTATAAAAGG - Intergenic
1072845905 10:98830148-98830170 ATAGTAGGCAATAGTATTTATGG - Intronic
1074040069 10:109779553-109779575 ATGGGAGTCAATAGTATTAAGGG - Intergenic
1074155840 10:110798617-110798639 TAAGAAGTCAAGATTCTTTAGGG - Intronic
1076177856 10:128382458-128382480 AAAGGAGTCAAGAGAGATGAAGG - Intergenic
1076963123 10:133782917-133782939 GGAGGAGTCATGAATATTTATGG + Intergenic
1078639877 11:13084587-13084609 AAGTGAGTCAAGAGTAGTGAGGG - Intergenic
1079215198 11:18503670-18503692 AAAGGAATTAAGAATAGTTAGGG - Intronic
1080602409 11:33832541-33832563 AAAGGAGACAAGAGCCTTGAAGG + Intergenic
1081267731 11:41047654-41047676 CAAGGAGTCATGAGCATTTCTGG - Intronic
1082135161 11:48539991-48540013 AAAGGAGTAAACAGTCTGTATGG - Intergenic
1083795236 11:65013147-65013169 AATGGAATCCAGAGTGTTTAAGG - Intergenic
1083916596 11:65748997-65749019 AAGGGTGCCAAGACTATTTAAGG - Intergenic
1085836129 11:79958649-79958671 AAAGGACACAAGGGAATTTAGGG - Intergenic
1087172471 11:95064253-95064275 GGAGGAGTCAAAAGTATTTGAGG + Intergenic
1087944665 11:104143861-104143883 AACGCAGTTAAGATTATTTAAGG + Intronic
1088891939 11:114051530-114051552 AAAGGAGCATAAAGTATTTACGG + Intergenic
1089175369 11:116545163-116545185 CAAGGAGGCAGGAGGATTTATGG + Intergenic
1089225173 11:116913786-116913808 AAGTGATTCAAGAGAATTTAAGG - Intronic
1091191946 11:133703189-133703211 AAGGGTGACAAGAGCATTTAAGG - Intergenic
1093647450 12:21603716-21603738 AAAAGTGTCAAGACTATTGAAGG - Intronic
1094291827 12:28859695-28859717 AAAGAAGTCAAGAAGGTTTATGG + Intergenic
1094690636 12:32764990-32765012 CAAGGAGGGAAGATTATTTAAGG - Intergenic
1094794925 12:33960563-33960585 AGAGGAGTCAGGATTATTTGGGG - Intergenic
1095441113 12:42239051-42239073 AAAGGACTTATGAGTATATAGGG - Intronic
1095550352 12:43430749-43430771 AAAGCAGTCAATATGATTTAAGG + Intronic
1097033016 12:56103264-56103286 TAAGGAGTGAAGATCATTTACGG - Exonic
1098563908 12:71909423-71909445 AAAGCAGACAAAAGAATTTAAGG + Intronic
1098927589 12:76368468-76368490 AAATGAATGAAGAATATTTAAGG - Intronic
1098973702 12:76879987-76880009 AGAGGAGGCAATAGCATTTATGG - Intergenic
1099196119 12:79618106-79618128 AAAGAAGTGATGAGTATTTGAGG - Intronic
1099906645 12:88779177-88779199 GAAGGAAGGAAGAGTATTTATGG + Intergenic
1100007522 12:89911866-89911888 AATGGAGACAACAGTATATAAGG - Intergenic
1100162178 12:91873101-91873123 AAAGAAGTCAAGAATCTTGATGG + Intergenic
1100987603 12:100218496-100218518 GAAGGATTAAAGAGTATTTCCGG - Exonic
1102305998 12:111804966-111804988 AAAGCAGTGATGAATATTTATGG - Intronic
1102385506 12:112505793-112505815 AAATAAGTTAAGAGTTTTTAAGG - Intronic
1102567722 12:113807951-113807973 GGAGGAGTCAAGAGACTTTAAGG - Intergenic
1103318800 12:120078155-120078177 AAAGGAATCAAGAGGGTTTCAGG - Intronic
