ID: 1188537661

View in Genome Browser
Species Human (GRCh38)
Location X:31215335-31215357
Sequence GACTCAGATGCCTCTTGGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 156}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188537654_1188537661 24 Left 1188537654 X:31215288-31215310 CCTACGGAGAGGTTTAAAATAAG 0: 1
1: 0
2: 0
3: 5
4: 110
Right 1188537661 X:31215335-31215357 GACTCAGATGCCTCTTGGGGTGG 0: 1
1: 0
2: 0
3: 10
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188537661 Original CRISPR GACTCAGATGCCTCTTGGGG TGG Intronic
900131604 1:1089596-1089618 GACTCAGGGGCCTCGTGAGGAGG - Intronic
900719867 1:4168664-4168686 CACTAAGAAGCCTCTGGGGGAGG + Intergenic
902995093 1:20218303-20218325 GCCTCAGTTTCCTCTTGGTGAGG + Intergenic
903810379 1:26031766-26031788 AAAGCAGATGTCTCTTGGGGAGG + Intronic
904429560 1:30453265-30453287 GACACAGGGTCCTCTTGGGGAGG + Intergenic
904484292 1:30814656-30814678 GACTCAGATGGTGCTGGGGGTGG - Intergenic
904888420 1:33759699-33759721 GACTCAGATCCCTCTTGGCATGG + Intronic
905013663 1:34762928-34762950 GACTCAGAGGCATGTTAGGGTGG - Exonic
916624105 1:166534976-166534998 GTCTCAGATTGCTGTTGGGGCGG - Intergenic
916661529 1:166926313-166926335 GACACAGCTGATTCTTGGGGTGG - Intronic
916740535 1:167643579-167643601 GCTTCATATGCCTCATGGGGAGG + Intronic
917156197 1:172001667-172001689 GTCTCACATTCCTCTTGGGATGG - Intronic
922181166 1:223234048-223234070 GACTCTGCTGCCTTTTGGGTAGG - Intronic
923600830 1:235401383-235401405 CACACAGATACCACTTGGGGAGG - Intronic
924857214 1:247885705-247885727 GCCTCAGACTCCTCTTGAGGAGG + Intergenic
1063236202 10:4119107-4119129 GTCTTAGTTTCCTCTTGGGGAGG + Intergenic
1063382690 10:5596154-5596176 GAGTCAGATGCCTTCGGGGGAGG - Intergenic
1063420667 10:5910527-5910549 GTCTCTCATGCCTCTTGGGTGGG + Intronic
1064328403 10:14372200-14372222 GAGTCAGATGCGTCTTAAGGAGG + Intronic
1066153799 10:32653211-32653233 GACTCAGGTTCCTCTTGCTGGGG + Intronic
1068713051 10:60155408-60155430 GACTCAGTTTCCTCTTGCTGGGG - Intronic
1072438192 10:95432339-95432361 TCATCAGATACCTCTTGGGGGGG - Intronic
1074799381 10:116983976-116983998 TACTCAGCTGCCTGTTGGGCTGG - Intronic
1076636459 10:131884766-131884788 GACACAGATACCTGCTGGGGAGG + Intergenic
1076875786 10:133214895-133214917 GACCCTGATGCCTCCTGGGCAGG - Intronic
1078011245 11:7574701-7574723 GACCCAGCTGCCCCTGGGGGTGG + Intronic
1078643137 11:13114460-13114482 GACTGAGGTGACTCTGGGGGAGG - Intergenic
1081965332 11:47165772-47165794 GACACAGAGGCATCTTGGAGAGG + Intronic
1083852761 11:65377615-65377637 CACTCAGAAGCCTCTTTGGTGGG - Intronic
1088640468 11:111868173-111868195 GACTATGATGCGTCTTGGTGTGG - Intronic
1089048167 11:115522000-115522022 CCCTCATGTGCCTCTTGGGGAGG - Intergenic
1089704705 11:120269544-120269566 GCCTGAGTTGCCTCTTGGGTGGG + Intronic
1091062575 11:132477456-132477478 GAGTGAGATGCTTCTTGGAGTGG + Intronic
1093963506 12:25301490-25301512 GAGTCAGAGACCTTTTGGGGAGG - Intergenic
1094055623 12:26266746-26266768 GAGACAGATGCCTCTTTGGAGGG + Intronic
1095961087 12:47834802-47834824 GAGGCAGGAGCCTCTTGGGGTGG + Intergenic
