ID: 1188546219

View in Genome Browser
Species Human (GRCh38)
Location X:31310482-31310504
Sequence TGTATTTACATATTAACACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 503
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 472}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188546217_1188546219 -3 Left 1188546217 X:31310462-31310484 CCTTTATTTGATAAAGCACTTGT 0: 1
1: 0
2: 1
3: 35
4: 446
Right 1188546219 X:31310482-31310504 TGTATTTACATATTAACACAGGG 0: 1
1: 0
2: 2
3: 28
4: 472

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188546219 Original CRISPR TGTATTTACATATTAACACA GGG Intronic
900001822 1:18670-18692 GGTATTTACACATGCACACATGG + Intergenic
900021542 1:189193-189215 GGTATTTACACATGCACACATGG + Intergenic
903196290 1:21691011-21691033 TGTATTTAATTTTTAACACTTGG - Intronic
904133431 1:28292333-28292355 TATATTTAGATATTGAGACATGG - Intergenic
904192178 1:28754188-28754210 TGTATTTATAGATCAACAAATGG + Intronic
905456797 1:38093893-38093915 TGTTTTTAATTATTAACACACGG + Intergenic
906440054 1:45834239-45834261 TTTATTTAAATAGTAACAAAAGG + Intronic
906858078 1:49329855-49329877 TGCATCTACATAATATCACAAGG + Intronic
908144413 1:61223948-61223970 TCTATTTACATATTACCAGAGGG + Intronic
908880247 1:68723743-68723765 TTTATTAATATATTAATACATGG - Intergenic
908920311 1:69182903-69182925 TGTATTTTCATAATAACTCTAGG + Intergenic
909110955 1:71476722-71476744 TGTTGTTACATATTAATACTGGG + Intronic
909829314 1:80166001-80166023 TTTATTTACATATTTATTCACGG - Intergenic
909929047 1:81473823-81473845 TGTATCTACATCTAAACAAATGG - Intronic
910317848 1:85907829-85907851 TTTATTTATCTATTAACCCAAGG + Intronic
911031192 1:93490350-93490372 TGTATTTACTTGGAAACACAAGG - Intronic
911284732 1:95975439-95975461 TGTATTTACCCTTTAATACAAGG + Intergenic
911583053 1:99657640-99657662 TTTATTTACATATTGAGATAAGG - Intronic
912114237 1:106384553-106384575 AGCATTTACATTTTAACAAATGG - Intergenic
913350058 1:117847958-117847980 TATATTTAAATATTTAGACAAGG + Intergenic
913350667 1:117855221-117855243 TGAATTAACAAATTAACACATGG - Intergenic
916421225 1:164639667-164639689 TTTATTTATTTATTAAAACAGGG + Intronic
917349537 1:174062687-174062709 TTTATTTACATATTTAAACAGGG - Intergenic
917382078 1:174422560-174422582 TGTATTTGCATATCAATAAAAGG - Intronic
917389489 1:174519176-174519198 TATATATATATATTTACACATGG - Intronic
917491724 1:175503941-175503963 TGGGTTTACATATTGACAAAGGG + Intronic
917819451 1:178747584-178747606 AGGAGTTACATCTTAACACAGGG - Intronic
918431148 1:184462100-184462122 TGTTTTAACAAATTAACAAAAGG - Intronic
918746027 1:188200910-188200932 TGCATTCACCTATCAACACATGG + Intergenic
919227144 1:194719436-194719458 TATATTTATTTATTAACACTTGG + Intergenic
919249764 1:195038561-195038583 TATATTCACATATTAAGAGATGG - Intergenic
919718296 1:200803803-200803825 TGTTTTTACATACTATAACAAGG + Intronic
920640660 1:207748849-207748871 TGGCATTACATATCAACACAGGG - Intergenic
920663988 1:207946592-207946614 TGTTTTTAAATATTCACTCAAGG - Intergenic
920875646 1:209832875-209832897 TTTATTTATATATTGAGACAGGG - Intronic
921272743 1:213487387-213487409 TGTATTTATTTATTGAGACAGGG - Intergenic
921442411 1:215203106-215203128 TGTAGTTACACAGTAACAGATGG - Intronic
921613521 1:217239699-217239721 TGTATTTAAATATAAACAATTGG - Intergenic
921696045 1:218211911-218211933 TGTACTTATATATAAACACAGGG - Intergenic
921753032 1:218819437-218819459 TCTATTTGCACTTTAACACAAGG + Intergenic
922273069 1:224052043-224052065 TTTATTTACTTATTGAGACAGGG - Intergenic
922407328 1:225328763-225328785 GTTACTTACATATTAACGCATGG - Intronic
922623850 1:227017047-227017069 TGTATTTTTATTTTAACAGAAGG - Exonic
922723452 1:227910583-227910605 TTTATTTTTATCTTAACACAAGG + Intergenic
923206496 1:231764007-231764029 CTTATTTATATATTAACACAGGG - Intronic
1063452457 10:6159774-6159796 TTTATTTACTTATTGAAACAGGG + Intronic
1065013258 10:21438689-21438711 TCTATATACATATTGAGACAGGG + Intergenic
1065444511 10:25784272-25784294 TGTCTAGACAGATTAACACAGGG - Intergenic
1068005434 10:51387752-51387774 TGTATTTTCATTTCTACACATGG + Intronic
1068325677 10:55483008-55483030 TGTATATAAACATTAACTCAAGG + Intronic
1068421269 10:56796784-56796806 TGTTTTTACATACATACACAAGG - Intergenic
1068594661 10:58889718-58889740 TGTGATTACAGACTAACACAAGG + Intergenic
1068686090 10:59871355-59871377 TGTATACACATGTAAACACAAGG - Intronic
1068773246 10:60845581-60845603 TGTAATTACATATTACAAAATGG - Intergenic
1068906997 10:62337705-62337727 TGCATTTACCTATTGACAAAAGG + Intergenic