1103873114 12:124105611-124105633 AAATCAGTCAAGACTCTTTATGG - Intronic
1104408292 12:128537027-128537049 GGAGGAGTCATGAATATTTATGG + Intronic
1104500473 12:129280998-129281020 AAAGGAGTAAAGAGTATAGATGG - Intronic
1105074378 12:133262617-133262639 GGAGGAGTCATGAATATTTATGG + Intergenic
1108487350 13:50940499-50940521 AAAGGAGCCAATATTATTTTGGG - Intronic
1108852138 13:54743570-54743592 AAAGGAGGCAACAGCCTTTAGGG + Intergenic
1108977114 13:56460451-56460473 AAAGAAGTAAAGAATATTGAAGG - Intergenic
1109014288 13:56989325-56989347 AAATGAATCAATTGTATTTAAGG - Intergenic
1110190462 13:72724505-72724527 AAAGGAGTTAAGAGAATCTATGG - Intronic
1110295314 13:73857056-73857078 AAAGGAGTCAAGGAAAGTTAAGG + Intronic
1111367339 13:87266911-87266933 AAAGGAGTCATGAGTAATAAGGG - Intergenic
1112161565 13:96873798-96873820 AAAGGAGAGAAGGGTATTTCTGG - Intergenic
1113209615 13:107960317-107960339 ATAGGAGTCAAGAGAAATAAGGG + Intergenic
1113989548 13:114349754-114349776 GGAGGAGTCATGAATATTTATGG + Intergenic
1115015498 14:28607517-28607539 AATGTAGTTAAAAGTATTTAAGG - Intergenic
1115401806 14:32970136-32970158 AAAGGAATCAAATGTATTAATGG + Intronic
1115887144 14:37985150-37985172 AAAGGAATGAAGACTATTAAGGG - Intronic
1116557584 14:46332376-46332398 AAAGCACTCAAGACTATTTAAGG + Intergenic
1117548598 14:56812216-56812238 CCAGGAGTCAAGAGTTTCTAGGG + Intergenic
1119958205 14:78823758-78823780 GAAAGAGTCATGAATATTTACGG + Intronic
1120393023 14:83931656-83931678 TAAGGAGTCAAGGGAAGTTATGG - Intergenic
1122099658 14:99397511-99397533 AAAGGAGTCCTTAGGATTTAGGG - Intergenic
1122675313 14:103407908-103407930 AGAAGAGTAAAGAGTATTTCAGG - Intronic
1123904332 15:24907013-24907035 AAAGGAGGCAAGAGAACTGAAGG + Intronic
1125384764 15:39125519-39125541 AATGGAGAAAAGACTATTTAGGG - Intergenic
1126760627 15:51967083-51967105 AACGGAGTCTAGAAGATTTATGG + Intronic
1130877854 15:88029726-88029748 AAATAAGTGGAGAGTATTTATGG - Intronic
1131345563 15:91644681-91644703 GAGGGAGTCAAAAGTATTTGTGG + Intergenic
1131399528 15:92113369-92113391 AAAGGAATCAATAGAATTGATGG + Intronic
1131732521 15:95296790-95296812 AAATGAGTGAACAGTATTTATGG + Intergenic
1131736369 15:95337135-95337157 AAAAGAGGGAAGAGTATTTCCGG + Intergenic
1135935469 16:26776199-26776221 ACAGGAGTAAACAGTCTTTAAGG - Intergenic
1137858291 16:51818998-51819020 AAAGGAGTAAAGTGAATTAATGG - Intergenic
1138771482 16:59669551-59669573 AAAAGAGTCAAAAATATTTTGGG - Intergenic
1138918191 16:61493948-61493970 AGAGGAGTGAAGAGTATTTCCGG + Intergenic
1139906849 16:70372031-70372053 ACAGGAGACAAGTGCATTTAGGG + Exonic
1140303979 16:73785568-73785590 AAAGAACTCATGAGTATTCAGGG - Intergenic
1140777849 16:78266427-78266449 AAAGGAGCAGAGAGTATTTTAGG - Intronic
1143485832 17:7253153-7253175 AGAGGAGTGATGAGTATTTGGGG + Intronic