1097070250 12:56349341-56349363 TAAACAGAAGCCTCTTGGGGTGG - Intronic
1097076715 12:56400349-56400371 GATTCTGGTGCCTGTTGGGGTGG + Intergenic
1098042118 12:66362819-66362841 GACTCAGACGCCTCTGCGGCAGG - Intronic
1098994139 12:77098579-77098601 GCTTCAAAAGCCTCTTGGGGTGG - Intergenic
1104951201 12:132441292-132441314 GCCTCAGATTCCACGTGGGGTGG - Intergenic
1108750071 13:53439738-53439760 GCCTCAGCTGCCTCCTGGCGGGG + Intergenic
1112282678 13:98076477-98076499 GACTTAGCTGCCTCCTGGCGGGG - Intergenic
1113069553 13:106407253-106407275 GACTAAGATGACTCTTGCAGTGG - Intergenic
1118805052 14:69228862-69228884 GACACACAGGCCACTTGGGGAGG - Exonic
1119696023 14:76714068-76714090 GTCCCAGATGCCTCCAGGGGAGG + Intergenic
1121274705 14:92659577-92659599 GATTCAGAGCCCCCTTGGGGAGG + Intronic
1121814738 14:96920597-96920619 GTCACAGAGGCCTCTTGGTGTGG - Intronic
1123975463 15:25549529-25549551 GACTAAGATGTGTCTTGGTGTGG - Intergenic
1124877932 15:33613098-33613120 GGCTCAGAGGCCTCTGCGGGAGG - Intronic
1128291709 15:66483156-66483178 CCCTCATTTGCCTCTTGGGGAGG + Intronic
1130907623 15:88251648-88251670 AACTCAGCTGGCTCTTGGGTGGG - Intronic
1133168350 16:3964722-3964744 CACTCAGACCCCTCTTGGGGTGG + Exonic
1137349975 16:47705210-47705232 GAATCAGATGCCTGTTGAGTCGG + Intergenic
1138271729 16:55700367-55700389 GACTCTCATTCCTGTTGGGGTGG + Intronic
1138278514 16:55754503-55754525 GATTCAGGGGCTTCTTGGGGAGG - Intergenic
1138290040 16:55839118-55839140 GATTCAGGGGCTTCTTGGGGAGG + Intergenic
1141700337 16:85639376-85639398 GTTTCAGATGCCTATGGGGGTGG - Intronic
1146894239 17:36529774-36529796 TACTCAGATGCCTCTCTGGTTGG - Intronic
1149799049 17:59549295-59549317 GATACAGATGCCTCTGGGAGGGG - Intergenic
1152617005 17:81342677-81342699 GCCTCAGACGCCTCGTGGAGCGG - Intergenic
1152717030 17:81905198-81905220 GCATCAGATGGGTCTTGGGGAGG - Intronic
1153828426 18:8898413-8898435 AACTCAGATGCATCTTTGGAAGG + Intergenic
1157578586 18:48760045-48760067 GCGTGAGATGTCTCTTGGGGTGG + Intronic
1159242032 18:65753603-65753625 GAATCAGATGCTACTTGGTGGGG + Intronic
1160820036 19:1053669-1053691 GGCTCAGATGTCCCTTGGGAAGG + Intronic
1161663412 19:5560742-5560764 GGCACAGGTGCCTCCTGGGGAGG + Intergenic
1162971246 19:14182675-14182697 GGCTCAGATGGGTCTGGGGGTGG + Intronic
1163458421 19:17422322-17422344 GACACAGAGGCCTCTGGGAGTGG - Exonic
1164870802 19:31641004-31641026 GTCTCAGTTGCCTCTTATGGTGG - Intergenic
1166139309 19:40797391-40797413 GACTCAGGTGCCTGTTGCGGAGG + Intronic
1166355398 19:42224514-42224536 GACTGAGATGACACCTGGGGAGG + Exonic
1166669555 19:44701640-44701662 AATGCAGATGCCTCTTGGAGGGG - Intronic
1167525439 19:49980882-49980904 GGCTCAGATCCATCTTGGGGTGG - Intronic
1167761599 19:51453344-51453366 GACTGAGCTGCCACTTTGGGAGG - Intronic
1168282814 19:55314607-55314629 GACTCAGTAGTCTCTTGGGTGGG - Intronic
931840922 2:66147120-66147142 ATCTCAGGTGCCTCTTGGGGTGG + Intergenic
935932792 2:108146966-108146988 GTCTCAGATTCCACTTTGGGAGG + Intergenic
936473359 2:112818403-112818425 GCATCAGATGCCCCTTGGGCAGG + Intergenic
938072486 2:128316035-128316057 AACGCAGATGCCTCTGGCGGAGG - Intronic
