ID: 1188550033

View in Genome Browser
Species Human (GRCh38)
Location X:31353396-31353418
Sequence CTCTTTCTGATCTCAGTCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1238
Summary {0: 1, 1: 1, 2: 3, 3: 97, 4: 1136}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188550033_1188550036 2 Left 1188550033 X:31353396-31353418 CCTGAGACTGAGATCAGAAAGAG 0: 1
1: 1
2: 3
3: 97
4: 1136
Right 1188550036 X:31353421-31353443 TGTTGTAACTTACTAGACTTGGG 0: 1
1: 0
2: 0
3: 7
4: 144
1188550033_1188550037 24 Left 1188550033 X:31353396-31353418 CCTGAGACTGAGATCAGAAAGAG 0: 1
1: 1
2: 3
3: 97
4: 1136
Right 1188550037 X:31353443-31353465 GTTGATATGCATTAGAATTAAGG 0: 1
1: 0
2: 0
3: 11
4: 152
1188550033_1188550035 1 Left 1188550033 X:31353396-31353418 CCTGAGACTGAGATCAGAAAGAG 0: 1
1: 1
2: 3
3: 97
4: 1136
Right 1188550035 X:31353420-31353442 CTGTTGTAACTTACTAGACTTGG 0: 1
1: 0
2: 0
3: 5
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188550033 Original CRISPR CTCTTTCTGATCTCAGTCTC AGG (reversed) Intronic
900358726 1:2277579-2277601 CTCTTTTTGTTCCCAGTTTCGGG + Intronic
900663929 1:3800903-3800925 CTCTTTTTCTTCTTAGTCTCAGG - Intergenic
900809696 1:4792751-4792773 CACTTTCAGGTCTCAGTGTCTGG + Intergenic
900908723 1:5579035-5579057 CTCTTTTTCTTCTCAGTCTCAGG - Intergenic
901214000 1:7544100-7544122 CTCTTTTTCTTCCCAGTCTCAGG - Intronic
902114912 1:14113458-14113480 CTCTTTCAGATCTCAGGGCCTGG - Intergenic
902271460 1:15308035-15308057 CTCTTTTTCTTCCCAGTCTCGGG + Intronic
902664915 1:17930755-17930777 CTATTTCTGTTCCCTGTCTCGGG + Intergenic
903146669 1:21377168-21377190 CTCTTTTTCTTCCCAGTCTCGGG + Intergenic
904846407 1:33421580-33421602 CTCTGTTTCATCTCAGTCCCGGG - Intronic
904883234 1:33716211-33716233 CTCCTTCTGCTACCAGTCTCTGG - Intronic
904927899 1:34062884-34062906 CTCTTTTTCTTCCCAGTCTCGGG - Intronic
904928174 1:34064784-34064806 CTCTTTTTCTTCCCAGTCTCGGG - Intronic
905484874 1:38288389-38288411 CTCTCTCTGCTATCAGTTTCAGG + Intergenic
905959002 1:42027670-42027692 CTCTTTTTGTTCCCAGTTTCGGG - Intronic
905964766 1:42082318-42082340 CTGCTTCTGATATTAGTCTCAGG + Intergenic
906372765 1:45268636-45268658 CTCTTTTTCTTCCCAGTCTCGGG + Intronic
906770264 1:48477030-48477052 CTCTTTTTCTTCCCAGTCTCAGG + Intergenic
907555772 1:55343185-55343207 CTCTTTTTCTTCCCAGTCTCAGG + Intergenic
907556113 1:55345429-55345451 CTCTTTTTCTTCCCAGTCTCGGG + Intergenic
907616880 1:55935013-55935035 CTCTTTTTCTTCCCAGTCTCAGG - Intergenic
907890813 1:58635027-58635049 CTCTTTATCTTCCCAGTCTCGGG + Intergenic
907925826 1:58954311-58954333 CTCTTTTTCTTCCCAGTCTCTGG + Intergenic
907941004 1:59087340-59087362 CTCTTTTTCTTCCCAGTCTCAGG - Intergenic
908372999 1:63502420-63502442 CTCTTTTTCCTCCCAGTCTCAGG - Intronic
908406221 1:63816547-63816569 CTCTTTTTCTTCCCAGTCTCGGG + Intronic