1145109968 17:20154082-20154104 AAAGAAGTAATGTGTATTTAAGG + Intronic
1146528421 17:33586546-33586568 AAGGGAGACAAGAATATGTAGGG - Intronic
1146848306 17:36199295-36199317 AAAGGAATCACGAGTATGGAGGG - Intronic
1150013220 17:61525832-61525854 AAACGAGTCATGTTTATTTAAGG + Intergenic
1152173724 17:78771917-78771939 AAAGCAGTGAAGGGTATGTAGGG - Intronic
1152773595 17:82186271-82186293 CAATGAGCAAAGAGTATTTACGG + Intronic
1152952264 17:83245144-83245166 GGAGGAGTCATGAATATTTATGG + Intergenic
1153252712 18:3138736-3138758 AGAGGAGTAAAGAGTAATAATGG - Intronic
1153409164 18:4774285-4774307 AAAGTAGGCCAGAGAATTTATGG + Intergenic
1154368161 18:13730502-13730524 AAAGAATTTAAAAGTATTTATGG + Intronic
1156304998 18:35869976-35869998 AGAGGAGGCAAGAGTAATAAGGG - Intergenic
1156899204 18:42281086-42281108 AAAGCAGTCAATATTTTTTAAGG + Intergenic
1157000929 18:43523657-43523679 AAAAGAGTCAAGGGTGATTAGGG + Intergenic
1157708736 18:49832797-49832819 AAAGGAGAGAAAGGTATTTAGGG + Intronic
1158021046 18:52842143-52842165 AAAGGAAGCAATGGTATTTAAGG - Intronic
1158985535 18:62812477-62812499 AGAGGAGTTAAGAGTAAATAGGG + Intronic
1160066753 18:75582834-75582856 AAAGGAGGCAGGAATGTTTAAGG + Intergenic
1160653878 19:250342-250364 GGAGGAGTCATGAATATTTATGG - Intergenic
1162656333 19:12133712-12133734 AAAGGAGTCAAGATAACTGAAGG + Exonic
1163079738 19:14929564-14929586 AAAGGAGTGAAGAAAACTTATGG - Intergenic
1164632305 19:29769567-29769589 AGAGGAGTCAAGGGGATTTTTGG - Intergenic
1165929053 19:39344167-39344189 AAGGGATTCTAGAGGATTTAGGG - Intronic
1166395690 19:42438906-42438928 CATGGACTCATGAGTATTTATGG - Intronic
1167110959 19:47460910-47460932 AAAAGATAAAAGAGTATTTATGG + Intronic
1168728254 19:58603367-58603389 GGAGGAGTCATGAATATTTATGG + Intergenic
925721801 2:6836725-6836747 TAAGGAGTCAAGAATATGTCAGG - Intergenic
926486384 2:13465188-13465210 AAAGGAGCAAAGACAATTTATGG + Intergenic
926884885 2:17587860-17587882 AAAGGGGTCAATAGTTTATATGG + Intronic
927378935 2:22454725-22454747 TAAGGAGTCCAAAGAATTTAGGG + Intergenic
929007024 2:37405691-37405713 CAAGGAGTCAAGTTTCTTTATGG + Intergenic
929848615 2:45559163-45559185 GAAGGAATCAAGAGTAGATATGG - Intronic
930072584 2:47379729-47379751 AAAGGAATTAAAAATATTTAAGG - Intronic
930581636 2:53218171-53218193 AAAGGAATCAAGAGTACTTGGGG - Intergenic
930974168 2:57434724-57434746 AAAGGACTTAACAGTATTTTCGG - Intergenic
931134932 2:59387916-59387938 ATAGGACTCAAGAGAATTAAGGG - Intergenic
931909780 2:66886335-66886357 CATGGATTCAAGAGTACTTAGGG + Intergenic
932999292 2:76901915-76901937 AAAGGAATTAAGATTATATATGG - Intronic
936570299 2:113607643-113607665 GGAGGAGTCATGAATATTTATGG - Intergenic
938786921 2:134638492-134638514 AGAAGAGTCAAGAGGATTAAAGG + Intronic
939337722 2:140852345-140852367 AAAGACGTCAAGACTTTTTAAGG + Intronic
