ID: 1188538302

View in Genome Browser
Species Human (GRCh38)
Location X:31221262-31221284
Sequence ACCCAAGTTAAGGAATTTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 136}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188538302 Original CRISPR ACCCAAGTTAAGGAATTTAG AGG (reversed) Intronic
901500511 1:9649949-9649971 AGCCCAGCCAAGGAATTTAGAGG - Intergenic
902881413 1:19374187-19374209 ACCCAAGAAAAGGAATAAAGAGG - Intronic
906139830 1:43527428-43527450 ACCCAAGGTAATGAAACTAGAGG - Intronic
908433910 1:64086017-64086039 ACCCAAGTTAAGGGACATATGGG + Intronic
917051420 1:170928916-170928938 ACCCAAGTTAGGGAGTGCAGAGG + Intergenic
918137833 1:181691495-181691517 ATCCAAGTTATTGAATTTACTGG - Intronic
918159905 1:181888917-181888939 ATCTAAGTTATGGAATTTATTGG - Intergenic
919153451 1:193730056-193730078 AAGCAAGATAAGGAAATTAGGGG - Intergenic
920221765 1:204409360-204409382 ATCCAAGTATATGAATTTAGAGG + Intronic
923948792 1:238923808-238923830 ATTTAAGCTAAGGAATTTAGAGG + Intergenic
1067293370 10:44960060-44960082 ACCTCTGTTAAGCAATTTAGGGG + Intronic
1069404454 10:68083804-68083826 ACTAAACTTAAGGAAATTAGGGG - Intergenic
1073597572 10:104816567-104816589 ACCCAAGTGCAGGAAGTTTGTGG + Intronic
1076520051 10:131075788-131075810 TCCCGAGTTAAGGAACCTAGAGG + Intergenic
1077712133 11:4548028-4548050 ACCCAACTTATGGAATTTCTTGG + Intergenic
1081650792 11:44822859-44822881 AACCAAGTTAAGGGAATTAAAGG + Intronic
1082071235 11:47941415-47941437 ACCCAAGCTAAAGACTTCAGGGG + Intergenic
1084865600 11:72054110-72054132 ACTCAAGCTAGGAAATTTAGAGG - Intronic
1090824798 11:130377114-130377136 ACCCAAGATATGAAAATTAGCGG + Intergenic
1092214157 12:6668857-6668879 ACCCATTCTGAGGAATTTAGGGG - Intronic
1092907992 12:13119530-13119552 ATCCAAGTTAAGGAACACAGTGG + Intronic
1093053923 12:14535642-14535664 ACCCAGGTAAATGAATTTAAAGG - Exonic
1093559575 12:20522090-20522112 TCCCAAGCTAGGGAATCTAGTGG - Intronic
1094585418 12:31773196-31773218 ACTCAGGTGTAGGAATTTAGTGG + Intergenic
1108678477 13:52758954-52758976 AAAAAAGTTAAGTAATTTAGGGG - Intergenic
1110205067 13:72902326-72902348 ACACAAGTTAAGTTCTTTAGCGG - Intronic
1111020841 13:82448217-82448239 ACCCAAGTTAAATAATTTTATGG + Intergenic
1114470829 14:22960263-22960285 ACCGAAGTGAAGGATTTTATAGG + Intronic
1115073180 14:29351621-29351643 ACCCTAGTCAAGGCTTTTAGAGG - Intergenic
1115133125 14:30077057-30077079 ACCCAAGTCCAGGAAGTTTGAGG - Intronic
1117718242 14:58602680-58602702 ACTCAAGTTAGTGAATATAGGGG - Intergenic
1118396651 14:65343062-65343084 CCCCAAGGAAAGGAATTAAGTGG - Intergenic
1119010909 14:70987506-70987528 CCACAAGTAAAGGAATTTAAAGG + Intronic