1069387918 10:67901355-67901377 TGGATTTTCATATCAAAACAGGG + Intronic
1069401768 10:68055663-68055685 TATATTTGAATATTAACAAAAGG - Intronic
1069854270 10:71431019-71431041 TGTATGTTCATATTAGCACATGG - Intronic
1069931559 10:71885701-71885723 TGTATATATATATACACACATGG + Intergenic
1069998458 10:72357939-72357961 TGTATTTATTTATTGAGACAGGG - Intergenic
1070034430 10:72708085-72708107 TGTATTTGCTTATTCTCACAAGG + Intronic
1070425378 10:76281950-76281972 TGTATTTACATTTTCAGGCAGGG - Intronic
1071775256 10:88779440-88779462 TATTTTTCCATATTATCACATGG - Intergenic
1072395648 10:95037649-95037671 TGTATTTCCATAATGACAGATGG - Intronic
1072417283 10:95259726-95259748 TCTATTCAAATATTATCACAAGG - Intronic
1072466737 10:95670362-95670384 TTTATTTATTTATTAAGACAGGG + Intronic
1072846160 10:98832714-98832736 TGTATTTAGATAATAAAAAAAGG + Intronic
1073651989 10:105370916-105370938 AGTAGTTAAATAGTAACACACGG - Intergenic
1073681287 10:105706464-105706486 TGTATGTACACATACACACAGGG - Intergenic
1073928098 10:108540817-108540839 TGAATTTACAGATTAATTCAGGG - Intergenic
1074480834 10:113819077-113819099 TTTATTTACTTATTTAGACATGG + Intergenic
1075435027 10:122432379-122432401 TGTATTTACTTCATCACACAAGG - Exonic
1079529702 11:21436060-21436082 TGTATTTATTTATTTAGACACGG + Intronic
1079665890 11:23104723-23104745 AGTATTTGCATATTAAAATAAGG - Intergenic
1080527457 11:33140200-33140222 TGTATTAACTCATTAAAACAAGG - Intronic
1080719442 11:34835059-34835081 TGTATGTACATATAAATATATGG - Intergenic
1080816325 11:35760690-35760712 TGTATTTATATAGTACAACATGG + Intronic
1080941999 11:36929203-36929225 TGTCTTTCCATATCAACATAGGG - Intergenic
1081301250 11:41454815-41454837 TGTATTTATATTTTTATACAGGG - Intronic
1081660450 11:44884976-44884998 TTTAGTTACAAATTAACACTGGG - Intronic
1082572435 11:54759818-54759840 TGTATTACCATTTTAACATAAGG - Intergenic
1083548792 11:63569431-63569453 GGTATTCACATATAACCACATGG - Intergenic
1084137038 11:67192269-67192291 TGTTTTTAAACATTAACAAATGG + Intronic
1084461323 11:69298199-69298221 TTTATCTCCATAGTAACACAAGG + Intronic
1084571756 11:69963955-69963977 TGTATTTAAAAAGTGACACATGG - Intergenic
1085001041 11:73035197-73035219 TGTATGTACGTACTAAGACAAGG + Intronic
1086242722 11:84715122-84715144 TGTTTTTATATATTAAGATAGGG - Intronic
1086461650 11:87011767-87011789 TATATTTAAGTATGAACACAGGG + Intergenic
1087257889 11:95977318-95977340 TATATTTACAAACTAGCACAGGG + Exonic
1087366208 11:97222764-97222786 TTTATTTACAAATAAAAACATGG + Intergenic
1087559792 11:99773493-99773515 TGTATTTAAATACTAACCTAGGG + Intronic
1088353710 11:108919483-108919505 TGCATTTATATAGGAACACAAGG - Intronic
1088381156 11:109194217-109194239 AGTATTTATATATTTAAACATGG + Intergenic
1088395451 11:109362989-109363011 TGCACTTACTTATTAACAGATGG - Intergenic
1089083659 11:115798659-115798681 AGTCTTTCCATATTAACACCTGG + Intergenic
1089120043 11:116127250-116127272 CGTCTGTATATATTAACACATGG + Intergenic
1090020559 11:123124858-123124880 TGTATTTAAATATATACATATGG + Intronic
1090350545 11:126105094-126105116 GTTATTTACATAATAATACAGGG - Intergenic
1090637769 11:128702559-128702581 TCTATTTATATATTAACATGGGG + Intronic
1091374903 12:18775-18797 GGTATTTACACATGCACACATGG + Intergenic
1091517697 12:1201042-1201064 TGTACTTACATTTTTACAGAAGG - Intronic
1092553567 12:9530360-9530382 TGTATTTAAATATTTAGACTAGG + Intergenic
1092749504 12:11705623-11705645 TACATTAACATATTAACAAAAGG + Intronic
1094416332 12:30219905-30219927 TATATTTATATATTTACATATGG + Intergenic
1094518531 12:31160266-31160288 TGTATTTAAATATTTAGACTAGG - Intergenic
1094754456 12:33450406-33450428 AGTGTTTACATATAAACACAGGG - Intergenic
1094775216 12:33718967-33718989 TGTTTTTACATATCAACAAATGG - Intergenic
1095548399 12:43400777-43400799 AGTATGTACATGTTCACACATGG + Intronic
1096922559 12:55103193-55103215 TGTATTTAGAAATCAAGACATGG + Intergenic
1097381170 12:58897367-58897389 TATATTAAAATATTAATACATGG - Intronic
1097763483 12:63495902-63495924 TGTATTTTAATATTAGCACATGG - Intergenic
1098110094 12:67112517-67112539 TTTATTTACTTATTGAGACAGGG - Intergenic
1098323186 12:69271834-69271856 TGTTTTTACACATTAAAAAAAGG - Exonic
1098407434 12:70141052-70141074 TAAATTTACATATTTACGCATGG + Intergenic
1099154280 12:79155395-79155417 TGGATTTCTATATTAACACTGGG - Intronic
1099604191 12:84781022-84781044 TGTATGTACATATCTACAGAGGG - Intergenic
1100096591 12:91046657-91046679 TGTATATATATATACACACATGG - Intergenic
1100129903 12:91479447-91479469 TGTATTTACATTTCAACATAGGG + Intergenic
1100451295 12:94709381-94709403 CCTATTTACATAATAACACCAGG + Intergenic
