ID: 1188533055

View in Genome Browser
Species Human (GRCh38)
Location X:31163690-31163712
Sequence GAGGCGTGACCTTGAATGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 107}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188533055_1188533064 24 Left 1188533055 X:31163690-31163712 CCTCTCATTCAAGGTCACGCCTC 0: 1
1: 0
2: 0
3: 5
4: 107
Right 1188533064 X:31163737-31163759 CTTCTCTCTCCTGCCTCCTGTGG 0: 1
1: 0
2: 9
3: 85
4: 714
1188533055_1188533065 25 Left 1188533055 X:31163690-31163712 CCTCTCATTCAAGGTCACGCCTC 0: 1
1: 0
2: 0
3: 5
4: 107
Right 1188533065 X:31163738-31163760 TTCTCTCTCCTGCCTCCTGTGGG 0: 1
1: 0
2: 5
3: 94
4: 611

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188533055 Original CRISPR GAGGCGTGACCTTGAATGAG AGG (reversed) Intronic
900568871 1:3348644-3348666 GAGACATGACCTTGAATGTCAGG + Intronic
905994710 1:42371553-42371575 GGGGTGTGAGCTTGAATAAGAGG + Intergenic
909722129 1:78785913-78785935 CAGCTGTGACCTTGAAGGAGAGG + Intergenic
911596822 1:99807328-99807350 GATGAGAGACCTTGAAGGAGAGG - Intergenic
912392266 1:109311615-109311637 GAGCAGTGACCCTCAATGAGGGG + Exonic
921956540 1:220990783-220990805 GAGAAGAGACCTTGAATGTGAGG + Intergenic
922122891 1:222691138-222691160 GAGCCATGACCTAGGATGAGAGG + Intronic
923048159 1:230370352-230370374 GAAGCGTGACCTTGAGAAAGGGG - Intronic
924383620 1:243483972-243483994 GAGGCGAGACCATGAACGTGGGG - Intronic
1066617859 10:37314068-37314090 GAGGCCTGGTTTTGAATGAGAGG + Intronic
1067913532 10:50371939-50371961 GAGGTGTGACCTTTAAGAAGTGG - Intronic
1068010980 10:51450797-51450819 AAGGCTGGAACTTGAATGAGTGG + Intronic
1068130334 10:52888653-52888675 GAGGCGGAACCTGCAATGAGCGG - Intergenic
1072916156 10:99538451-99538473 GAAGCTTGGCCTTGAAGGAGAGG - Intergenic
1075832588 10:125423999-125424021 ACTGCGTGACCTTGAACGAGTGG + Intergenic
1076705284 10:132298085-132298107 GAAGCGTGACCTTCAGGGAGTGG - Intronic
1077498446 11:2897924-2897946 GAAGGGTGACCTGGAAGGAGCGG - Intronic
1078415104 11:11158276-11158298 GAGGCCAGACCTTGCAGGAGGGG + Intergenic
1079109951 11:17599802-17599824 GAGCCGTGACCCGGAATGGGAGG + Intronic
1080950160 11:37022449-37022471 AAGGCGTGACCTTGAGTCAGGGG + Intergenic
1085582212 11:77663089-77663111 GAGGCATCACCTTGAATAACGGG + Exonic
1090414859 11:126533961-126533983 GAAGCGTGACCTGGAATGGCAGG + Intronic
1090659586 11:128872090-128872112 GAGGCGTGTCCTGGAGAGAGGGG + Intergenic
1090740251 11:129653383-129653405 GAGTGGTTACCTTGGATGAGAGG + Intergenic
1091832074 12:3557084-3557106 GAGGTGAGTCCTGGAATGAGAGG + Intronic
1092735662 12:11580185-11580207 GAGGCGTGACACTGAGTAAGTGG + Intergenic
1092766761 12:11860115-11860137 AAGGCGTGACCTGCACTGAGGGG - Intronic
1097018868 12:56006231-56006253 GAGGGATGACTTTGAATGGGAGG - Intronic
1098407565 12:70142112-70142134 CAGGCGTGCCCTTGTTTGAGTGG + Intergenic
1100333737 12:93610287-93610309 GAGGGGTGTCCTGGGATGAGGGG - Intergenic
