ID: 1188548082

View in Genome Browser
Species Human (GRCh38)
Location X:31332295-31332317
Sequence TGATCTGGATAAAACTTGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 126}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188548082 Original CRISPR TGATCTGGATAAAACTTGAC TGG (reversed) Intronic
902165388 1:14566912-14566934 TGATATGGATAAAGTTTGAGTGG - Intergenic
906683792 1:47749577-47749599 TTATGTGGATATAACTTAACTGG - Intergenic
907965823 1:59328504-59328526 TGATATGGAGAAAATTTGAGTGG - Intronic
908075117 1:60508588-60508610 TGAACTGGAGAAGACTTCACTGG - Intergenic
909714225 1:78688162-78688184 GAATATGTATAAAACTTGACTGG + Intergenic
910102695 1:83595603-83595625 GTATCTGGATAAAAACTGACTGG + Intergenic
910655991 1:89618519-89618541 TGAACTGGATAAAACTAAAATGG + Intergenic
916925194 1:169512043-169512065 TGATCTGGAAAATACTTGTTTGG - Intergenic
917208762 1:172608776-172608798 TTTTCTGGAGAAAACTTGAGGGG - Exonic
917861481 1:179149182-179149204 TGATATGGAGAAAATTTGAGTGG + Intronic
919869039 1:201806561-201806583 TGCTATGGAGAAAACTTCACTGG + Intronic
920013856 1:202889498-202889520 TAATGTGGCTAAAACTTGATGGG - Intergenic
920940681 1:210479073-210479095 TGATGCTGATAAAACTTGCCCGG - Intronic
921537971 1:216375590-216375612 TGATGTGGAGAAAATTTGAGTGG - Intronic
924548415 1:245051699-245051721 TTATCTTGAAAAAACTTGATAGG - Intronic
924883818 1:248190198-248190220 AGAACTGGATAAAAGTTTACAGG + Intergenic
1063074040 10:2696399-2696421 AGATCTGCATAAAAATTAACAGG + Intergenic
1066057032 10:31691578-31691600 TGATATGGAGAAAGCTTGAGTGG - Intergenic
1066535658 10:36388307-36388329 TGAGTTGGATAAAACATGGCAGG - Intergenic
1066555130 10:36604018-36604040 TGAACAGGATAAAACTTAAATGG + Intergenic
1066643320 10:37578711-37578733 TGACTTGGATAAAACATGGCAGG - Intergenic
1068041664 10:51832947-51832969 TGATATGAATAAATCTTGCCTGG + Intronic
1068700363 10:60013365-60013387 TGATATGGATAAAATTTTAGTGG - Intergenic
1069103251 10:64350762-64350784 TGAGTTGGTTAAAAATTGACTGG - Intergenic
1071098154 10:82003322-82003344 TGATCTGGATAATTCTTTAGAGG + Intronic
1071710185 10:88042265-88042287 TGATCTCCAGATAACTTGACCGG + Intergenic
1072499537 10:95999263-95999285 AGACATGGAGAAAACTTGACAGG - Intronic
1074352189 10:112748444-112748466 AAATCTGGAGAAAACTTGACTGG - Intronic
1074896748 10:117784085-117784107 TGTCCTGGAGAAAACTTGGCAGG + Intergenic
1082293631 11:50412334-50412356 AGATCTGGATAAGACTGGTCAGG - Intergenic
1082293678 11:50412619-50412641 TGAACTGGATAAGACTGGTCAGG - Intergenic
1082293700 11:50412787-50412809 TGAACTGGATAAGACTGGTCAGG - Intergenic
1088333452 11:108676952-108676974 TGGACTGGATAAAACTTGAGTGG + Intronic
1093188329 12:16047613-16047635 TGGTCTGGCTAGATCTTGACAGG + Intergenic
1099411372 12:82332886-82332908 TGAGCTGAATAAATTTTGACAGG + Intronic
1104525033 12:129513219-129513241 TGAAGAGGAGAAAACTTGACAGG + Intronic
1106456552 13:29932829-29932851 TGATATGGAGAAAGTTTGACTGG - Intergenic
1106783236 13:33080784-33080806 TGATCTGGATAAAGGTAGAGTGG + Intergenic
1107020751 13:35748282-35748304 TGATCTGGTTTGAACTGGACAGG + Intergenic
1108936057 13:55880914-55880936 TGATCTGGACAATACTTTTCTGG - Intergenic
1109180830 13:59212299-59212321 TGCTCAGGTGAAAACTTGACAGG - Intergenic
1116221166 14:42089290-42089312 TTTTCTGGATAAAACATGTCAGG + Intergenic