939492571 2:142894184-142894206 AAATTAGGCAAGAGTATCTAAGG + Intronic
939634807 2:144569050-144569072 ATAAGAGTGAAGAGTATTTGTGG + Intergenic
939821683 2:146964933-146964955 AAAGTAGTTAGGAATATTTATGG + Intergenic
940091533 2:149924832-149924854 AAATGAGGCATGTGTATTTAGGG + Intergenic
940684791 2:156833645-156833667 AAAGGTGTCAAGATAATCTACGG - Intergenic
940693191 2:156945957-156945979 AAAGGATTCATGACAATTTATGG - Intergenic
941216620 2:162717894-162717916 ATAGGTGTCCAGAGTTTTTAGGG - Intronic
941499760 2:166258123-166258145 AAAGGAGTCAAGATTCTTATTGG + Intronic
941822174 2:169854814-169854836 AAAGCAATAGAGAGTATTTAAGG + Intronic
943019776 2:182559092-182559114 TAAGGAGTCAAGATAAATTAAGG - Intergenic
943265519 2:185726726-185726748 AACAGAGTCAAGGGTTTTTATGG + Intergenic
943512638 2:188844835-188844857 AAGGGAGTCAAGAGGACTCAAGG + Intergenic
944129357 2:196330383-196330405 AAAGAAGTCAACAGAATTGAAGG + Intronic
944153225 2:196584251-196584273 AGATGAGTCTAGGGTATTTATGG + Intronic
944555198 2:200881458-200881480 AGAGGAGGCAACAGTATTTGGGG - Exonic
945767101 2:213994667-213994689 AAAGCAGTCATGAATATGTAAGG - Intronic
947074628 2:226329102-226329124 AAAGGAGTCAACAGTAGTCATGG + Intergenic
947336362 2:229089412-229089434 AAAGGAGTCTAGTCTATTCAAGG - Intronic
947422324 2:229952248-229952270 CAAGGAATGAAGAGGATTTAAGG - Intronic
948684433 2:239661190-239661212 AAAGAAGTCAACAGTTTTAATGG + Intergenic
949088515 2:242179008-242179030 GGAGGAGTCATGAATATTTATGG + Intergenic
1169160324 20:3372175-3372197 AAAGGAGGCAAGAGCCTTTCTGG + Intronic
1169726659 20:8741130-8741152 TAAGGAATCAAGAATATTCAGGG + Intronic
1169763658 20:9125066-9125088 GATGGAGTCAAGCGTATTTCAGG - Intronic
1170233448 20:14075622-14075644 AAAAGATTCAAGAGAATTAAAGG - Intronic
1170648548 20:18218150-18218172 AATGGTTTCAAGTGTATTTATGG + Intergenic
1173092714 20:39989145-39989167 CAAGGAGTCAATAGCATTTCAGG + Intergenic
1173266916 20:41492261-41492283 AAAGCAGAAAACAGTATTTATGG + Intronic
1178134465 21:29611456-29611478 TAAGGAGTTAAGTGTATTTTTGG + Intronic
1178254301 21:31037466-31037488 AAGGCAGTCAAGAATATTTGTGG - Intergenic
1178442136 21:32607204-32607226 AAAGGAAACAAGCGTATTTGGGG - Intronic
1180263678 21:46694969-46694991 GGAGGAGTCATGAATATTTATGG + Intergenic
1180714833 22:17864759-17864781 AAAGGAGTCCAGAGGGTTTTGGG + Intronic
1181784887 22:25219839-25219861 TAAGGATTCAAGAGAAGTTAGGG + Intronic
1181902934 22:26170234-26170256 AAAGGAGTCAAGGGTTTCTGTGG - Intronic
1183223513 22:36532856-36532878 AAAGAAGTTCAGTGTATTTAAGG - Intergenic
1185429908 22:50803329-50803351 GGAGGAGTCATGAATATTTATGG + Intergenic
949630156 3:5917713-5917735 AAAGGAGTCAAGAGGAAGAATGG - Intergenic
949704919 3:6805448-6805470 TAAGCAGTCAAGAATATTTGTGG - Intronic
