ID: 1188546177

View in Genome Browser
Species Human (GRCh38)
Location X:31309939-31309961
Sequence ATAAGCTATCTAGCCAGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 213}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188546171_1188546177 20 Left 1188546171 X:31309896-31309918 CCAGCCACGACTCATAAATCCAA 0: 1
1: 0
2: 0
3: 7
4: 60
Right 1188546177 X:31309939-31309961 ATAAGCTATCTAGCCAGGCCAGG 0: 1
1: 0
2: 0
3: 16
4: 213
1188546172_1188546177 16 Left 1188546172 X:31309900-31309922 CCACGACTCATAAATCCAAACAT 0: 1
1: 0
2: 1
3: 9
4: 123
Right 1188546177 X:31309939-31309961 ATAAGCTATCTAGCCAGGCCAGG 0: 1
1: 0
2: 0
3: 16
4: 213
1188546170_1188546177 24 Left 1188546170 X:31309892-31309914 CCAGCCAGCCACGACTCATAAAT 0: 1
1: 0
2: 1
3: 5
4: 65
Right 1188546177 X:31309939-31309961 ATAAGCTATCTAGCCAGGCCAGG 0: 1
1: 0
2: 0
3: 16
4: 213
1188546175_1188546177 -8 Left 1188546175 X:31309924-31309946 CCAGGTTTATTTACAATAAGCTA 0: 1
1: 1
2: 4
3: 20
4: 159
Right 1188546177 X:31309939-31309961 ATAAGCTATCTAGCCAGGCCAGG 0: 1
1: 0
2: 0
3: 16
4: 213
1188546174_1188546177 1 Left 1188546174 X:31309915-31309937 CCAAACATTCCAGGTTTATTTAC 0: 1
1: 1
2: 2
3: 25
4: 239
Right 1188546177 X:31309939-31309961 ATAAGCTATCTAGCCAGGCCAGG 0: 1
1: 0
2: 0
3: 16
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188546177 Original CRISPR ATAAGCTATCTAGCCAGGCC AGG Intronic
901095092 1:6672128-6672150 ATAAAATTTCTATCCAGGCCGGG - Intronic
901801933 1:11713306-11713328 AGAGGCTTTCCAGCCAGGCCAGG - Intronic
903584181 1:24396463-24396485 ATTTACTATCTAGCCAGGCATGG - Intronic
904586163 1:31582032-31582054 ATAAGCAATATAAACAGGCCGGG + Intronic
904714478 1:32456956-32456978 GTAAGCAACCTAGGCAGGCCAGG + Intergenic
906004986 1:42461489-42461511 ATAAAATATTTAGCCAGGCATGG - Intronic
906301535 1:44685599-44685621 ATAAGCTATCTGGCCAGGTATGG - Intronic
906397184 1:45476555-45476577 ATGAGGTAGCTAGCCAGGCGCGG + Intronic
906557142 1:46722850-46722872 ATAAATTATGTAGCCAGTCCTGG - Intergenic
907255254 1:53174015-53174037 TGAAGCTATCTAGCCAGGCAGGG - Intergenic
908154185 1:61335550-61335572 ATAAGCTAACTGGCCAGGCGCGG + Intronic
908766954 1:67562860-67562882 ATAAGCAGTCGAGCCAGGACTGG + Intergenic
909641454 1:77872258-77872280 AAAAGCAATCCAGCCAGGCATGG - Intronic
912655294 1:111481217-111481239 ATAAAATAACTAGCCAGGCATGG + Intergenic
915110099 1:153558797-153558819 AAAAGATGTCTAGCCAGGCGCGG + Intergenic
915190891 1:154149551-154149573 ATAAAAAAACTAGCCAGGCCTGG + Intronic
915556332 1:156662933-156662955 ATAAGCCACCTCGCCTGGCCTGG + Intergenic
917322831 1:173801528-173801550 AAAATCTAACTAGCCAGGCATGG + Intronic
922288745 1:224192761-224192783 AAAAGCTATTTCGCCAGGCACGG + Exonic
922810493 1:228412926-228412948 ATAAGTCATCGCGCCAGGCCAGG - Intronic
923286856 1:232504380-232504402 ATAAACGAACTAGCCAGGCATGG + Intronic
1064279973 10:13942642-13942664 AAAAGAGATCTAGCCAGGCGTGG + Intronic