1101321429 12:103676485-103676507 TGAATTTTTATTTTAACACAGGG + Intronic
1101742581 12:107512308-107512330 TGCATTTCCTTATTTACACATGG + Intronic
1102532924 12:113560029-113560051 TTTCTTTACATTTGAACACAGGG + Intergenic
1102931464 12:116865518-116865540 TTTATTTACTTATTGAGACAGGG - Intronic
1103155353 12:118680139-118680161 TGTGATTACTTTTTAACACAGGG + Intergenic
1103665860 12:122565115-122565137 TTTTTTTAAATATTACCACATGG + Intronic
1104601763 12:130159643-130159665 TTTATTTACATATTTAACCATGG - Intergenic
1106275637 13:28203308-28203330 TTTATTTACTTATTGAGACAGGG + Intronic
1107305774 13:39017162-39017184 TGTTTTTTGATATAAACACATGG - Intronic
1108332371 13:49401756-49401778 TTTATTTACATTTTTAAACAAGG - Intronic
1109060709 13:57615874-57615896 TTTATTTATTTATTAAGACAGGG - Intergenic
1109372040 13:61435292-61435314 TTTCTTATCATATTAACACAGGG + Intergenic
1109871127 13:68335551-68335573 TGTATATATATATTTAAACATGG + Intergenic
1110917179 13:81035590-81035612 TGTCTTTATATAATAATACAAGG - Intergenic
1111014957 13:82367917-82367939 TGTATTCAGATATTACCAAATGG - Intergenic
1111264421 13:85789290-85789312 TGTATTGCTATATTAACATATGG + Intergenic
1111436140 13:88210796-88210818 TGTATTTACAGATTAATTGAAGG + Intergenic
1112023235 13:95390247-95390269 TGTATTTATTTATTGAGACAAGG + Intergenic
1115261177 14:31456019-31456041 TATATTTCCAAATTAGCACAGGG + Intronic
1116589914 14:46759484-46759506 TTTATTTACATAGAAACAGAGGG - Intergenic
1117526185 14:56607677-56607699 TGTATGTACATATATACATAGGG + Intronic
1117927382 14:60796950-60796972 TGTATATAGATATACACACATGG + Intronic
1118098451 14:62566780-62566802 TGTATGTATATATTCACACACGG - Intergenic
1118135989 14:63028296-63028318 TGAAATAACATATTAACAGATGG - Intronic
1118171192 14:63390727-63390749 TCCATATACATATTAACAAATGG - Intronic
1118558228 14:67050038-67050060 ACTATTTGCATGTTAACACAAGG - Intronic
1120301744 14:82716036-82716058 TGCATATATATATTCACACATGG + Intergenic
1120814099 14:88835639-88835661 TATGTTTACTTATTAACAAATGG - Intronic
1120847645 14:89139969-89139991 TGTATTTACTTTTCAACTCAGGG + Intronic
1121566146 14:94910668-94910690 TGTCCTTACATATGAACATATGG + Intergenic
1122514313 14:102296381-102296403 TGTATATACATATAAATATATGG - Intronic
1123504254 15:20923261-20923283 AGTATTTACACAATAAAACAGGG + Intergenic
1123561499 15:21496958-21496980 AGTATTTACACAATAAAACAGGG + Intergenic
1123597743 15:21934238-21934260 AGTATTTACACAATAAAACAGGG + Intergenic
1123673884 15:22689157-22689179 CCTATTTACAAATTAGCACATGG - Intergenic
1123903337 15:24897933-24897955 TGTATTAATACATTAATACAGGG - Intronic
1124074096 15:26426459-26426481 TGTAGTTTAAAATTAACACAGGG + Intergenic
1124325890 15:28762147-28762169 CCTATTTACAAATTAGCACATGG - Intergenic
1125450915 15:39806165-39806187 TGTAGTTAAATTTTAACATAGGG + Intronic
1126337387 15:47601735-47601757 TCTATTTTCCAATTAACACATGG - Intronic
1126591233 15:50341994-50342016 TGGATTTATATTTTAATACAGGG + Intronic
1126629955 15:50724189-50724211 TCTATTTACATAGTAAAACCAGG - Intronic
1126915704 15:53463927-53463949 TGTTTTTACCTAATAACACTTGG - Intergenic
1129022775 15:72537893-72537915 TGTATATACATTTTCATACATGG + Intronic
1130701866 15:86191785-86191807 TATAATAACATATGAACACATGG + Intronic
1131290588 15:91103500-91103522 TGCATTTACATAATATCATATGG + Intronic
1131650444 15:94392441-94392463 TATATGTGCATATTAAAACAGGG + Intronic
1131651673 15:94406420-94406442 TGTATTTACATAGTGACACCGGG + Intronic
1132451687 15:101972270-101972292 GGTATTTACACATGCACACATGG - Intergenic
1202969844 15_KI270727v1_random:224082-224104 AGTATTTACACAATAAAACAGGG + Intergenic
1132455205 16:18359-18381 GGTATTTACACATGCACACATGG + Intronic
1132848923 16:2015331-2015353 TGTATTTACTTTTTGAGACAGGG + Intronic
1133624805 16:7561251-7561273 TTTGTTTACATATTACCCCATGG + Intronic
1134141261 16:11721494-11721516 TATATATTCATAATAACACATGG + Intronic
1135252276 16:20910951-20910973 TGTATTTTCATATGAAACCATGG + Intronic
1135334367 16:21588411-21588433 TGTATTTTCATCTTGACAGATGG - Intergenic
1135872935 16:26168929-26168951 TGTATTAATATATAAATACAGGG + Intergenic
1136940224 16:34517334-34517356 TGTAGTAACATATTAAAATAAGG + Intergenic
1136959596 16:34831232-34831254 TGTAGTAACATATTAAAATAAGG - Intergenic
1137257892 16:46792420-46792442 TGTATGTATATATACACACAGGG - Intergenic
1139221165 16:65183718-65183740 TGTATATATATATATACACAAGG - Intergenic
1139562530 16:67752645-67752667 TATATATATATATTTACACAAGG + Intronic
1140983359 16:80133138-80133160 TGTATTTATTTATTGAGACAGGG + Intergenic