1122611265 14:102985013-102985035 TGCTCTGGTTAAACCATGACGGG + Intronic
1122611314 14:102985217-102985239 TGCTCTGGTTAAACCATGACGGG + Intronic
1126656497 15:50983423-50983445 TGATCTAGATAAGAATTGAGGGG + Intronic
1127690236 15:61388356-61388378 TGCTCTGTATAAAAATTAACTGG - Intergenic
1128650571 15:69409607-69409629 TGATTTGGATAAGACTCGCCTGG + Intergenic
1130549706 15:84882278-84882300 TGATCTGGATCAAACTGAAAAGG + Intergenic
1131786889 15:95923072-95923094 TTAACTGGATAAAATTTGAGGGG - Intergenic
1140651592 16:77094313-77094335 TGATCTGGACAACACATCACAGG - Intergenic
1149011690 17:51863632-51863654 TGAGCTGGATACAAATTCACTGG + Intronic
1156850562 18:41720846-41720868 TTATCTGCAGAACACTTGACTGG - Intergenic
1156877024 18:42026793-42026815 TGATCTGAATAAGACTTTATAGG - Intronic
1158511904 18:58098081-58098103 TCATCTGGATAAAACTAAGCAGG - Intronic
1160166131 18:76514060-76514082 TGATATGGAGAAAGCTTGAGTGG - Intergenic
1163484948 19:17580060-17580082 GGATGTGGCTAAAATTTGACCGG + Intronic
1166413732 19:42576629-42576651 TTATCAGAATAAAACTTAACAGG - Intergenic
925751461 2:7093730-7093752 GGAACTGGATAAAACCTGGCAGG + Intergenic
927199299 2:20568483-20568505 TGCTCTGCTTAAAACCTGACAGG - Intronic
933199033 2:79427239-79427261 TGCTCTGTATAAAATTTCACAGG + Intronic
933541087 2:83643683-83643705 TGATCTAGGTCACACTTGACAGG + Intergenic
940184784 2:150971873-150971895 TGATATGGAGAAAACTTTAGTGG - Intergenic
940663712 2:156579743-156579765 TGATTTGAATAAAAATGGACAGG + Exonic
940952918 2:159696616-159696638 TGATCTGGGAAAAACTGCACAGG - Intergenic
941373540 2:164698782-164698804 TGATTTGGATAAAAATTGAATGG + Intronic
942813872 2:180028583-180028605 TGATCTGGGTAAAAATTTTCTGG - Intergenic
943968612 2:194372931-194372953 TGATCTGGAGAATTGTTGACAGG + Intergenic
944398330 2:199295795-199295817 TGATCTGGAAACAACTTGTGAGG + Intronic
945957907 2:216103432-216103454 TGAGCTGGATAAACCATGTCTGG + Intergenic
1172660929 20:36568244-36568266 TGATATGGAGAAAATTTGAGTGG - Intergenic
1173512635 20:43642251-43642273 TAATCAGAATAAAACTGGACTGG - Intronic
1177832482 21:26154523-26154545 TGATTTGGACAAAACTTGTGGGG - Intronic
1177937861 21:27371903-27371925 AGATCTGAAAAAAAGTTGACAGG + Intergenic
1179790891 21:43755413-43755435 TGACCTGCATAGAACTTGGCAGG - Intronic
950907403 3:16551926-16551948 TGAACTGGACAACACTTGTCTGG + Intergenic
953114410 3:39977638-39977660 AGATCTCCATAAAACTTGAGAGG + Intronic
955631996 3:60984512-60984534 AGCTCTGGCTAAAACTTCACTGG + Intronic
958971979 3:100621450-100621472 TGATATGGAGAAAATTTGAGTGG + Intronic
963730181 3:148963628-148963650 TAATCTGGATATAAAGTGACTGG - Intergenic
964211692 3:154235306-154235328 TAATATGGATTAAACTTAACAGG - Intronic
976135105 4:81927177-81927199 AGAGCTGGATAATACTTCACAGG - Intronic
980529570 4:134034732-134034754 ATATCAGCATAAAACTTGACAGG + Intergenic
982858162 4:160411959-160411981 CCATCTGGAAAGAACTTGACAGG - Intergenic
987832426 5:23112873-23112895 TTATCAGGATAAAAGTTGACTGG - Intergenic
989654080 5:43725591-43725613 TGATATGGAGAAAACTTGAGTGG - Intergenic
994012442 5:94921446-94921468 TGATCTGTATAAATCTTGATAGG + Intronic
994851443 5:105058812-105058834 TGATATGGAGAAAGCTTGAGTGG + Intergenic
995240349 5:109878593-109878615 TGATGTGGATAAGTCTTGATAGG + Intergenic