1066121999 10:32298085-32298107 ATAATCTAACTGGCCAGGCGCGG - Intronic
1067895150 10:50170940-50170962 TCTAGCTCTCTAGCCAGGCCAGG - Intergenic
1068702241 10:60032501-60032523 AAAAATTATCAAGCCAGGCCAGG - Intronic
1068738790 10:60445739-60445761 TTAAGCTTTTTGGCCAGGCCAGG + Intronic
1070039853 10:72765636-72765658 ATAAGAAATATAGCCAGGCATGG + Intronic
1071669923 10:87598776-87598798 ATGATCTGTCTAGCCAGGCTTGG - Intergenic
1073483512 10:103801997-103802019 ATTAGCTATCTAAAAAGGCCAGG - Intronic
1074562552 10:114546934-114546956 ATAAGCAAGCAAGCCAGGCATGG - Intronic
1074598008 10:114885110-114885132 ATGAGCCACCTCGCCAGGCCGGG - Intronic
1077864077 11:6208882-6208904 ATTAGCTTTCTGGCCAGGCGCGG + Intronic
1077864918 11:6214362-6214384 ATAGGCTATCTAGGGAGGGCAGG + Intronic
1079188159 11:18255457-18255479 ATAAGAAAACTAGCCAGGCATGG - Intergenic
1079433519 11:20421191-20421213 ATAAACAAACTAGCCAGGCACGG - Intronic
1082004170 11:47410533-47410555 AGGAGCTATCTAGCCAGGGGCGG + Intronic
1083661756 11:64254665-64254687 CCAAGCTCTCTACCCAGGCCAGG - Intronic
1083852932 11:65378458-65378480 CTAAGCTAAGTGGCCAGGCCCGG - Intronic
1084756147 11:71240093-71240115 AGAAGCTATTTAACCAGGCTTGG + Intronic
1085502279 11:77034874-77034896 ATGAGCCATCTCGCCTGGCCAGG - Intronic
1085806540 11:79641963-79641985 ATAAGCTTTCTATGTAGGCCTGG + Intergenic
1087567728 11:99883653-99883675 ATAGGTTATCAAGACAGGCCAGG - Intronic
1088692579 11:112340431-112340453 ATAAGCCACCAAGCCTGGCCTGG - Intergenic
1089234491 11:117011685-117011707 ATAAGGTTTCTGGCCAGGCATGG + Intronic
1092154852 12:6275531-6275553 AAAGGCTATCAAGCCAGGCGCGG + Intergenic
1092662512 12:10754467-10754489 ATATGCTATGTGGCCAGGCATGG - Intergenic
1093455316 12:19359671-19359693 ATAAGCTTTCTGGCCGGGCGCGG + Intronic
1094029818 12:25998635-25998657 AAAAGCTTTCTTGCCAGGCGCGG - Intronic
1095673005 12:44882816-44882838 AAAAGGTATATAGCCAGGCATGG - Intronic
1096312680 12:50535281-50535303 ATAAGCTACCAGGCCTGGCCTGG - Intronic
1097123542 12:56754730-56754752 GTAAGCTATCAGGCCTGGCCTGG - Intronic
1097197550 12:57251771-57251793 AAAAGCAATCTAGCCATGCACGG - Intronic
1100155738 12:91798394-91798416 AAAAGCTTTCTGGCCAGGCGTGG + Intergenic
1102420237 12:112797626-112797648 ATCAGCTGTCCAGCCAGGCTAGG + Intronic
1103228903 12:119311438-119311460 AAAAGCTACCTAGCCAAGCATGG - Intergenic
1103769266 12:123307914-123307936 ATAAGAAATTTAGCCAGGCGTGG + Intronic
1106339535 13:28815790-28815812 ATAAACTATCTAGCTGGGCGTGG + Intergenic
1107819680 13:44275127-44275149 ATAAGTGATATAGCCATGCCCGG - Intergenic
1108358394 13:49647855-49647877 ATAAAATAATTAGCCAGGCCTGG + Intergenic
1108597133 13:51959351-51959373 AGACCCTATCTAGCCAGGCATGG + Intronic
1108975066 13:56431560-56431582 ATAAGCTAACTAGTGATGCCAGG + Intergenic
1110298593 13:73898955-73898977 AAAAGTTATCCAGCCATGCCAGG + Intronic
1111383368 13:87490011-87490033 ATAAAATATTTAGCCAGGCGCGG - Intergenic
1111582229 13:90237282-90237304 TTAAGCTCTCTGGCCAGGCACGG + Intergenic