1144124853 17:12193569-12193591 TGTGGTTATATATCAACACAAGG + Intergenic
1145926579 17:28651941-28651963 GGAATTTACAAATTAGCACAGGG + Intronic
1146130053 17:30265142-30265164 TTTGTTTACATATAAACACTGGG + Intronic
1146247118 17:31296358-31296380 TGTATTTGCATATTAAAAGAAGG - Intronic
1148560018 17:48600687-48600709 TGTATTTACATATTCCCCCAAGG - Intronic
1148884876 17:50765250-50765272 TGTTTTTACTTTTTAAAACATGG + Intergenic
1150070630 17:62147182-62147204 TGTATTTACAAATTTACAATGGG + Intergenic
1150269433 17:63853619-63853641 TTTATTTATATATTGAGACAGGG - Intergenic
1150734115 17:67721147-67721169 TGAATTTACAGATTAAAGCAGGG + Intronic
1152144148 17:78557769-78557791 TGTATTTTAATATTTAGACATGG - Intronic
1153289935 18:3490866-3490888 TGTTTTTAAATATTATCAAATGG - Intergenic
1153342133 18:3986277-3986299 TGTGTTTCCATCTTAACAAAAGG - Intronic
1153565072 18:6411049-6411071 TGTATTTGCATAATAAAATATGG + Intronic
1154388978 18:13920299-13920321 TGTATTTGGAAATTAACAGAGGG - Intergenic
1155449400 18:25947546-25947568 TTTATTTATTTTTTAACACAGGG - Intergenic
1155919929 18:31593480-31593502 TGTATTAACCCATTAACAAAAGG + Intronic
1156606439 18:38672295-38672317 TGCATTTATATATTAATTCATGG + Intergenic
1158041938 18:53104975-53104997 TGCATTTACATAATCACAGATGG - Intronic
1158662549 18:59401679-59401701 TGTGTCTGCATATTCACACATGG + Intergenic
1158787299 18:60730259-60730281 TATATTTAGAGATTAAGACATGG - Intergenic
1158804637 18:60955542-60955564 GGTATTTTCAACTTAACACAGGG - Intergenic
1158953095 18:62515344-62515366 TGTATTTACTTCTTTACATAAGG + Intergenic
1159714332 18:71803262-71803284 TGTATATATATATTCACAGAGGG + Intergenic
1159837865 18:73361590-73361612 TGCATGTACATAGTAACAAAAGG - Intergenic
1160633574 19:60278-60300 GGTATTTACACATGCACACATGG + Intergenic
1160892166 19:1384816-1384838 TTTATTTATTTATTAAGACAGGG + Intronic
1161310987 19:3593886-3593908 TTTATTTACTTATTTACAGATGG + Intergenic
1162271246 19:9617525-9617547 TTTATTTATATATAAAAACAGGG + Intronic
1162276387 19:9658811-9658833 TTTATTTATATATAAAGACAGGG + Intronic
1163355308 19:16806704-16806726 TGTATTTATTTATTAAGAGACGG - Intronic
1164875477 19:31682533-31682555 TGTATTGACATTTAAAAACATGG + Intergenic
1166010750 19:39940474-39940496 TGTATTATCAGATTAACAGAAGG - Intergenic
1167700889 19:51044837-51044859 TGTATTTATTTATTGAGACAAGG + Intergenic
1168711539 19:58503338-58503360 TGTATTGACGTATGGACACATGG + Intronic
925022302 2:581246-581268 TGTGTTTGCATATTATCATATGG + Intergenic
925543189 2:4988818-4988840 TCTATTTACAAATTAAAAGATGG - Intergenic
926003746 2:9355053-9355075 TGTATTAAGATGTTAACAGAAGG - Intronic
926817241 2:16811440-16811462 TTTATTTACATTTTGAGACAGGG + Intergenic
927431900 2:23033692-23033714 GGTATTTAAATATTAACACATGG + Intergenic
928002334 2:27535366-27535388 TCTATTTTCATCTCAACACATGG - Intergenic
928046830 2:27942817-27942839 TTTATTTATTTATTAAGACAGGG + Intronic
928773261 2:34727546-34727568 TGTATTGTAATAATAACACATGG + Intergenic
928808347 2:35189989-35190011 GTTATTTACTTATTTACACACGG - Intergenic
928968423 2:37000382-37000404 TGTTTATAACTATTAACACAAGG + Intronic
930160016 2:48145207-48145229 TTTATTTAGACATTAACAAAAGG + Intergenic
931023767 2:58083793-58083815 TGTATTTAAATATTTAAATATGG + Intronic
931764113 2:65439433-65439455 TGTGTTTGCAATTTAACACAGGG + Intergenic
932096261 2:68851746-68851768 ACTATTTACATAATAACACCAGG + Intergenic
932189250 2:69725379-69725401 TTTATTTATATATAAATACATGG + Intronic
932529329 2:72510627-72510649 TTTATTTATATATTAAAAAAGGG + Intronic
933014938 2:77113325-77113347 TGTAATACCATTTTAACACAAGG + Intronic
934061128 2:88295186-88295208 TGTCTTTACATAGTAGCATATGG - Intergenic
934486598 2:94719713-94719735 TGTATTAACATATTTATATAAGG + Intergenic
935503105 2:103866364-103866386 TGTATTTACATTTTGACATTTGG - Intergenic
935518380 2:104073969-104073991 GATATATACATATTAAAACAAGG + Intergenic
935723320 2:105998718-105998740 TGTATTTACATTTTCACATTGGG + Intergenic
936171046 2:110175022-110175044 TGTCTTTAAACAGTAACACAAGG + Intronic
936567898 2:113594737-113594759 GGTATTTACACATGCACACATGG - Intergenic
937433613 2:121861876-121861898 TGTATATATATATATACACAGGG + Intergenic
937595870 2:123672533-123672555 CGTATTTACATTTAAACTCAGGG - Intergenic
937776815 2:125787619-125787641 TGGATGTATGTATTAACACATGG - Intergenic
937859065 2:126694104-126694126 TGTATATATATATTTACCCAGGG - Intronic
938389221 2:130892110-130892132 TCTCTTTAGATATTAACATAAGG - Intronic
938679258 2:133672727-133672749 TTTATTTACAAAAAAACACATGG + Intergenic
938838889 2:135138579-135138601 TGTGTGTACATATTAATACATGG + Intronic