1101730663 12:107424556-107424578 GAGGTGTGGCTTTGAATGCGTGG + Intronic
1104180339 12:126373600-126373622 GAGGGGTGACTTTGAATAGGAGG + Intergenic
1106417396 13:29557777-29557799 GAGGAGTGAATGTGAATGAGGGG + Intronic
1108550729 13:51541152-51541174 GAGATGTGACTTTGAAGGAGAGG + Intergenic
1112125030 13:96455663-96455685 AAGGCTTGAACTTGAATAAGTGG + Intronic
1119978628 14:79054362-79054384 GAGGCTTGCCCTTGGATGAATGG + Intronic
1122011475 14:98752755-98752777 GAGGTGCTTCCTTGAATGAGGGG - Intergenic
1125334184 15:38611577-38611599 GAGGCTGGACCCTGAAGGAGAGG - Intergenic
1129444702 15:75608778-75608800 GACGCTTGACCTTGAAGGGGAGG + Intronic
1129739805 15:77984753-77984775 GAGGGGTGACCTGGGGTGAGGGG - Intronic
1136171469 16:28492241-28492263 GAGCCGTGACCTTAGATCAGTGG + Intronic
1136554303 16:30998626-30998648 TGGGTGTGACCTTGAGTGAGTGG - Intronic
1138970412 16:62136079-62136101 GGGGCATGACCTTGACTAAGAGG + Intergenic
1140260247 16:73371855-73371877 GGGCCGAGACCTTGAATGGGAGG - Intergenic
1140458526 16:75118860-75118882 GAGGGGTGACTTTGAAAGAATGG - Intergenic
1141892035 16:86932450-86932472 GAGGTGTGACCGTGAGTGTGAGG + Intergenic
1143582141 17:7833878-7833900 GAGGCGTGGCCCTGAACGAATGG + Intergenic
1143997256 17:11017542-11017564 CACACATGACCTTGAATGAGAGG + Intergenic
1146499483 17:33352258-33352280 GATGGGTGACCTGGAAGGAGTGG - Intronic
1147562414 17:41517241-41517263 GAGGGGTGATTTTCAATGAGGGG - Intronic
1152497621 17:80685149-80685171 GAGGTGCGACCCTGAATGAGGGG - Intronic
1162021261 19:7869590-7869612 GAGGCGGGACCTTGAGGCAGGGG - Intronic
1165481286 19:36066018-36066040 GAGTCGTGATCGTGACTGAGTGG + Intronic
1168593298 19:57654198-57654220 GAGGGATGACCAGGAATGAGTGG - Intergenic
935433445 2:103002914-103002936 CAGCTTTGACCTTGAATGAGTGG - Intergenic
936167888 2:110139806-110139828 GGGGCGTGCCTTTGAAGGAGAGG + Intronic
936973077 2:118193204-118193226 GAGGTGGGAACATGAATGAGGGG + Intergenic
940234233 2:151492501-151492523 CAGGAGAGACCGTGAATGAGTGG + Intronic
945852353 2:215024041-215024063 GAGGCGTGAACTTGAAAGACAGG - Intronic
947711334 2:232318104-232318126 GAGGCCTGGCCTTGCAGGAGTGG - Intronic
947855292 2:233319793-233319815 TAGTCCTGAGCTTGAATGAGGGG + Intronic
948608432 2:239151476-239151498 CAGCCGTGACCTTGAGTGACTGG + Intronic
1169210969 20:3766182-3766204 CAGGCGTGAGCTTTAATGGGAGG - Intronic
1172095025 20:32456386-32456408 GAGGAGTCATCTGGAATGAGAGG + Exonic
1172393291 20:34581192-34581214 GTCACGTGACTTTGAATGAGTGG + Intronic
1175472868 20:59245178-59245200 GTGGCCTGAATTTGAATGAGAGG - Intronic
1178398295 21:32261782-32261804 GAGGTGAGAGCTTGAAAGAGAGG + Intergenic
1182003475 22:26940046-26940068 GCGGCGTGACCTTGGACAAGTGG - Intergenic
1183748534 22:39705995-39706017 GTTACGTGACCTTGAATGAACGG + Intergenic
950364202 3:12471610-12471632 GGGCAGTGAACTTGAATGAGTGG - Intergenic
955862408 3:63345522-63345544 GAGGGGTGACCTCCAGTGAGGGG + Intronic