951829264 3:26906082-26906104 AAAGTAGTCAAGAGAATCAAAGG + Intergenic
952169228 3:30787371-30787393 AGAGGAGTCAATATTATATAGGG - Intronic
952544823 3:34407512-34407534 AAAGCAGGAAAGATTATTTAGGG - Intergenic
952641141 3:35598020-35598042 AATGGAGCCAAGAGAGTTTATGG + Intergenic
954790794 3:53131870-53131892 AAAGGGGTACAGAGTATTTTAGG - Intergenic
957526497 3:81385332-81385354 AAAGCACTCAAGGCTATTTAAGG + Intergenic
957633784 3:82755120-82755142 AAAGCAGGGAAGTGTATTTAAGG - Intergenic
957787987 3:84905604-84905626 AAATGAGTCCAGGGTTTTTATGG - Intergenic
958159816 3:89804243-89804265 AAAGCAGTTAATAGTGTTTATGG - Intergenic
961150201 3:124631487-124631509 AAAAGAGTCAAGGGTATCTCAGG - Intronic
964798848 3:160530644-160530666 AAAGGAATCAAGTGAATTTTTGG + Intronic
965145857 3:164902989-164903011 AAAGGACACAAAAATATTTAAGG + Intergenic
968291016 3:197539827-197539849 TCAGGAATCAAGAGTTTTTAAGG - Intronic
969935975 4:10681682-10681704 AAACTAGTCAACAGCATTTAAGG - Intronic
972138007 4:35917048-35917070 AAATCAGTCAAGAGTAAATAAGG - Intergenic
972645285 4:40962179-40962201 AAAGGAGGCAGGGGTATTTGTGG + Intronic
972845885 4:42988778-42988800 AAATGAGGCAAGTGTATATATGG + Intronic
974138980 4:57859246-57859268 AAATGTGTCAAGAGTGTCTAGGG - Intergenic
974374604 4:61060665-61060687 AAAGGAGAAAATAGTGTTTAAGG - Intergenic
975446777 4:74474724-74474746 AAAGGTGCCAAGAATATTTCTGG - Intergenic
976218662 4:82738591-82738613 GAAGGAGTGAAGAGTAGGTATGG - Intronic
976236425 4:82901664-82901686 TAAGGAGTTTAGAGTATGTATGG + Intronic
978853962 4:113371948-113371970 AAAGTGGTCAATAGTATTTTAGG - Intronic
979452990 4:120894377-120894399 AAAGGAGTGAAGAGCAGTGAAGG - Intronic
979529217 4:121751106-121751128 AAAGTAGTCTAGAGTAGGTATGG + Intergenic
980435867 4:132772812-132772834 AAAGGAGGCAACAAGATTTATGG + Intergenic
980860687 4:138496269-138496291 TAAGGATTCAAGAGAATTTATGG - Intergenic
981798067 4:148621434-148621456 AAAAGAGTGAAGAAAATTTAAGG + Intergenic
983591237 4:169413714-169413736 AATGGAGACAACAGTATTAATGG + Intronic
983606399 4:169590854-169590876 AAAGAATTCAAGAATATTTAGGG + Intronic
983873555 4:172850390-172850412 AAAGGAGTCCAGAATATATAGGG + Intronic
984459439 4:180015028-180015050 AAAAGAATAAAGACTATTTAAGG + Intergenic
985157072 4:187000638-187000660 AATAGAATCAAAAGTATTTATGG - Intergenic
985466344 4:190200215-190200237 GGAGGAGTCATGAATATTTATGG + Intergenic
986344845 5:6824793-6824815 AAAGGAGTAAATGGCATTTATGG - Intergenic
986403481 5:7402081-7402103 AGAGCAGTCACCAGTATTTAAGG - Intronic
986719626 5:10551718-10551740 ACAGGAATCAAGAGAATTTCTGG + Intergenic
987145799 5:14990314-14990336 AAATGAGTCAAGAGTAGGGAGGG - Intergenic
987699517 5:21378965-21378987 AAAAGTGTCAATAGTATTGAAGG - Intergenic
987831575 5:23102360-23102382 AAAGAAGTCATCAGAATTTAAGG + Intergenic