1121075488 14:91064799-91064821 ACCCAAGTTGACAAATTCAGTGG - Intronic
1128870781 15:71153763-71153785 ACCTAAGTTAAATAATATAGTGG - Intronic
1130770020 15:86914969-86914991 AATCAAGTTTAGGAATTTGGAGG - Intronic
1132779110 16:1613185-1613207 CCCCAACTTAAGGGATTTCGTGG - Intronic
1139950836 16:70668642-70668664 CCCCAAGATAAGGTATTGAGAGG + Intronic
1143485866 17:7253445-7253467 ACACATGTAAAGGACTTTAGTGG + Intronic
1143763272 17:9120393-9120415 CCCCACGTTAAGGATTTTGGGGG + Intronic
1144346773 17:14356528-14356550 AGCAAACTGAAGGAATTTAGGGG + Intergenic
1147148849 17:38501640-38501662 ACCTAAGTTATTGAATTTATGGG - Intronic
1150351589 17:64449062-64449084 AGCCAAGTTAAGGAAATCAGAGG - Intronic
1153469130 18:5423508-5423530 ACCCAAGGTTAGGAATTTCTTGG + Exonic
1157034528 18:43955141-43955163 TCCAGAGTTAAGGAATTTAAAGG - Intergenic
1160326325 18:77952408-77952430 TCCCAACTGTAGGAATTTAGAGG - Intergenic
1162487570 19:10970702-10970724 CCACAAGTTAAGGACTTTATCGG - Intronic
1166251093 19:41571217-41571239 TCCCAAGTGAAGGATTTTACTGG - Intronic
1167869235 19:52353886-52353908 ACCTCAGTTAAGCAATTTAGGGG - Intronic
927820850 2:26263414-26263436 ACCCAATATAAGGAATGTTGTGG + Exonic
928600668 2:32900889-32900911 AGCCATGTTAAGGAGCTTAGGGG + Intergenic
929380746 2:41349609-41349631 ACCAAATTTAAGGAAATTGGAGG - Intergenic
934766292 2:96881955-96881977 ACCCAATTTAAGGAGATTGGTGG + Intronic
935514822 2:104022829-104022851 ACCAAAGTTTAGGAATTATGAGG + Intergenic
937395249 2:121529602-121529624 ACCGGAGGTCAGGAATTTAGAGG + Intronic
939563750 2:143762411-143762433 AACACAGTTAAGGAATTTAAGGG + Intronic
939848202 2:147273315-147273337 GCAGAAGTTTAGGAATTTAGAGG + Intergenic
941148404 2:161883097-161883119 ACCCAAGTAAAGGAAAATAGTGG - Intronic
942917716 2:181331731-181331753 ACCCAAAATAGGGATTTTAGAGG + Intergenic
943042692 2:182821972-182821994 AGCCAACTTAAGAAATTTAGGGG - Intergenic
944596648 2:201267071-201267093 AGCCAGATTAAGAAATTTAGGGG + Intronic
946731300 2:222712090-222712112 ACCCTAGTTGAGGAATCCAGGGG + Intergenic
1170939632 20:20837928-20837950 TCCAAAGTTTAGGAATTCAGAGG - Intergenic
1173073052 20:39788044-39788066 AACCAAGTTAAAGAATTTTAAGG - Intergenic
1175101093 20:56579337-56579359 ACAGAATTTCAGGAATTTAGTGG + Intergenic
1178695595 21:34790817-34790839 AACCAAATCAATGAATTTAGGGG - Exonic
1180115532 21:45701413-45701435 ACCCAACTTAAGAAGTTGAGAGG - Intronic
1181139461 22:20793768-20793790 TCCCAAGTTAGGGAAATTTGGGG + Intronic
1184989357 22:48156604-48156626 ACACAAGTTAAGGTATTTGAGGG - Intergenic
949148691 3:737392-737414 AGCCAAGTGAAGGTATTTAAAGG + Intergenic
953920103 3:46945760-46945782 ACCTAAGTTATTGAATTTACTGG + Intronic