958021567 3:88003732-88003754 GAAGAGTTTCCTTGAATGAGGGG - Intergenic
958953593 3:100442650-100442672 GAGGGGTGACTTTGAAAGAATGG + Intronic
958954382 3:100451489-100451511 GAGGGGTGACTTTGAAAGAATGG + Intronic
968322436 3:197781812-197781834 CAGGGATGACGTTGAATGAGCGG + Exonic
968473829 4:793784-793806 GAGGCAAGACCTTCAAGGAGGGG - Intronic
968616727 4:1580763-1580785 GAGGCGGGGCCTTGAGTGGGAGG - Intergenic
968616743 4:1580800-1580822 GAGGCGGGGCCTTGAGTGGGAGG - Intergenic
969023083 4:4151179-4151201 GAGCCCTGCCCTTGAAAGAGGGG - Intergenic
969620175 4:8275002-8275024 GAGGCGTCATCTTGCCTGAGTGG - Intronic
971273101 4:25170187-25170209 GAGGAGTGGACTGGAATGAGGGG - Intronic
982576197 4:157112869-157112891 GAGGGGTGACCTTGATGGTGGGG + Intronic
986318654 5:6609686-6609708 GAGAGCTGACCCTGAATGAGGGG - Intronic
991184606 5:63792740-63792762 GAGGCGGAAGCTTCAATGAGTGG + Intergenic
997254640 5:132418876-132418898 GAGGCCTGACCTTGTCTAAGGGG - Intronic
997452004 5:133991244-133991266 GAGGCAAGACCCTGAATGTGGGG + Intronic
999501207 5:152148343-152148365 GAGGAGTAACCTTGGAGGAGGGG + Intergenic
1001568185 5:172713925-172713947 GAGGCGGGACCCTGAGGGAGGGG + Intergenic
1004254352 6:14049368-14049390 GAGGCTGGACCTACAATGAGAGG + Intergenic
1006833707 6:36984702-36984724 GAGGAGTGAGCTGGAATGAAGGG - Intronic
1015998160 6:139015648-139015670 GAGGGATGACCGTGACTGAGGGG + Intergenic
1019626740 7:2019663-2019685 GAGGCGTGGCCTTGTGTGGGGGG - Intronic
1019626751 7:2019694-2019716 GAGGCGTGGCCTTGCGTGGGTGG - Intronic
1022836284 7:34118518-34118540 GAAGCATTACCTTGGATGAGTGG + Intronic
1025195258 7:56927570-56927592 GAGGCCTGACGTTGGATGACAGG - Intergenic
1025676694 7:63649373-63649395 GAGGCCTGACGTTGGATGACAGG + Intergenic
1026528781 7:71179160-71179182 GAGGGGTGACTTTGAATAAATGG - Intronic
1034439692 7:151080439-151080461 GCGGCGTGACCTTGGACAAGTGG + Intronic
1042926456 8:73972596-73972618 CAGGCGTAACCCTAAATGAGAGG - Intronic
1045920525 8:107523571-107523593 GGTGCGTGACCTTGTATGTGGGG - Intergenic
1046827039 8:118702749-118702771 GGTGTGTGACCTTGGATGAGTGG + Intergenic
1049478652 8:142809591-142809613 GAGGCGGGAACTTGAGAGAGAGG + Intergenic
1051167368 9:14278551-14278573 GAGGCGAGCCCCTGAGTGAGCGG + Intronic
1053016067 9:34662961-34662983 GAGGAGTGACTTTGAATGTGTGG - Intronic
1055260985 9:74433418-74433440 GATGGGTGAGCTTGACTGAGTGG + Intergenic
1056888127 9:90463722-90463744 GAGGAGAGACCTTGAAAGTGTGG + Intergenic
1059375821 9:113880581-113880603 CAGGCGAGACCTTGAATCATGGG + Intronic
1059411078 9:114132688-114132710 GCTGCGTGACCTTGAGCGAGTGG + Intergenic
1061886713 9:133594764-133594786 GAGAAGTGACCCTGAGTGAGGGG + Intergenic
1187661857 X:21556426-21556448 GAATCCTGACCTAGAATGAGAGG + Intronic
1188533055 X:31163690-31163712 GAGGCGTGACCTTGAATGAGAGG - Intronic
1197028896 X:121789728-121789750 GAGGGATGACTTTGAATGAGAGG - Intergenic
1202099939 Y:21296765-21296787 GCGATGTGGCCTTGAATGAGTGG - Intergenic