988638444 5:33014240-33014262 AAAGGAATGAAGAATATCTATGG - Intergenic
988957609 5:36334514-36334536 AAAGAATCCAAGAGGATTTATGG + Intergenic
989789814 5:45384150-45384172 AAAGGAAACATGAGTATATACGG - Intronic
990825706 5:59894852-59894874 AAAGAAGCCAAGAGGATTTCAGG + Intronic
991489573 5:67169277-67169299 AAATGAGTAAAGAGTACTTAAGG + Exonic
992121083 5:73593165-73593187 AAAGCTTCCAAGAGTATTTATGG - Intergenic
993854945 5:93062496-93062518 AAAGGAGGTAAGAGTGCTTATGG + Intergenic
993921146 5:93804039-93804061 AAAGGAATCAAATGTATTTATGG - Intronic
994017462 5:94984224-94984246 AAATTAGTCCAGAGCATTTAAGG - Intronic
995314622 5:110754414-110754436 AAAAGAGTCAAGATTATAGAGGG - Intronic
995359110 5:111273577-111273599 AAAGCAGTCAAGAGGAATTTTGG - Intronic
995725127 5:115173870-115173892 AATGAAGGCAAGAGTATTGAAGG - Intronic
996753389 5:126911724-126911746 AAAGGATTCACCAATATTTAGGG + Intronic
999051795 5:148531135-148531157 AAAGGAGTTAAGACTTTTGAGGG + Intronic
999873226 5:155773749-155773771 CAAGGGTTGAAGAGTATTTAAGG + Intergenic
1001784837 5:174403152-174403174 AAAGAAGTCAAGGGTAATTTGGG - Intergenic
1002746295 5:181476546-181476568 GGAGGAGTCATGAATATTTATGG + Intergenic
1003834814 6:10059363-10059385 AAAGGATTCAAAAGAATTTTAGG + Intronic
1003927588 6:10890945-10890967 AAAGGTGTCAAGAACATTCATGG - Intronic
1004990291 6:21129867-21129889 AAAGGAGTCAGGAATTTATAAGG + Intronic
1005329695 6:24737684-24737706 TAAGGAGTTAAGAATATTCATGG + Intergenic
1006479640 6:34281427-34281449 AAGGAAGTCAAGAATATTTCAGG - Exonic
1008755307 6:54788295-54788317 AAAGGACTCAAGAGGCTTAATGG - Intergenic
1009795349 6:68458898-68458920 GTAGGAGTCATGAATATTTAAGG - Intergenic
1010656129 6:78514018-78514040 ACAGGTGGCAGGAGTATTTAAGG + Intergenic
1011748361 6:90430507-90430529 AAAGGAGTGCTGAATATTTATGG - Intergenic
1012033111 6:94098422-94098444 AAAAGAGTCATTAGAATTTAGGG - Intergenic
1012783643 6:103595053-103595075 AAAGGAGTCAAGATTATCCTGGG - Intergenic
1012800123 6:103815616-103815638 AAAGGTGTAAAGAGTACCTAAGG - Intergenic
1013751466 6:113411861-113411883 AAAGAATCCAAAAGTATTTAAGG - Intergenic
1014319237 6:119906179-119906201 AAAGGTCTCATGAGTGTTTATGG + Intergenic
1014858460 6:126432214-126432236 ACAGGTGCCATGAGTATTTATGG - Intergenic
1016290923 6:142527323-142527345 TAAGGAGTCAATTGTATTGATGG + Intergenic
1016304986 6:142674630-142674652 AAAGGAGACAGGAGGAATTAAGG - Intergenic
1017848190 6:158277967-158277989 AAAGAAGTCAAGAGAATTCCAGG - Intronic
1018714991 6:166525318-166525340 AAAGGAGTCGAGCACATTTAAGG + Intronic
1018798626 6:167206291-167206313 AAAGGAGTCAAGACTGGCTAGGG - Intergenic
1018814083 6:167317874-167317896 AAAGGAGTCAAGACTGGCTAGGG + Intergenic
1020632819 7:10660682-10660704 GAGGGAGGAAAGAGTATTTAAGG + Intergenic
1020650262 7:10866376-10866398 AAAGGATTCATGGATATTTATGG + Intergenic