1113223855 13:108137490-108137512 ATCAGCAAATTAGCCAGGCCAGG + Intergenic
1114768144 14:25398134-25398156 ATAAGCCACCTTGCCTGGCCTGG + Intergenic
1117718024 14:58600468-58600490 ACAAGATATCCAGCCAGGCTGGG - Intergenic
1119562086 14:75598629-75598651 ATAAAATAACTAGCCAGGCATGG - Intronic
1119838801 14:77774775-77774797 AGAAGTTAACTAGCCAGGCATGG - Intergenic
1121113005 14:91325117-91325139 ATAACCTAGGTAGCCAGGTCAGG - Intronic
1123998728 15:25736829-25736851 ATCAGCTCTCTGGTCAGGCCTGG + Intronic
1125499162 15:40227612-40227634 AAAAGCTAACTAGCGTGGCCAGG + Intergenic
1126153501 15:45543884-45543906 CTAAACTATATAGCCAGGCGTGG - Intergenic
1126590369 15:50333736-50333758 AAAAGTCATCTAGCCAGGCGTGG + Intronic
1126615377 15:50573763-50573785 ATAATTTAGATAGCCAGGCCGGG + Intronic
1126781652 15:52144123-52144145 GAAAGCTATCTATCCGGGCCTGG + Intronic
1127422286 15:58818409-58818431 ATAAAAAATCTAGCCAGGCATGG - Intronic
1128031371 15:64483540-64483562 ATAAGAAATGTAGCCAGGCGTGG - Intronic
1129047719 15:72751676-72751698 ATAACCTATGGAGCCAGGACAGG + Exonic
1131229829 15:90651713-90651735 AGGAGCCATCTAGCCAGGTCCGG + Intergenic
1131368688 15:91861777-91861799 ATAAGAAAACTAGCCAGGCTTGG - Intronic
1137478091 16:48828302-48828324 ATAATTTATCCAGCCAGGCGAGG + Intergenic
1139241363 16:65395610-65395632 CTAATCCATCAAGCCAGGCCAGG + Intergenic
1139534849 16:67565282-67565304 GTGAGCCATCTCGCCAGGCCAGG + Intronic
1141294261 16:82752123-82752145 ATAAGCTAACAAGGCAGGCCTGG + Intronic
1143246887 17:5494303-5494325 ATGAGCTATCTCGCCTGGCCTGG - Intergenic
1143814764 17:9503660-9503682 ATCAGCTTTATTGCCAGGCCTGG - Intronic
1143907136 17:10217874-10217896 ATAAGAAATGTAGCCAGGCCAGG - Intergenic
1151761795 17:76108300-76108322 AAAAATTATCTAGCCAGGCATGG - Intronic
1152081310 17:78189025-78189047 AGAAGGTATCTATCCAGGCCCGG - Intronic
1152201366 17:78948438-78948460 ATAAAATAACTAGCCAGGCATGG + Intergenic
1156780094 18:40840364-40840386 ATAAAGTATCTGGCCAGGCACGG + Intergenic
1157759782 18:50252729-50252751 ATAGGATATCTGGCCAGGCATGG + Intronic
1158464709 18:57679983-57680005 ATAAACTACCTGGCCAGGCATGG + Intronic
1162045742 19:7999088-7999110 ATAAGCCACCACGCCAGGCCAGG - Intronic
1166137701 19:40787250-40787272 ATAAGCCACCGAGCCAGGCCTGG - Intronic
1167427087 19:49434910-49434932 CCAAGCTATCCAGCCATGCCCGG + Intronic
1168219995 19:54953705-54953727 ATAAAGAATCCAGCCAGGCCGGG + Intronic
1168629377 19:57945183-57945205 ATAAGCTGTTCAGCCAGGCGTGG - Intronic
1168638983 19:58018158-58018180 ATAAGCTACCATGCCTGGCCAGG - Intergenic
927531416 2:23807013-23807035 ATAAGTATTCTAGCCAGGCATGG + Intronic
927808200 2:26166752-26166774 AAAAGCTGTCTAGCCAGGCATGG - Intergenic
927937150 2:27082486-27082508 GGAAGCCATCTAGCCCGGCCAGG - Exonic
928288527 2:30015883-30015905 ATACGATAACTAGCCAGGCATGG + Intergenic
928440349 2:31286953-31286975 ATAAGATTCCTAGCCAGGCGCGG - Intergenic