955859091 3:63307978-63308000 ATCCAAGTAAAGGAATTTGAAGG + Intronic
956097752 3:65735282-65735304 ACAGAAGTTAAGGATTTTTGGGG + Intronic
956370492 3:68553875-68553897 ACCAATGCTAAGGAATTTTGAGG + Intergenic
956682568 3:71794921-71794943 ACTCATGTAGAGGAATTTAGAGG + Intergenic
957549782 3:81689332-81689354 ACCCAAGTTTAGGAAAATACTGG + Intronic
958156799 3:89765377-89765399 ACCCAGGCTAAGGAATTTATGGG + Intergenic
959552836 3:107682566-107682588 ACCAATGTTATGGAATCTAGTGG - Intronic
961509953 3:127394732-127394754 ACACAAGAAAAGGAATTTACTGG - Intergenic
961590135 3:127973162-127973184 ACACAAGTTAAGTATTTTGGTGG - Intronic
963947463 3:151161958-151161980 AGCCAAATTAAGGAATGTCGAGG + Intronic
966056892 3:175704551-175704573 GACCAAGTAAAGGAATTCAGAGG - Intronic
966202347 3:177370034-177370056 TCCCAAGCTAAAGAATTTGGGGG - Intergenic
975394066 4:73854539-73854561 ACCAATGTTAAGGAATTTGTGGG - Intergenic
975725656 4:77289301-77289323 ACCAAAGTTAATGGATTCAGGGG - Intronic
975897018 4:79105723-79105745 ACCCAATTCAAGGAATCTAAAGG - Intergenic
975983858 4:80185630-80185652 ACCCATGTGACTGAATTTAGGGG + Intronic
978194033 4:105949647-105949669 CCCAAAGTAAAGGAAGTTAGGGG + Intronic
980084094 4:128373688-128373710 ACTCCAGTTCAGGAAGTTAGCGG + Intergenic
983530101 4:168801698-168801720 ACCCAAGTAAAGTAATTAAAGGG + Intronic
986373731 5:7108419-7108441 ACTGAAGTTGAGGAATTTGGAGG - Intergenic
987452474 5:18103415-18103437 TTCCAAGTTAAGGCATTTTGGGG + Intergenic
987700379 5:21390377-21390399 ACACAAGTTAAAGGCTTTAGGGG + Intergenic
993797829 5:92290940-92290962 ACCCAAGTTATCGAATTTATGGG + Intergenic
996927122 5:128841003-128841025 ACCCAAGCTGAGGAATATATTGG + Intronic
1000730383 5:164827906-164827928 ACGAAAGGCAAGGAATTTAGTGG + Intergenic
1001673205 5:173491407-173491429 ACCAAAGTTAAGGAATTCGCAGG - Intergenic
1001820408 5:174705673-174705695 AGCCAAGGCAAGAAATTTAGGGG + Intergenic
1005673997 6:28135742-28135764 ACCCAAGTGAAAGAAGGTAGTGG + Intergenic
1006733085 6:36251109-36251131 ACCCAAGATGAGGAAATTTGAGG - Intronic
1006733191 6:36252055-36252077 ACCCCAGGTAAGGAAGTTTGAGG + Intronic
1007698763 6:43751583-43751605 ATCTAAGTTATGGAATTTATTGG - Intergenic
1008556275 6:52675843-52675865 GTGGAAGTTAAGGAATTTAGAGG + Intronic
1009552379 6:65115662-65115684 ACCCATGTTCAGGATTTTATAGG + Intronic
1010640013 6:78313487-78313509 ACCCAATTGAGGGAATATAGAGG - Intergenic
1013156730 6:107498992-107499014 ACCCCTGTTAAGGAAACTAGAGG + Intronic
1013653524 6:112221464-112221486 ACACCAGTGAATGAATTTAGAGG - Intronic
1014286263 6:119502574-119502596 AGCAAAGTGAAGGAATTTGGAGG - Intergenic
1014986333 6:128015338-128015360 ACCTAATTGAATGAATTTAGTGG - Intronic
