ID: 1188528777

View in Genome Browser
Species Human (GRCh38)
Location X:31114605-31114627
Sequence GAAATCGCCTGGGCCAATAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 33
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 30}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188528777_1188528785 3 Left 1188528777 X:31114605-31114627 CCAGTATTGGCCCAGGCGATTTC 0: 1
1: 0
2: 0
3: 2
4: 30
Right 1188528785 X:31114631-31114653 GTGACAGGTGGTGTTACCTTGGG 0: 1
1: 0
2: 0
3: 6
4: 122
1188528777_1188528784 2 Left 1188528777 X:31114605-31114627 CCAGTATTGGCCCAGGCGATTTC 0: 1
1: 0
2: 0
3: 2
4: 30
Right 1188528784 X:31114630-31114652 TGTGACAGGTGGTGTTACCTTGG 0: 1
1: 0
2: 0
3: 8
4: 134
1188528777_1188528786 8 Left 1188528777 X:31114605-31114627 CCAGTATTGGCCCAGGCGATTTC 0: 1
1: 0
2: 0
3: 2
4: 30
Right 1188528786 X:31114636-31114658 AGGTGGTGTTACCTTGGGCAAGG 0: 1
1: 1
2: 5
3: 36
4: 251
1188528777_1188528781 -9 Left 1188528777 X:31114605-31114627 CCAGTATTGGCCCAGGCGATTTC 0: 1
1: 0
2: 0
3: 2
4: 30
Right 1188528781 X:31114619-31114641 GGCGATTTCCCTGTGACAGGTGG 0: 1
1: 0
2: 0
3: 7
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188528777 Original CRISPR GAAATCGCCTGGGCCAATAC TGG (reversed) Intronic
917789010 1:178487560-178487582 GAAATCCCCTGGACAATTACAGG + Intergenic
918310640 1:183282992-183283014 GAAACCACCTGAGCCAATTCAGG + Intronic
920695850 1:208180888-208180910 GACATGGCCAGGGCCAATAGCGG - Intronic
1079897781 11:26144484-26144506 TAAATCACATGGGCCACTACTGG + Intergenic
1086096421 11:83054461-83054483 GAAATAACCTGGTCTAATACAGG + Intronic
1102143445 12:110636082-110636104 GAAATCGCCTGGGCAAGCAATGG + Intronic
1114571661 14:23673471-23673493 GAAATCCCCTGGGAGAATTCAGG - Intergenic
1119789583 14:77337968-77337990 GAGATCCCCTGGGCCAAGACAGG - Exonic
1120461804 14:84806452-84806474 CAAATAGTCTGGGCCAATCCTGG - Intergenic
1152509064 17:80772888-80772910 GAACTCGCCTGGGGCTGTACAGG + Intronic
930189588 2:48443604-48443626 AAAATGGCCTGGTCCAATAGGGG - Intronic
932656405 2:73614434-73614456 GAAATAGCCTGTTCCAATGCTGG - Intergenic
1172962314 20:38807388-38807410 GAACACTCCTTGGCCAATACTGG + Intronic
1183175701 22:36223399-36223421 GAAATCTCCTGGGCCCTCACAGG - Intergenic
954637784 3:52080774-52080796 GAACTCGCCTGGGTCACTGCTGG + Intronic
961274256 3:125714649-125714671 GTTATCGCCTGTGCCAATAGGGG + Intergenic
967269778 3:187723788-187723810 TGAATGGCCTGGGTCAATACAGG + Intronic
971060402 4:22962337-22962359 GAAATCTCCTGGGCCGAGATAGG - Intergenic
973259694 4:48150301-48150323 GAAATTGCCTGGACCTAGACGGG - Intronic
994182543 5:96783264-96783286 GAAATGACCTGTGACAATACTGG - Intronic
997450155 5:133976117-133976139 GAAATGGACTGAACCAATACTGG + Intronic
1000877667 5:166660884-166660906 GACAAAGCCTGGGCCAAAACTGG + Intergenic
1006175454 6:32118689-32118711 GAAATGGCCTGGGCCAAAGCAGG + Intronic
1031279464 7:119778958-119778980 GAGACCGCCTTGGCCAACACAGG - Intergenic
1032440106 7:131936123-131936145 GAAAAGCCCTGGGCCAATCCAGG - Intergenic
1037355699 8:18017523-18017545 GAAATAGTCTGGCCCAACACAGG - Intronic
1044743475 8:95350763-95350785 GAAATCTCTTGGGCAAATGCTGG + Intergenic
1047969101 8:130069809-130069831 GAAATTGCCTGGGGCAAAAATGG + Intronic
1049591968 8:143466746-143466768 GGAATAGCCTGGGGCAAGACTGG - Intronic
1186916852 X:14232200-14232222 GAATTTGCCTGGGCAAATCCTGG - Intergenic
1188528777 X:31114605-31114627 GAAATCGCCTGGGCCAATACTGG - Intronic
1190555478 X:51629973-51629995 GAAATCCCATGGGCCAAAATTGG - Intergenic
1190874588 X:54450563-54450585 GAAATAGACAGGGACAATACAGG + Intronic