908426751 1:64014974-64014996 CTCTTTTTCTTCCCAGTCTCGGG - Intronic
908442755 1:64171171-64171193 CTCTTTTTCTTCCCAGTCTCAGG - Intronic
908760738 1:67509486-67509508 CTCTTTTTGTTCCCAGTTTCGGG + Intergenic
908853499 1:68396951-68396973 CTCTTTTTCTTCCCAGTCTCGGG - Intergenic
908998278 1:70185546-70185568 CTCTTTTTCTTCCCAGTCTCGGG + Intronic
909066433 1:70940492-70940514 CTCTTTTTCTTCCCAGTCTCGGG - Intronic
909107724 1:71433481-71433503 CTCTTTTTCTTCCCAGTCTCGGG - Intronic
909128060 1:71699991-71700013 CTCTTTTTCCTCTCAGTCTCAGG + Intronic
909140687 1:71861115-71861137 GTGTTTCAGATCACAGTCTCTGG + Intronic
909373589 1:74914931-74914953 CTCTTTTTCTTCCCAGTCTCAGG - Intergenic
909670711 1:78185095-78185117 CTGTTAGTCATCTCAGTCTCTGG + Intergenic
909681426 1:78295603-78295625 CTCTTTTTCTTCCCAGTCTCAGG + Intergenic
909702369 1:78541580-78541602 CTTTTTTTCTTCTCAGTCTCAGG - Intergenic
909806853 1:79883278-79883300 CTCTTTTTCTTCCCAGTCTCAGG - Intergenic
909885208 1:80933201-80933223 CCAATTCTGATCTCAGTTTCAGG + Intergenic
910057476 1:83050014-83050036 CTCTTTTTCTTCCCAGTCTCAGG - Intergenic
910745379 1:90568731-90568753 CTCTTTCTGAGATCAGTTTTGGG + Intergenic
910818080 1:91313063-91313085 CTCTTTTTCTTCCCAGTCTCAGG + Intronic
910850166 1:91642066-91642088 CTCTTTTTCTTCCCAGTCTCGGG + Intergenic
910965696 1:92805983-92806005 CTCTTTTTCTTCCCAGTCTCAGG + Intergenic
911156743 1:94644520-94644542 TTCTCTCTGATCTCGGTATCAGG - Intergenic
911331851 1:96533377-96533399 CTCTTTTTCTTCCCAGTCTCAGG + Intergenic
911530483 1:99037674-99037696 CTATTTTTCTTCTCAGTCTCAGG - Intergenic
911541753 1:99165113-99165135 CTCTTTTTCTTCCCAGTCTCGGG + Intergenic
911785206 1:101937674-101937696 CTCTTTTTCCTCCCAGTCTCAGG + Intronic
911950027 1:104161568-104161590 CTTTTTCTGATGTCTTTCTCTGG - Intergenic
911972702 1:104457855-104457877 CTCTTTTTCTTCCCAGTCTCAGG + Intergenic
912099356 1:106185971-106185993 CTCTTTTTCTTCCCAGTCTCAGG + Intergenic
912210344 1:107550425-107550447 CTCTTTTTCTTCTCAGTCTCGGG - Intergenic
912263408 1:108131362-108131384 CTCTTTTTCTTCCCAGTCTCAGG - Intergenic
912279576 1:108298690-108298712 CTCTTTTTCTTCTCAGTCTTGGG - Intergenic
912288650 1:108395667-108395689 CTCTTTTTCTTCTCAGTCTTGGG + Intronic
912389844 1:109295352-109295374 GTCTTTCTGTGCTCAGTTTCTGG + Intronic
912907256 1:113719837-113719859 CTCTTCTTCTTCTCAGTCTCAGG - Intronic
912938115 1:114021309-114021331 CTCTTTGTCTTCCCAGTCTCGGG + Intergenic
913098246 1:115540017-115540039 CTCTTTTTCTTCCCAGTCTCAGG - Intergenic
913459165 1:119064772-119064794 CTCTTTTTCTTCCCAGTCTCGGG + Intronic
914230657 1:145762399-145762421 CTCTTTTTCTTCCCAGTCTCAGG + Intronic
914506741 1:148296024-148296046 CTCCTGCTGGTCTCAGTCGCCGG + Intergenic
914976596 1:152370138-152370160 CTCTGTCTGATTTTAGTATCAGG - Intergenic
916533509 1:165680864-165680886 CTCTTTCTGTTCCCAGTTTCGGG - Intronic