938988668 2:136605437-136605459 GGTATCTACATTTGAACACATGG - Intergenic
939361661 2:141180609-141180631 TGTCTTTACAAATAAAAACAGGG + Intronic
939689974 2:145246755-145246777 TATATTCACATACTTACACATGG - Intergenic
941336935 2:164257491-164257513 TATATTTTCAAAATAACACATGG + Intergenic
941501786 2:166288085-166288107 TATATATATATATAAACACATGG - Intronic
941764499 2:169281852-169281874 TGTATTTACATATCTATATATGG - Intronic
942497864 2:176558637-176558659 TGAAGTTACATATTAATACTAGG - Intergenic
942894845 2:181040038-181040060 TGTATTTATAATTTACCACATGG + Intronic
943810399 2:192180540-192180562 TGTATTTTAATGTTAATACAGGG + Intronic
943818196 2:192283080-192283102 TGTATATACATATGTATACATGG - Intergenic
943983252 2:194583788-194583810 TTTCTTTGCATATTAACAGATGG + Intergenic
944796911 2:203196390-203196412 TCTCTTTTCATATTAATACATGG - Intronic
944829176 2:203515031-203515053 TGTATGTACACATGCACACAGGG - Intronic
945140127 2:206676951-206676973 TATATTTATTTATTAAGACAGGG + Intronic
945187201 2:207151268-207151290 CATATTCACATGTTAACACAAGG - Intronic
946503504 2:220275016-220275038 TGTATTAACACATACACACATGG + Intergenic
947195197 2:227557333-227557355 TGCTTTTACAAATTAACAGAAGG - Intronic
947338619 2:229113619-229113641 TGTGTATACATATTTACAGATGG + Intronic
947390843 2:229637842-229637864 GGTATTTCCATATTAACAAATGG - Intronic
948237492 2:236401528-236401550 TGTATTTACACATTTATCCATGG - Intronic
1169482258 20:5994940-5994962 TTTATTTAACAATTAACACATGG - Exonic
1169876522 20:10303324-10303346 AGTATTTACATAGTAAGATAGGG - Intronic
1170177018 20:13482945-13482967 CTTATTAACATATTAACATATGG + Intronic
1170422460 20:16206585-16206607 TGTATTTCCATATCATCACTGGG + Intergenic
1171295023 20:24009828-24009850 TAAATTTACATAGTTACACATGG + Intergenic
1171296907 20:24025250-24025272 TGTATTTACACAGTAACTAATGG - Intergenic
1171936103 20:31277136-31277158 TGTATATAGACATTAACATAAGG - Intergenic
1171976959 20:31601359-31601381 TGTATTTATATTTTGAGACAGGG + Intergenic
1173921029 20:46745012-46745034 TGTTTTTGCATATTAAATCACGG + Intergenic
1174383860 20:50174886-50174908 TTTATTTATTTATTGACACAGGG + Intergenic
1174649987 20:52116767-52116789 TCTATATACATTTTAACACGAGG + Intronic
1174822866 20:53742658-53742680 TTTATTTATTTATTGACACAGGG + Intergenic
1174954456 20:55081670-55081692 AGTATTTCTATATTAAAACAAGG - Intergenic
1177278382 21:18946480-18946502 TGTATTTACATTTTAAAAACAGG - Intergenic
1177502667 21:21978377-21978399 TTTATTTATCTATTGACACAGGG + Intergenic
1177538133 21:22456227-22456249 TGTATTTATATAAAAACACTGGG + Intergenic
1177703480 21:24669705-24669727 TGTGTGTACATATTAACCCTAGG + Intergenic
1177851213 21:26350907-26350929 GGTATTTCCATTTCAACACATGG + Intergenic
1179221249 21:39409380-39409402 TGTAGCTACATATAAAGACAGGG + Intronic
1179388582 21:40966461-40966483 TCTTTGTATATATTAACACATGG + Intergenic
1179607822 21:42528938-42528960 TTTATTTAAATATTAACACTGGG - Intronic
1181328302 22:22068592-22068614 TATATTTAAATATTTACCCAAGG - Intergenic
1182485711 22:30637287-30637309 TTTATTTACTTATTTAGACAGGG + Intronic
1182840781 22:33388022-33388044 TCTATGCACATAATAACACATGG + Intronic
1183936168 22:41263693-41263715 CATTTTTACATCTTAACACAGGG + Intronic
1184672477 22:46022344-46022366 TATATTTAAATACTAACACGTGG - Intergenic
949479958 3:4484303-4484325 TCTATTTACATATTACCACATGG + Intergenic
952024632 3:29064283-29064305 TGTATTTATATACTGACAAAAGG + Intergenic
952135091 3:30409998-30410020 TGCATTTACATTTTACCACCTGG + Intergenic
952812744 3:37419724-37419746 TTTATTTATTTATTAAAACAGGG - Intronic
955133508 3:56193175-56193197 TATATTTTCTTATTAAAACAAGG - Intronic
955464070 3:59217669-59217691 TATATATACATATATACACATGG + Intergenic
956205118 3:66747583-66747605 TGTATTTTCAAATGAACAAATGG - Intergenic
956554685 3:70506004-70506026 TCTATATTCATATTAACTCATGG - Intergenic
956583100 3:70835659-70835681 TTTCTATACATATTTACACATGG + Intergenic
957167981 3:76699622-76699644 TGTATTTAAACATTTGCACATGG - Intronic
957635312 3:82776224-82776246 TGTCATTACATATTGACAAAAGG + Intergenic
958775152 3:98473691-98473713 TGTATACAAATATTAACACTTGG + Intergenic
958792812 3:98671226-98671248 TGTATTTATTTATTGAGACAGGG - Intergenic
958822022 3:98986479-98986501 TTTATTTACATTTTAGCAAAAGG + Intergenic
959820372 3:110728487-110728509 TATATTGAAATATTAAAACAGGG + Intergenic
960601884 3:119467261-119467283 TGTATTTCCATATTTCCACAAGG + Intronic
960822243 3:121747418-121747440 TATATATACATATATACACATGG + Intronic
962044159 3:131737944-131737966 TGCATTTACTTATTTACTCAAGG + Intronic