935531217 2:104234619-104234641 ATTAGCAAACTAACCAGGCCGGG + Intergenic
935960868 2:108424314-108424336 AAAATCTATCTGGCCAGGCATGG + Intergenic
935989595 2:108706831-108706853 ATAAATTATCTAACCAGGCCGGG + Intergenic
940799683 2:158119718-158119740 AAAAACTATCTGGCCAGGCATGG + Intronic
941078273 2:161031158-161031180 ATACTCTAATTAGCCAGGCCTGG + Intergenic
942034961 2:172001808-172001830 ATTAGCCACCTTGCCAGGCCTGG - Intronic
944115133 2:196177880-196177902 ATAAGAAAACTAGCCAGGCACGG + Intergenic
944407605 2:199402400-199402422 ATACATTATCTAGCCAGGCATGG + Intronic
945921754 2:215762136-215762158 GTAAGCTACCAAGCCTGGCCTGG + Intergenic
946194602 2:218025545-218025567 TTAAAGTATGTAGCCAGGCCAGG - Intergenic
946381826 2:219354091-219354113 ATAAGCCACCAAGCCTGGCCTGG - Intergenic
948107641 2:235428075-235428097 AGTAGGTATCTAGGCAGGCCAGG - Intergenic
1170370354 20:15641055-15641077 AGAAGCAATCTAGCCAGAGCAGG + Intronic
1173209392 20:41020372-41020394 AGAAGCTACCTGGCCAGGCACGG + Intergenic
1173608897 20:44352247-44352269 AAAAGCTCTCCAGCCAGGCAGGG - Intergenic
1174476033 20:50796089-50796111 AAAATCTATCTCGCCAGGCCTGG + Intronic
1175668984 20:60885414-60885436 ATAACCTTTCCACCCAGGCCAGG + Intergenic
1177633436 21:23755840-23755862 ATAAGCAATCTAACCAAGACTGG - Intergenic
1178156697 21:29862140-29862162 ATAAGACAATTAGCCAGGCCTGG - Intronic
1179081468 21:38174442-38174464 ATAAGTTATTGAGCCAGGGCTGG - Intronic
1180608247 22:17077818-17077840 ATAAGTGGTCTAGGCAGGCCGGG + Intergenic
1182495426 22:30703769-30703791 AAAAGCTATAAGGCCAGGCCAGG - Intronic
1184949682 22:47832465-47832487 CACAGATATCTAGCCAGGCCAGG - Intergenic
955122702 3:56076804-56076826 ATAAGCCATGTAGACAGGCATGG - Intronic
955457531 3:59140191-59140213 ATAAGCTATTTTGCCAGGATAGG + Intergenic
955925792 3:64003887-64003909 ATAAGCTTTTTATCCAGACCCGG + Intergenic
958650447 3:96930699-96930721 ATAAGCTGTCTAGCTGGGCCTGG + Intronic
959732474 3:109619648-109619670 ATAAGCTATATTGCCAAGCAAGG - Intergenic
960104747 3:113782871-113782893 ATATGCTATCTTGGGAGGCCGGG - Intronic
960462395 3:117952308-117952330 AAAAGAATTCTAGCCAGGCCAGG - Intergenic
961190790 3:124959576-124959598 ATGAGCTATCGCGCCTGGCCAGG + Intergenic
962745440 3:138394500-138394522 ACAAGCTATCCAGCGATGCCTGG - Intronic
963326399 3:143867913-143867935 ATGAGCTATCGTGCCTGGCCTGG + Intergenic
964121574 3:153189671-153189693 ATAAGTAACCTAGCCAGGCTTGG - Intergenic
965842455 3:172922636-172922658 ATAAGCTACCATGCCTGGCCAGG - Intronic
965998337 3:174914356-174914378 ATAAAATATAAAGCCAGGCCGGG - Intronic
967939910 3:194757543-194757565 ATAAGCTAGATATCCAGACCAGG - Intergenic
968114347 3:196078366-196078388 AAAAGCTTTCTGGCCAGGCACGG + Intronic
970849146 4:20581190-20581212 AGAAGCCAACTAGACAGGCCTGG - Intronic
971908092 4:32755281-32755303 ACTAGATCTCTAGCCAGGCCAGG - Intergenic
972418543 4:38866199-38866221 ATAAGAAATATAGCCAGGCACGG + Intergenic
976200511 4:82573495-82573517 ATGAGCTACCTTGCCCGGCCAGG - Intergenic