1016916024 6:149245223-149245245 ACCCAAGTTTTGGAAAGTAGAGG + Intronic
1020637327 7:10712778-10712800 CCCCAAGTGAAGGAATTTGGAGG + Intergenic
1024468145 7:49736134-49736156 ACCCAAGTTAAAGAATTCACAGG + Intergenic
1027877538 7:83789386-83789408 ACCTAAGTTAAGAAATGTAGGGG - Intergenic
1028822181 7:95225054-95225076 AATAAAGTTAAGGAAGTTAGTGG + Intronic
1029484459 7:100830933-100830955 ACCCACGTTCTGTAATTTAGTGG - Intronic
1030484704 7:110150731-110150753 ACCCAATTTAAGAAAGGTAGAGG + Intergenic
1031726084 7:125240955-125240977 ACCTTAATTAAAGAATTTAGGGG - Intergenic
1032692014 7:134296637-134296659 AACCAATTTAATGACTTTAGTGG - Intronic
1033282013 7:140012812-140012834 ACCCAAGTTCAGGAAGAGAGCGG + Intronic
1036008412 8:4693154-4693176 GGCCAAATTAAGGAATTAAGAGG - Intronic
1042532190 8:69827409-69827431 GCAGAAGTTAAGGCATTTAGTGG + Intronic
1044164651 8:88967179-88967201 ACCAAAGTTTAGGAATTTGAAGG + Intergenic
1046676861 8:117119042-117119064 TCCCATGGTAAGGAATATAGAGG + Intronic
1046843911 8:118893315-118893337 ATCCAATTTCAGGAATTAAGAGG - Intergenic
1051034973 9:12733618-12733640 TCCATAGTTATGGAATTTAGGGG - Intergenic
1051553949 9:18361797-18361819 ACCCAACTAAATGAATTTGGTGG + Intergenic
1052101853 9:24456668-24456690 CCCCAATTTAAGGGATGTAGAGG + Intergenic
1052587894 9:30452442-30452464 AGGCAAGTTTAGGAATTTGGGGG - Intergenic
1054959160 9:70948021-70948043 AATCAAGTTAAGGAATTATGTGG - Intronic
1055207342 9:73748450-73748472 ACAAAAATTAAGAAATTTAGAGG - Intergenic
1056146441 9:83735352-83735374 ACCGAAGATAAGGAAAATAGAGG - Intergenic
1058025398 9:100137352-100137374 GCCCAAGTTTAGGAGTTTAATGG - Intronic
1058494913 9:105546107-105546129 ACCCAAGAGAAGGAACTCAGGGG - Intronic
1058788149 9:108412616-108412638 ACCAAAATTTAGGAGTTTAGAGG + Intergenic
1058790060 9:108435489-108435511 AACCAATCTAAGGAATTTGGGGG + Intergenic
1059463937 9:114453623-114453645 ATCCAAGTTGTGGAATTTAAAGG - Intronic
1186025567 X:5306946-5306968 ACCCAATATAAGGAATATTGTGG - Intergenic
1186105510 X:6201679-6201701 ATCCAAGATGAGGAATTGAGAGG + Intronic
1186116896 X:6313655-6313677 ACCCAAATTCAGGAATGTACTGG + Intergenic
1186829194 X:13373751-13373773 ACACATGTAAAGGAATTTGGAGG + Intergenic
1188538302 X:31221262-31221284 ACCCAAGTTAAGGAATTTAGAGG - Intronic
1189633030 X:42975208-42975230 ACACAAGTCAAGGAAATTAAAGG - Intergenic
1193673017 X:84413062-84413084 ACCCAATCTGAGGAATTTAAGGG - Intronic
1195230680 X:102843872-102843894 ACTCATTTTAAGGAATTCAGAGG + Intergenic
1197475454 X:126918328-126918350 ACCCAAGTAATGGAATTTCTGGG - Intergenic
1201491739 Y:14549151-14549173 ACCCAAGATAAGGGACTGAGAGG - Intronic