941996074 2:171603184-171603206 GACCCAGGTGCCTCTGGAGGAGG - Intergenic
946369819 2:219274105-219274127 GACTCAGGTGCCTCAGGGGCAGG + Intronic
949032339 2:241803004-241803026 GACCCAGAGGCCTCTAGGAGTGG - Intronic
1168810544 20:701758-701780 GGCTCAGCTGCCTCTGGAGGGGG + Intergenic
1169833775 20:9854858-9854880 GCCTTAGTTGCCTCTTGGAGGGG + Intergenic
1170961345 20:21028543-21028565 CACTCAGATGCCTCTGGCTGGGG + Intergenic
1171776470 20:29372904-29372926 GACTCAGGTGACTCTTGAAGTGG - Intergenic
1172297154 20:33820862-33820884 GAATCAGAAGCCTCTTAGCGGGG + Intronic
1172320686 20:33993567-33993589 GACTGAGACGCGGCTTGGGGAGG - Intergenic
1174126848 20:48312672-48312694 GACACAGGTGACTCTTGGGGAGG - Intergenic
1175336390 20:58199045-58199067 AAATCAGATGCCTCTGCGGGTGG - Intergenic
1175986830 20:62768224-62768246 GAGTCAGATGCGCCCTGGGGTGG + Intergenic
1176056512 20:63151781-63151803 GGCTCAGAGGCCTCCTCGGGAGG - Intergenic
1177351920 21:19953958-19953980 AACTCTGGGGCCTCTTGGGGAGG + Intergenic
1177822894 21:26051027-26051049 GACTCGGATGTCTGGTGGGGCGG - Exonic
1178349045 21:31858347-31858369 GACTCAGAAGTCCCTTGGGAAGG + Intergenic
1181505607 22:23354368-23354390 GATTCAGGGGCTTCTTGGGGAGG - Intergenic
1182061724 22:27403203-27403225 GACTGAGATGGCTCTAAGGGTGG - Intergenic
949226026 3:1697441-1697463 GACTCAGATCCTTCTTAGAGTGG - Intergenic
950539145 3:13599651-13599673 GACTGAGATGCCTTTGGAGGTGG + Intronic
951618852 3:24579103-24579125 GGCACAGATGTCTCTTGGTGGGG + Intergenic
952984879 3:38770396-38770418 GACTCAGACCCTTCTTGGGTAGG + Intronic
954662794 3:52234966-52234988 GACTCTGCTGCCTCTGTGGGTGG - Intronic
956180224 3:66510596-66510618 AACTCAAATGCCTGGTGGGGTGG - Intergenic
957088619 3:75706749-75706771 GACTCAGGTGACTCTTGAAGTGG + Intergenic
960086496 3:113596761-113596783 GTCCCAGAGGCCTGTTGGGGAGG - Intronic
960513247 3:118575496-118575518 GACCCAGAGGCCTCTGGGAGTGG + Intergenic
960808875 3:121609920-121609942 GACTCAGGTGACTCTTGAAGTGG - Intronic
967977415 3:195043256-195043278 GACTCGGAGGCATCTTGGGGAGG + Intergenic
967998436 3:195184590-195184612 GACTTAAATGTTTCTTGGGGGGG - Intronic
968115409 3:196085587-196085609 GAATCAGAGTCCTCGTGGGGCGG + Intergenic
968401056 4:297967-297989 GAATCAAATTTCTCTTGGGGAGG - Intronic
969724131 4:8909171-8909193 CACTCAGATGGCACTTGGAGCGG + Intergenic
969846829 4:9925967-9925989 GACACTGATGCATCTGGGGGTGG + Intronic
970452229 4:16180943-16180965 CACTGAGATGCCTCTTTAGGAGG + Intronic
971859508 4:32086507-32086529 GACCAAGATGCCTCATGGTGAGG + Intergenic
978285546 4:107073314-107073336 GCCTCAGCTGCCTCTGTGGGGGG + Intronic
982741317 4:159060262-159060284 GATTCAGAGGCCTAGTGGGGAGG + Intergenic
986591904 5:9379613-9379635 GTCTTAGATCCCTCTTGAGGTGG + Intronic
988889460 5:35599044-35599066 GCCTCAGATTCTTCTTGGGCAGG - Intergenic
990677785 5:58207692-58207714 GTCTCTGAAGCCTCTAGGGGAGG + Intergenic
991146616 5:63313561-63313583 GCCTCAAAAGCCTCTTGGGTGGG - Intergenic
991668844 5:69026754-69026776 AAGACAGATGCCTCTTGGAGAGG - Intergenic
992369730 5:76130622-76130644 CACTCAGCTGCCTCTTCTGGTGG - Intronic