1021876051 7:25050392-25050414 AAAGAAGCAAAGAATATTTAGGG - Intergenic
1023505117 7:40891128-40891150 AAAGGAGTCAAGAAAGTCTATGG + Intergenic
1029299565 7:99568757-99568779 AAACGAATCAAGAGGATCTATGG - Intronic
1029666172 7:101996598-101996620 AAAGGAGTCAGGCATAATTAAGG - Intronic
1029964228 7:104721727-104721749 TAAGGGGCCAAGAGTATTTAAGG + Intronic
1030822550 7:114112784-114112806 AAAGGAGTTAAGAGAACTTGTGG + Intronic
1033503026 7:141972934-141972956 AAAGGAGACAAGAGACTTGAGGG + Exonic
1033854149 7:145536267-145536289 AAAGGAGGCAAAAGTTTTGAAGG + Intergenic
1034892894 7:154856209-154856231 AAAGAAGTAAAAAGCATTTAAGG - Intronic
1035496668 7:159333641-159333663 GGAGGAGTCATGAATATTTATGG + Intergenic
1035513410 8:210132-210154 GGAGGAGTCATGAATATTTATGG - Intergenic
1036650932 8:10643548-10643570 AAAGGAGAGAAAAGCATTTAAGG + Intronic
1038572462 8:28674748-28674770 AAAGGAGACATCAGAATTTAGGG - Intronic
1040697341 8:50016526-50016548 AAAGGAGACAAGAGCCTTGAAGG - Intronic
1043196919 8:77306731-77306753 AATGGAGTCTAGAGTAGTCAGGG + Intergenic
1043393670 8:79815707-79815729 GAAAAAGTCAAGAGTGTTTATGG + Intergenic
1047580878 8:126213984-126214006 AAGAGAGGCAAGACTATTTAAGG + Intergenic
1047780346 8:128106051-128106073 AAAGGACTCAGGAGGCTTTAGGG - Intergenic
1048250211 8:132859521-132859543 CAAGAAGCCAAGAGCATTTAGGG - Intergenic
1049482988 8:142835602-142835624 ATAGAAGTCAAGAATATTTTGGG - Intronic
1050231873 9:3534931-3534953 AAAAGAGTCAAGAGTGAATATGG - Intergenic
1050419796 9:5451556-5451578 ACAGTCGTCAACAGTATTTAAGG + Intronic
1053108341 9:35433736-35433758 AAAGAATTCAACAGTATTTTTGG + Intergenic
1056182108 9:84095013-84095035 AAAGTAGTTATGAGTATTTCTGG + Intergenic
1058786120 9:108389817-108389839 AAAGGACACAAGAGAATTTTGGG + Intergenic
1058863575 9:109140864-109140886 ATAGGAGTTAAGAGTATTCATGG + Intronic
1059739827 9:117139069-117139091 CTTGGAGTCAAGAGTGTTTATGG + Intronic
1060638314 9:125217690-125217712 AAAGGAGTCCTGAGCATTTGAGG - Intronic
1186011545 X:5139920-5139942 AGAGCATTCAAGAGTACTTATGG + Intergenic
1186234819 X:7496445-7496467 AAAGAAGCCAAGACTATTTTTGG - Intergenic
1187095526 X:16143673-16143695 AAAGGAGTAAGGAGTCTTTGTGG - Intronic
1187486408 X:19708351-19708373 AAAGGGGTGGAGAGTATTTGTGG - Intronic
1187829529 X:23366659-23366681 AAAGAAGTGCAGAGTATTAAGGG - Intronic
1188528637 X:31113289-31113311 AAAGGAGTCAAGAGTATTTAAGG + Intronic
1193658935 X:84233368-84233390 AAAGGAGTCAAAAGGATTTAAGG - Intergenic
1196652644 X:118184020-118184042 AAATGAGTATAAAGTATTTAAGG + Intergenic
1197695160 X:129541495-129541517 CAATCAGTCAACAGTATTTACGG - Intronic
1198107897 X:133478398-133478420 AATGGAGTGAAAAGCATTTATGG - Intergenic
1199014428 X:142796810-142796832 AAAGGTGTCAAAAGTGTTCATGG + Intergenic