962356508 3:134698784-134698806 TGTCTTTGTATTTTAACACAGGG + Intronic
962947033 3:140181215-140181237 TTAATCTACATATTAACACCAGG - Intronic
963207658 3:142652912-142652934 TGACTTTACTTTTTAACACATGG - Intronic
963212510 3:142708739-142708761 TGTATTTATATACTAACCTAAGG + Intronic
963681224 3:148379947-148379969 TGTAATAACTTACTAACACAAGG + Intergenic
963964488 3:151350387-151350409 TGTATTAATATTTTAATACAAGG - Intronic
963964489 3:151350390-151350412 TGTATTAAAATATTAATACAAGG + Intronic
964204628 3:154158865-154158887 GGTCTTTTTATATTAACACAGGG - Intronic
964220135 3:154334061-154334083 TATATTTACATATATACATATGG - Intergenic
964605079 3:158552362-158552384 TGTATAGAGATATTTACACATGG + Intergenic
964741591 3:159971799-159971821 TCTGTTTACACATGAACACATGG + Intergenic
964751374 3:160056938-160056960 TATATTTATGTATTAAGACAGGG - Intergenic
965214383 3:165842847-165842869 TGGCTTAAAATATTAACACATGG - Intergenic
965431207 3:168591262-168591284 TTTATTTACATATTTATAAAGGG - Intergenic
966153188 3:176888419-176888441 AGTAGTTTTATATTAACACAAGG + Intergenic
966290608 3:178353013-178353035 AATATTTAAATATTAACAGATGG + Intergenic
966545832 3:181146873-181146895 TTTTTTTCCATATTAAAACATGG - Intergenic
967529247 3:190530185-190530207 TGTATTCACATATTATCTCCCGG - Intronic
967646718 3:191933449-191933471 TGTATTTACATACTCACATGTGG - Intergenic
968709922 4:2106966-2106988 TGTATTTACATATTAATGTAAGG + Intronic
970139280 4:12963238-12963260 TGTATTTTCATCTGTACACAGGG - Intergenic
970289873 4:14560456-14560478 TGACTTTACATAATTACACATGG - Intergenic
970653619 4:18205519-18205541 TGTATTTATATATAGACATATGG + Intergenic
971145443 4:23971134-23971156 TGTATATACATATGAAACCATGG - Intergenic
971613977 4:28763925-28763947 TGTATATTCATAGAAACACATGG - Intergenic
971646492 4:29213028-29213050 TGTTTATACAAATTAACACAGGG - Intergenic
971767497 4:30852270-30852292 TATATCTACATATAAACAAAGGG - Intronic
972471402 4:39408977-39408999 TGTATGTACAAATTTAGACATGG - Intronic
972557543 4:40195831-40195853 TGCATTAACAAATTGACACATGG + Intronic
974696777 4:65386417-65386439 TGTTTATACATATTGACAAATGG - Intronic
974860820 4:67519719-67519741 TATATTTACACATACACACATGG + Intronic
974863114 4:67547477-67547499 TGTATTTACATATCAGTATATGG + Intergenic
974914405 4:68162067-68162089 TGTATTTAAATTTTGACCCAGGG + Intergenic
974930479 4:68355705-68355727 TTTATTTATTTATTGACACAGGG - Intergenic
975510281 4:75187207-75187229 TGTATATATATATACACACACGG - Intergenic
975510282 4:75187233-75187255 TGTATATATATATACACACACGG - Intergenic
975881814 4:78918651-78918673 TGTATTCATATACTAATACAGGG + Exonic
976324350 4:83753611-83753633 TGTATTTCCATTATAACAAAAGG - Intergenic
976511842 4:85919987-85920009 TGTATATGCATATTAACGTATGG + Intronic
976738003 4:88329934-88329956 TTTATTTACATATAGAGACAGGG - Intergenic
977083169 4:92559703-92559725 CAAATTTACATATTAAAACATGG + Intronic
977490497 4:97703813-97703835 TATATATACATATATACACAGGG + Intronic
977854187 4:101868070-101868092 TCAATTTAAATATTAAGACACGG + Intronic
978069390 4:104448108-104448130 AGTTAATACATATTAACACAGGG + Intergenic
978495099 4:109350471-109350493 TGTAAATACTTATTAGCACAGGG - Intergenic
978500687 4:109406989-109407011 TGGATTTACATATCAACTCCTGG - Intergenic
978755123 4:112293490-112293512 TGTAGTTAGATATTACCAAAGGG - Intronic
979229076 4:118325816-118325838 TTTATTTACAGATTATCAGAGGG - Intronic
979471406 4:121102115-121102137 TGTATTTCCATATACAAACAAGG - Intergenic
980184173 4:129441038-129441060 TATACTTACATATTAATATAAGG + Intergenic
980266865 4:130527250-130527272 TAAAATGACATATTAACACAGGG + Intergenic
980662351 4:135878957-135878979 TGTATTTGCACATTAGTACAAGG - Intergenic
980763332 4:137265975-137265997 TCTCTTTTCATTTTAACACATGG + Intergenic
981124728 4:141092779-141092801 TGTATTTACCTATTTACAATAGG - Intronic
981760997 4:148194178-148194200 TATATTTACAGATTAACTTAGGG + Intronic
984433339 4:179676921-179676943 TGTTTTTACCTATAAACATAAGG - Intergenic
984684340 4:182649053-182649075 TGTATCCACATAGTAACAAAAGG - Intronic
986331641 5:6720737-6720759 TGTATTTTCATATATTCACACGG - Intronic
988446368 5:31290253-31290275 TGTGTTTACTTATTAAGAGATGG - Intronic
990283766 5:54279271-54279293 TGTTTTGGCAGATTAACACAGGG - Intronic
991170911 5:63624768-63624790 TATATCTGTATATTAACACATGG + Intergenic
992164220 5:74032619-74032641 GGTCTTTACTTCTTAACACAAGG + Intergenic
993038273 5:82782704-82782726 TGTCTTTACATCTTTATACAAGG + Intergenic
993718922 5:91302821-91302843 TGTTTTTACACAGTAAAACATGG - Intergenic