1000526157 5:162360578-162360600 GACTCAGATGCTTCTTGACAAGG - Intergenic
1003004406 6:2367686-2367708 GATTCAGGTGCCTCTCGAGGAGG - Intergenic
1005117711 6:22356547-22356569 GCCTCAGATGCCTCCCGGCGGGG - Intergenic
1006215045 6:32434324-32434346 GACACAGGGGCCTGTTGGGGGGG + Intergenic
1006455495 6:34129660-34129682 GACTCAGCTGTCTCTTGAGCAGG + Intronic
1007296542 6:40826484-40826506 GTCTCTGAAGCCTCTAGGGGAGG - Intergenic
1007670613 6:43550111-43550133 GACTCCGATGACTCTTGTAGAGG - Intronic
1009604561 6:65849805-65849827 GGCTCAGAGGCCTGATGGGGTGG + Intergenic
1013220169 6:108071236-108071258 GAATTAGTTGTCTCTTGGGGAGG - Intronic
1014917776 6:127173654-127173676 GGCTGAGAAGCCTCCTGGGGTGG - Intronic
1023324370 7:39037097-39037119 GACCCTGAGGCCTTTTGGGGAGG + Intronic
1023504859 7:40888849-40888871 GACTCAGATGCACCTGGGTGTGG + Intergenic
1026819432 7:73537024-73537046 GTCACAGATGAATCTTGGGGTGG + Exonic
1029654071 7:101912956-101912978 GAATGAAATGCATCTTGGGGAGG - Intronic
1031883745 7:127224242-127224264 GACTGTGATGCATCTTGGTGTGG - Intronic
1038157067 8:25000759-25000781 GACTCAGCAGCCTCCTGCGGCGG - Intergenic
1040529362 8:48253930-48253952 GGCTCAGAGTCTTCTTGGGGAGG + Intergenic
1041375501 8:57206866-57206888 TACCCAGATGTCTCTTGGGCAGG - Intergenic
1041376264 8:57211245-57211267 TACCCAGATGTCTCTTGGGCAGG - Intergenic
1041567668 8:59298417-59298439 GGCTCAGGTGACTGTTGGGGTGG + Intergenic
1044718768 8:95125645-95125667 GACACACATGTCTCTTGGAGAGG - Intergenic
1048039203 8:130709140-130709162 GACAGTGATGCCTCTCGGGGAGG + Intergenic
1048186868 8:132249797-132249819 GACTCAGCTGCCTCTTTGCGGGG - Intronic
1049647552 8:143742422-143742444 AGCTCAGATGCCTCCTGGGGAGG - Intergenic
1051346104 9:16152567-16152589 GAATAAGATGGCTCTTGGGGTGG + Intergenic
1053230256 9:36401573-36401595 TGCTCAGATGTCGCTTGGGGAGG + Intronic
1057385638 9:94603725-94603747 GTCTCAGATGCAACCTGGGGTGG - Intronic
1057529511 9:95831691-95831713 GACACAGATGCCTCCTGGACAGG - Intergenic
1059422146 9:114198876-114198898 GCCTCAGCTGCCTCATGAGGTGG + Intronic
1059604096 9:115814230-115814252 AACTCAGGTGCCTTTTAGGGGGG + Intergenic
1060281394 9:122218169-122218191 GACTCCGCTGCCTCCTGGAGGGG - Intronic
1061631499 9:131875018-131875040 GGCTGAGCTGCCTCTTGGCGGGG - Intronic
1062000443 9:134213283-134213305 CCCTCAGATGCCACTAGGGGAGG - Intergenic
1062000758 9:134214607-134214629 CCCTCAGATGCCACTAGGGGAGG + Intergenic
1062025494 9:134338422-134338444 GACCCAGGTGCCACTTGGGCTGG - Intronic
1062087835 9:134657803-134657825 GACTCTGATGTCTTCTGGGGAGG + Intronic
1062197343 9:135281597-135281619 GACTTGGATTCCTCGTGGGGAGG + Intergenic
1186551047 X:10506301-10506323 GTCTCATATCCTTCTTGGGGAGG - Intronic
1188537661 X:31215335-31215357 GACTCAGATGCCTCTTGGGGTGG + Intronic
1190370902 X:49739783-49739805 GAATGAGATGCCTCCTGGGAAGG + Intergenic
1192185717 X:68945602-68945624 GACTTGGATTCCTCTCGGGGAGG - Intergenic
1200091571 X:153638528-153638550 GGCTCAGATGTCTGTGGGGGTGG - Intergenic
1200243155 X:154508220-154508242 CACCCAGAGGCCTCCTGGGGAGG + Intronic