996346817 5:122496545-122496567 TGATCTGGATGACAGTGGACAGG + Intergenic
996482913 5:123995732-123995754 TGATATGGAGAAAATTTGAGTGG - Intergenic
997953044 5:138257328-138257350 TTATCTGGATAGAAAATGACTGG + Intronic
999408250 5:151326159-151326181 TGGTCTGGATAAAACCTCAGTGG - Intronic
1001082613 5:168678179-168678201 AGATCTGGTTAAAAGTTGCCAGG - Intronic
1007563481 6:42830014-42830036 TCATCAGGATCAAACTTTACAGG + Exonic
1008028111 6:46662000-46662022 TAATCTGGGTTAAAGTTGACCGG + Intronic
1008319446 6:50090098-50090120 TGATGTGGAGAAAATTTGAGAGG + Intergenic
1009959697 6:70503525-70503547 TGATCTGGATAATAACTGAAAGG - Intronic
1012824725 6:104132934-104132956 TGATATGGAGAAAGCTTGAGTGG + Intergenic
1013385113 6:109620496-109620518 TGTTCTGGATATAACTTGTCAGG + Intronic
1014858556 6:126433352-126433374 TAAGCTGAATAAACCTTGACTGG + Intergenic
1015506039 6:133989629-133989651 TTATCTGTATAAAAATTGGCAGG - Exonic
1016364063 6:143296883-143296905 AGATCTGGGTACATCTTGACTGG + Intronic
1017234066 6:152100979-152101001 TGTTCTGGATTTAATTTGACTGG + Exonic
1018076567 6:160221401-160221423 TGATATGGAGAAAGCTTGAGTGG - Intronic
1023026104 7:36051247-36051269 TGATATGGATAAAGTTTGAGTGG + Intergenic
1023356055 7:39368274-39368296 TGATATGGATAAAGTTTGAGTGG + Intronic
1027619652 7:80468040-80468062 TGATGTAGCTAAAAATTGACAGG + Intronic
1027721901 7:81753707-81753729 TAATATGGATAATACTTCACTGG - Intronic
1029138042 7:98388996-98389018 TTTTTTGGATAAAACTTGAATGG - Intronic
1029911004 7:104147982-104148004 GGATATGGACAAAACTTGAGGGG + Intronic
1031497271 7:122465760-122465782 TGCTCTGTATAAGACTTGAATGG - Intronic
1033936916 7:146597127-146597149 TGTTCTGGATAGAACTTCATAGG + Intronic
1034814423 7:154159501-154159523 TGATCTGAATAAAAGCAGACAGG - Intronic
1043559951 8:81480863-81480885 TGGTCTGGATACAACTTCTCAGG + Intronic
1049004543 8:139846337-139846359 GGATCAGGATAACACTTGTCTGG + Intronic
1050349564 9:4727612-4727634 TGATATGGAGAAAGCTTGAGTGG - Intronic
1052182606 9:25548223-25548245 CGATCTGGCTGAAACTTGAAAGG + Intergenic
1052652660 9:31323849-31323871 TGATTAGGATAAAACTTGTATGG - Intergenic
1052941569 9:34135231-34135253 TGTTCTGGATAAAACATTTCAGG - Intergenic
1062481103 9:136752364-136752386 TGATTTGGATAAAAATTTAAAGG - Intergenic
1185975427 X:4714386-4714408 TGATCTGGTTAACACTTAGCCGG + Intergenic
1187356544 X:18578387-18578409 TGATAGGTATACAACTTGACTGG + Intronic
1188548082 X:31332295-31332317 TGATCTGGATAAAACTTGACTGG - Intronic
1188705364 X:33322046-33322068 TGATATGGATAAAATTTAAATGG - Intronic
1188855016 X:35183670-35183692 TGATCTGTATTAAACTTGACAGG + Intergenic
1192116030 X:68412044-68412066 TTATATAGATAAAACTTCACAGG + Intronic
1192708404 X:73552824-73552846 TGATCTATATAAAATTTGGCTGG - Intergenic
1193739016 X:85195514-85195536 TAATCTGGATAAAAATAGGCTGG + Intergenic
1194776956 X:97976948-97976970 TGATTTGGAAAATCCTTGACAGG + Intergenic
1195115221 X:101690713-101690735 TTCTCTGGATGAAACTTGAAAGG + Intergenic
1195246978 X:103003685-103003707 TGATTTGGACAGAATTTGACAGG - Intergenic
1196048012 X:111276329-111276351 TGATAAGGAAAAAACTGGACAGG - Intergenic
1196288437 X:113910896-113910918 AGATCTGGAAAAAAGTTGGCCGG + Intergenic
1196978749 X:121188301-121188323 GGTTCTGCAAAAAACTTGACTGG + Intergenic
1198690058 X:139272461-139272483 AGATTTGAATAACACTTGACAGG + Intergenic