993954851 5:94219479-94219501 TGTATTTAAATATTGTGACATGG - Intronic
994285318 5:97957534-97957556 TGAATTTACAGATTGTCACATGG + Intergenic
994389185 5:99169995-99170017 TGTATTTACATTTTTTCCCAAGG + Intergenic
994709033 5:103243576-103243598 GGTACTTACATTTTAAGACATGG - Intergenic
995378419 5:111504336-111504358 TGGATTTACATATGACAACATGG + Intronic
995458076 5:112373057-112373079 TGTATTCAGATATAAACTCAGGG + Intronic
995560245 5:113373515-113373537 TGTACTTACATTTTAATATATGG + Intronic
995616223 5:113967373-113967395 TGTATTTATTTATTGAGACAAGG + Intergenic
996602162 5:125277064-125277086 TGTATTAACATATTTAAACTTGG + Intergenic
997095594 5:130907130-130907152 TGTATTTAAATATTTCCATAAGG - Intergenic
997860734 5:137413256-137413278 TGCATTTAAATATAAACTCATGG + Intronic
999009237 5:148016861-148016883 GGTAATTACATATTAATACAAGG - Intergenic
999059903 5:148622532-148622554 TGTGTTTACTTACTGACACATGG + Intronic
1000492768 5:161935544-161935566 TGTATTTACATAATATAAAATGG - Intergenic
1001765606 5:174243860-174243882 TTTATTTATATAATAACACTTGG - Intergenic
1002116786 5:176968500-176968522 TTTATTCACAGATTAAAACAAGG - Intronic
1002848935 6:974095-974117 TATATATACATATACACACATGG - Intergenic
1003871562 6:10407626-10407648 TGTGTTTACAAATTAGCACCAGG + Intronic
1004132714 6:12935764-12935786 TGTATTTCCATCTAACCACATGG + Intronic
1004336021 6:14765103-14765125 TGTATTTATTTATTGAGACAGGG - Intergenic
1004474406 6:15957774-15957796 TGTATTGATATATTAGCACATGG - Intergenic
1006038273 6:31231535-31231557 TATATTTACATTTTAACAAATGG - Intergenic
1006047942 6:31314546-31314568 TACATTTACATTTTAACACATGG - Intronic
1006371504 6:33647031-33647053 TTTATTTATTTATTAAGACAGGG + Intronic
1007069676 6:39027226-39027248 TTTATTTATTTATTAAGACAGGG - Intronic
1008409154 6:51153016-51153038 TCTATGTACACATTATCACATGG - Intergenic
1009753840 6:67909285-67909307 GGAATTTACATATTAGCAAAGGG - Intergenic
1009826838 6:68877454-68877476 AGTATTTTCATATTCACATAAGG + Intronic
1010232427 6:73546666-73546688 TTTATGCACATATAAACACATGG - Intergenic
1010615069 6:78002549-78002571 TTTATTTACTTTTTAAGACAAGG - Intergenic
1010669429 6:78670267-78670289 TGTATTTACATTCTATTACAGGG - Intergenic
1011958090 6:93049438-93049460 TGTATATACATATACACATATGG + Intergenic
1012386238 6:98686580-98686602 TATATTTATATATTAACTCCTGG + Intergenic
1013464155 6:110402360-110402382 AGTATTTAAATATTTAAACATGG + Intronic
1014602232 6:123427990-123428012 TTTATTTAGAGAATAACACAAGG - Intronic
1014823668 6:126022802-126022824 TGTACATACATATAAACATATGG + Intronic
1014929712 6:127320671-127320693 TATATTTAAATATTAAGACTTGG - Intronic
1014997399 6:128166861-128166883 TTTATTTACATATTTACATAGGG - Intronic
1015232214 6:130928082-130928104 TGTATTTATTTATTGAGACAGGG - Intronic
1015414856 6:132936637-132936659 TGTACTTACATATTAACTGTCGG - Intergenic
1016359741 6:143254552-143254574 TGTTTTTAGATATTGACTCATGG + Intronic
1016441338 6:144087141-144087163 TGTATATACATATGTACATATGG + Intergenic
1017953645 6:159160111-159160133 TGTATTTATTTATTGAGACAGGG + Intergenic
1018240379 6:161768521-161768543 TTTATATACATTTAAACACATGG + Intronic
1018251189 6:161872339-161872361 TGCATTTATATATTTAAACAGGG + Intronic
1019021857 6:168925501-168925523 TATATGTACATGTTCACACATGG + Intergenic
1019586562 7:1807652-1807674 TATATTTAAATATATACACACGG - Intergenic
1020843479 7:13252713-13252735 TCTTTTTACATTTTAACATATGG - Intergenic
1021037978 7:15824900-15824922 TGTATATATATTTTAAGACAAGG - Intergenic
1021404258 7:20245984-20246006 TGTATTTGCATCTTAAGAAAAGG + Intergenic
1021888996 7:25169026-25169048 TGTTTTTAAAAATAAACACATGG - Intronic
1022378996 7:29842286-29842308 TGTATTTAAATAATAAGACATGG - Intronic
1023319430 7:38976837-38976859 TCCATTTTAATATTAACACAAGG + Intergenic
1023404058 7:39813046-39813068 TTTATTTACTTATTGAGACAGGG + Intergenic
1023611527 7:41976741-41976763 TGTATTGAGAGATTAACAAAAGG - Intronic
1024651694 7:51409084-51409106 TGTATTTATATTTTGAGACAGGG + Intergenic
1027291569 7:76717699-76717721 TGTATCTATATATTAGGACAGGG + Intergenic
1027903455 7:84149070-84149092 TGTATATACAAATAAAAACAAGG + Intronic
1027997487 7:85443592-85443614 TTGAGTTACATATAAACACAGGG + Intergenic
1029049851 7:97674155-97674177 TGTATATACACATACACACATGG - Intergenic
1029881293 7:103813163-103813185 TCTTTCTACATATTAATACATGG + Intronic
1030184041 7:106742047-106742069 TTTATTTATTTATTAAGACAGGG + Intergenic
1031262227 7:119535409-119535431 TTTATATACATATTAAAAGATGG - Intergenic
1031304666 7:120111256-120111278 TGTATATACATATATATACATGG + Intergenic