984472529 4:180194551-180194573 ATGAGCCACCTTGCCAGGCCTGG - Intergenic
985047191 4:185952316-185952338 AAAAGCTATTTTGCCAGGCTTGG - Intronic
985562201 5:593889-593911 AAAAGCAATGTGGCCAGGCCAGG + Intergenic
988137218 5:27189215-27189237 ATAAGCCATGAAGCCAGGCAAGG - Intergenic
989750010 5:44882132-44882154 TTAAACTATCTAGCAAGCCCTGG - Intergenic
990315918 5:54583270-54583292 ATAAGAAGTCTAGCAAGGCCAGG - Intergenic
992664004 5:78988048-78988070 ATAAGCGTTCTGGCCAGGCGTGG - Intergenic
995363168 5:111322290-111322312 ATTAGATCTCTGGCCAGGCCAGG + Intronic
995509762 5:112896643-112896665 AAAATAAATCTAGCCAGGCCTGG + Intronic
996152390 5:120055778-120055800 ATAAATTATGTAGCCAGGCCTGG - Intergenic
996699163 5:126432082-126432104 ATAAGAAAAATAGCCAGGCCTGG - Intronic
1002370645 5:178751177-178751199 ATAAAAAAACTAGCCAGGCCTGG + Intergenic
1004047406 6:12039801-12039823 AGAAGCTATGCAGCCAGGACAGG + Intronic
1004078029 6:12363319-12363341 ATAAGCTATAGAAACAGGCCAGG + Intergenic
1004722762 6:18282361-18282383 TTAAGATATCTGGCCAGGCGTGG + Intergenic
1005606387 6:27482110-27482132 ATAAGCTGTCAACCCAGGCAAGG + Intergenic
1007643964 6:43366512-43366534 ATAAGCTACCATGCCTGGCCCGG - Intronic
1007989587 6:46241183-46241205 ATAAGCTATTTTGCCAGGCTGGG + Intronic
1010800187 6:80166363-80166385 AAAAAATTTCTAGCCAGGCCCGG + Intronic
1011528273 6:88290689-88290711 ATAAGGCAGCTAGGCAGGCCAGG + Intergenic
1012568227 6:100687515-100687537 AAAAACTATTTAGCCAGGCATGG - Intronic
1013416068 6:109925782-109925804 AGAAGCTATCTAGCCTTGCTGGG - Intergenic
1014779899 6:125552455-125552477 GTAAGCCATCTCGCCTGGCCTGG - Intergenic
1014797211 6:125739850-125739872 ATCAGCTATATCGCCAGGCATGG + Intergenic
1015268443 6:131313856-131313878 AAAAACTATTTAGCCAGGCACGG - Intergenic
1015535438 6:134262761-134262783 ATAAACCATCTCGCCTGGCCAGG - Intronic
1015844758 6:137508696-137508718 ATAAGATATCTAGAGAGGCCGGG + Intergenic
1016372343 6:143388469-143388491 ATAAGCCACCGCGCCAGGCCAGG + Intergenic
1017204181 6:151787097-151787119 ATAAGCAATGCAGCCAGGCACGG - Intronic
1018199947 6:161385208-161385230 ATAAGCCACCTCGCCCGGCCGGG + Intronic
1018879312 6:167860824-167860846 ATCACCTACCTAGACAGGCCTGG - Intronic
1019221517 6:170477195-170477217 ATCAGCTCTCTTACCAGGCCGGG + Intergenic
1019500621 7:1362729-1362751 ATGAGCCATCGCGCCAGGCCAGG - Intergenic
1019729120 7:2620719-2620741 AAAAGATATCTGGCCAGGCATGG + Intergenic
1022158553 7:27684809-27684831 AAAAGGAATCTAGCCAGGCACGG + Intergenic
1024138555 7:46436058-46436080 ATAAACTATTAGGCCAGGCCTGG - Intergenic
1026197891 7:68188658-68188680 ATGAGCCACCTAGCCTGGCCTGG + Intergenic
1026529420 7:71184420-71184442 ATAAGCTTTCTAGAAAGGTCAGG - Intronic
1026982005 7:74532396-74532418 ATAAAATAAATAGCCAGGCCTGG + Intronic
1027195984 7:76030719-76030741 ACAACATATCTAGCCAGGCGTGG + Intronic
1028490028 7:91400853-91400875 ATCAGCCATCTGGCCAGGCGTGG + Intergenic
