ID: 1188541904

View in Genome Browser
Species Human (GRCh38)
Location X:31260156-31260178
Sequence GCCATGAGCCCAGGGGTTCG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 5893
Summary {0: 1, 1: 0, 2: 23, 3: 518, 4: 5351}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188541899_1188541904 9 Left 1188541899 X:31260124-31260146 CCAGCTACTCAGGAGGCTGAGGC 0: 84870
1: 190808
2: 228673
3: 158767
4: 94038
Right 1188541904 X:31260156-31260178 GCCATGAGCCCAGGGGTTCGAGG 0: 1
1: 0
2: 23
3: 518
4: 5351
1188541895_1188541904 18 Left 1188541895 X:31260115-31260137 CCTGTTGTCCCAGCTACTCAGGA 0: 431
1: 46623
2: 165091
3: 223234
4: 206297
Right 1188541904 X:31260156-31260178 GCCATGAGCCCAGGGGTTCGAGG 0: 1
1: 0
2: 23
3: 518
4: 5351
1188541897_1188541904 10 Left 1188541897 X:31260123-31260145 CCCAGCTACTCAGGAGGCTGAGG 0: 96881
1: 202886
2: 238913
3: 154169
4: 85070
Right 1188541904 X:31260156-31260178 GCCATGAGCCCAGGGGTTCGAGG 0: 1
1: 0
2: 23
3: 518
4: 5351

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188541904 Original CRISPR GCCATGAGCCCAGGGGTTCG AGG Intronic
Too many off-targets to display for this crispr