1033792909 7:144813886-144813908 TGTATTGAGATATAAATACAGGG - Intronic
1034208271 7:149338256-149338278 TTTATGTACCTAATAACACATGG + Intergenic
1035552541 8:540602-540624 TGTATTAACATATAACCGCAAGG - Intronic
1037417225 8:18665118-18665140 TGTATTTAAATAATAAGACTTGG - Intronic
1038156168 8:24992469-24992491 TTTATTGACATAATAACTCATGG - Intergenic
1038337377 8:26656211-26656233 TTTAATTCCATATTAATACAAGG + Exonic
1039705015 8:39997650-39997672 TTTATTTACTTATTGAGACAGGG - Intronic
1040697537 8:50020308-50020330 GGTTTTGACATATTTACACAAGG + Intronic
1041469858 8:58196695-58196717 TTTATTTACATCTTATCATAAGG + Intronic
1041595018 8:59639701-59639723 TGCAAATACATAATAACACAAGG - Intergenic
1041660941 8:60400373-60400395 TATATCTACATCTTAACACCTGG + Intergenic
1041861585 8:62519702-62519724 TGTTTTTATATGTTAACTCATGG - Intronic
1042461796 8:69078158-69078180 TGTCTTCAGATATCAACACATGG - Intergenic
1043217325 8:77608675-77608697 TTAATTTTCTTATTAACACATGG + Intergenic
1044151344 8:88779407-88779429 TGTATTTTTATATTAAAAGAAGG - Intergenic
1044444642 8:92260720-92260742 TGAATTTAGATTTTAAAACATGG - Intergenic
1044775287 8:95680380-95680402 TGAATTAACATTTTAAAACATGG - Intergenic
1045089773 8:98729697-98729719 TGTATTTAAAGAATAACACCTGG - Intronic
1045811224 8:106221961-106221983 TGTATTAAGATATCAACACTAGG + Intergenic
1047359528 8:124155067-124155089 TATATTTTACTATTAACACATGG - Intergenic
1048015627 8:130494224-130494246 TAAATTTAAATATTAACATAGGG - Intergenic
1049036767 8:140082486-140082508 TGCATTAACATATCAAGACATGG - Intronic
1049884630 9:18783-18805 GGTATTTACACATGCACACATGG + Intergenic
1050459100 9:5862034-5862056 TGTATTTATTTATTGAGACAGGG + Intergenic
1050989178 9:12125491-12125513 TGTATTTACAAAGTACAACATGG - Intergenic
1051254705 9:15201619-15201641 TGGAATTACATATGCACACATGG - Intronic
1051746118 9:20296969-20296991 TGTATTTACATTTTAAAAGGGGG - Intergenic
1053332279 9:37224081-37224103 TGTCTTTAAATATTAATAAAGGG + Intronic
1053671199 9:40364575-40364597 TGTATTAACATATTTATATAAGG - Intergenic
1053921009 9:42990954-42990976 TGTATTAACATATTTATATAAGG - Intergenic
1054382315 9:64504649-64504671 TGTATTAACATATTTATATAAGG - Intergenic
1054513417 9:66011725-66011747 TGTATTAACATATTTATATAAGG + Intergenic
1055635113 9:78269404-78269426 TGGATGTACATATGAAGACATGG + Intronic
1055673499 9:78631406-78631428 TGCTTTTAAATATTAACAAAAGG - Intergenic
1056776005 9:89513032-89513054 TGAATTTAATTATAAACACAAGG - Intergenic
1056976494 9:91260751-91260773 TGTATATACATATTATCAAGTGG - Intronic
1057895782 9:98907624-98907646 TATATTTACATACATACACACGG + Intergenic
1058281691 9:103123989-103124011 TGCATTTACATGTACACACATGG - Intergenic
1058331623 9:103768653-103768675 TGTATTTACTTCATAAGACAAGG + Intergenic
1058683737 9:107462986-107463008 AGTGTTTACATATTATGACAAGG - Intergenic
1058922824 9:109633597-109633619 TTTATTTACTTATTGAGACAGGG + Intergenic
1059712355 9:116880660-116880682 AGTATTTGCATATTTGCACAAGG - Intronic
1186734154 X:12443256-12443278 TGTATATACATATTAAGCTATGG - Intronic
1187238306 X:17488610-17488632 TGTATTTACATAGTAACTGTAGG - Intronic
1187552546 X:20320631-20320653 TTTATTTACATATGTACATACGG + Intergenic
1188546219 X:31310482-31310504 TGTATTTACATATTAACACAGGG + Intronic
1188825602 X:34829973-34829995 TATATATACATTTTAATACATGG + Intergenic
1193618020 X:83713891-83713913 TGTATGTGCATATATACACACGG - Intergenic
1193866320 X:86735168-86735190 TGCACATACATATTACCACATGG + Intronic
1194707913 X:97198341-97198363 TGTATATATATATTAATATAAGG + Intronic
1194742548 X:97591459-97591481 TGTATTTTGACATTAATACAAGG - Intronic
1194802630 X:98291343-98291365 TGTATTTAGATTTTAAAATAAGG + Intergenic
1195402506 X:104476373-104476395 TGTATGTATATATAAGCACAAGG + Intergenic
1195888019 X:109661451-109661473 TGTGATTACATATTATCATAAGG - Intronic
1195931784 X:110085342-110085364 TATATATATATATTAAAACAGGG + Intronic
1196284714 X:113865546-113865568 TTTATTTACACATTTACACGAGG + Intergenic
1196377125 X:115045648-115045670 TGTATGTACATGTACACACATGG + Intergenic
1197112034 X:122787650-122787672 TGTATGTACATAGAAACTCATGG + Intergenic
1197651196 X:129066442-129066464 TGTATTTACTTTTTAAAAAATGG - Intergenic
1198122036 X:133603523-133603545 TATATTTACTTTTAAACACATGG - Intronic
1198719703 X:139603154-139603176 TCTATTTAGATATAAAAACAGGG - Intronic
1201367714 Y:13226988-13227010 TGTATTTATTTATTGAGACAGGG + Intergenic
1201475771 Y:14379222-14379244 TGTAATACCATTTTAACACATGG + Intergenic
1201980757 Y:19908102-19908124 TGTAATTACACAGTTACACAGGG + Intergenic