1029064435 7:97835181-97835203 ATAAGATAATTAGCCAGGCACGG + Intergenic
1029198199 7:98821206-98821228 ATGAGCTAACATGCCAGGCCAGG + Intergenic
1032169232 7:129570370-129570392 AAAATCTATCCAGGCAGGCCAGG - Intergenic
1032952066 7:136925945-136925967 ATAGTCTAGCTAGCCAGGCATGG + Intronic
1033911104 7:146264146-146264168 AAAAGCAATCTATCCAGGCCAGG + Intronic
1034473911 7:151271671-151271693 ATGAGCCATCGAGCCTGGCCAGG - Intronic
1035198918 7:157247179-157247201 AGAATATATCTAGTCAGGCCAGG - Intronic
1036523602 8:9515002-9515024 AAAAGATATTTAGCCAGGCATGG - Intergenic
1036570584 8:9976754-9976776 ATCAGAAATCTAGACAGGCCAGG + Intergenic
1037943911 8:22974619-22974641 AGAAGCTATAAGGCCAGGCCAGG + Intronic
1039590035 8:38738397-38738419 ATAATTTATGTAGCCAGGCATGG - Intronic
1041516572 8:58705937-58705959 ATAGGCAATCTGGCCAGGCGCGG - Intergenic
1042549463 8:69981373-69981395 AAAAGCTATTGAGCCAGGCGCGG - Intergenic
1044139644 8:88634854-88634876 ATAGTCTATGTAGCCAGGCATGG + Intergenic
1051693141 9:19738826-19738848 ATCATATATCTAGCCAGGCGTGG + Intronic
1053385137 9:37681055-37681077 ATAAGAAAACTAGCCAGGCGTGG + Intronic
1053545063 9:39014252-39014274 ATCTGCTATCTGGCCAGGCACGG - Intergenic
1054941728 9:70750435-70750457 ATAAGTTAACAAGTCAGGCCTGG + Intronic
1057497206 9:95570815-95570837 AGATGCTTTCAAGCCAGGCCTGG + Intergenic
1058852168 9:109023542-109023564 ATAAGCAATGTGGCCAGGCGCGG + Intronic
1060598626 9:124863001-124863023 ATAAACAAATTAGCCAGGCCTGG - Intronic
1061072675 9:128321075-128321097 ATAAGTAATCTAGCTAGGCGTGG - Intronic
1185983525 X:4805809-4805831 ATGAGCTATCTGAGCAGGCCTGG - Intergenic
1186163157 X:6799501-6799523 TTTAGCTATCAATCCAGGCCTGG + Intergenic
1186454077 X:9697613-9697635 ATACGATAACTAGCCAGGCGTGG + Intronic
1187165462 X:16800528-16800550 GTAAGCCACCGAGCCAGGCCTGG + Intronic
1187457828 X:19458386-19458408 ATCAGCTAGCTGGCCAGGCACGG + Intronic
1188069326 X:25699942-25699964 ACCTGCTATCTAGCCAGGCATGG - Intergenic
1188386771 X:29570929-29570951 ATAATTTGTCTAGCCAGGCGCGG + Intronic
1188546177 X:31309939-31309961 ATAAGCTATCTAGCCAGGCCAGG + Intronic
1189809079 X:44764274-44764296 GTAAGCTTTCTGGCCAGGCATGG + Intergenic
1190396022 X:49984905-49984927 ATAAGCAATATTGCCAGGCACGG - Intronic
1190765764 X:53474423-53474445 ATAACTTATTTAGCCAGGTCTGG - Intergenic
1192127299 X:68514073-68514095 ATAAAAAAACTAGCCAGGCCTGG + Intronic
1192276985 X:69642833-69642855 GTAAGCTACATAGCCAGGACTGG + Intronic
1192618299 X:72650875-72650897 ATAAACTAATTAGCCAGGCGTGG - Intronic
1192744976 X:73929758-73929780 ATAAGGGATATGGCCAGGCCCGG - Intergenic
1193983883 X:88217181-88217203 AGTAGCTATCTTGCAAGGCCAGG - Intergenic
1196976150 X:121159817-121159839 ATAAGACATCTAGCCTGGCTGGG + Intergenic
1197801983 X:130360184-130360206 ATAAGAAAACTAGCCTGGCCAGG - Intronic
1199209371 X:145188815-145188837 ATAAGCCAACGTGCCAGGCCTGG - Intergenic
1200297289 X:154933361-154933383 ATAAGCTATCTGGCCAAGTTGGG + Intronic