917541768 1:175921354-175921376 CTCTTTTTCTTCCCAGTCTCAGG + Intergenic
917709566 1:177670645-177670667 CTCTTTCTAGTCTCGGGCTCTGG + Intergenic
918119756 1:181528363-181528385 CTCTTTTTGTTCCCAGTTTCAGG + Intronic
918203919 1:182292334-182292356 CTCTTTTTCTTCCCAGTCTCAGG - Intergenic
918487243 1:185042977-185042999 CTCTTTCTGAACTCAGTTCAAGG + Intergenic
918773636 1:188598876-188598898 CTTTTTCTCAGCTCACTCTCTGG + Intergenic
918831681 1:189406248-189406270 CTCTTTTTCTTCCCAGTCTCAGG - Intergenic
918924862 1:190770087-190770109 CTCTTTATATTCTCATTCTCTGG - Intergenic
919187204 1:194167636-194167658 CTCTTTTTCTTCTCAGTCTGGGG + Intergenic
919308626 1:195877497-195877519 CTCTTTTTCTTCCCAGTCTCAGG - Intergenic
919362392 1:196611380-196611402 CTCTTTTTCTTCCCAGTCTCGGG + Intergenic
919362583 1:196612806-196612828 CTCTTTTTCTTCCCAGTCTCAGG + Intergenic
921000453 1:211038350-211038372 CTCTTTTTCATCCCAGTCTCAGG + Intronic
921386857 1:214578202-214578224 CTCTTTTTCTTCCCAGTCTCTGG + Intergenic
921792878 1:219309757-219309779 CTCTTTTTCTTCCCAGTCTCAGG + Intergenic
922152459 1:223017656-223017678 CTCTTTTTCTTCCCAGTCTCAGG - Intergenic
922318054 1:224459778-224459800 CTTTTTCTGAGCTCAGGCCCAGG - Intronic
923198129 1:231687272-231687294 CTCTTTTTCTTCCCAGTCTCAGG - Intronic
923461379 1:234212164-234212186 CTCTTTTTCTTCCCAGTCTCAGG + Intronic
923575158 1:235151709-235151731 CTCTTTCTCATGTGATTCTCTGG - Intronic
923792231 1:237121667-237121689 GTGTTTCTGATCTCAGTCCCAGG + Intronic
923967919 1:239164097-239164119 GTGTTTCTGATTTCACTCTCAGG - Intergenic
924785854 1:247198648-247198670 CTCTTTTTCTTCCCAGTCTCAGG + Intergenic
924806424 1:247365300-247365322 CTCTTTTTCTTCTCAGTCTCGGG + Intergenic
1063242097 10:4181304-4181326 ATCTGTCTGGGCTCAGTCTCCGG - Intergenic
1063552649 10:7047714-7047736 CTCTTTTTCTTCCCAGTCTCTGG - Intergenic
1063833492 10:9984285-9984307 CTCTTTTTCTTCCCAGTCTCAGG + Intergenic
1063910048 10:10820208-10820230 CTCTTTTTGTTCTCAGTTTCGGG + Intergenic
1064336919 10:14451776-14451798 CTCTTTTTCTTCCCAGTCTCAGG + Intronic
1064502359 10:15988276-15988298 CTCTTTTTCCTCCCAGTCTCAGG - Intergenic
1064909181 10:20382080-20382102 CTCTTTTTCTTCCCAGTCTCAGG - Intergenic
1065226228 10:23546170-23546192 CTCTTTTTCTTCTCAGTCTCAGG + Intergenic
1065612822 10:27489305-27489327 CTCTTTTTCTTCTCAGTCTTGGG - Intergenic
1065999016 10:31086953-31086975 TTCTTTCTAATCTCAGTACCAGG - Intergenic
1066451748 10:35536325-35536347 CTCTTTTTTTTCCCAGTCTCGGG + Intronic
1066473062 10:35718127-35718149 CTCTTTTTGTTCCCAGTTTCAGG - Intergenic
1067395001 10:45907058-45907080 CACTGTCTTCTCTCAGTCTCTGG + Intergenic
1067767062 10:49094832-49094854 CTGTTTCTGCTCTCAGGCACTGG + Intronic
1067863321 10:49876189-49876211 CACTGTCTTCTCTCAGTCTCTGG + Intronic
1067911329 10:50349833-50349855 CTCTTTTTCTTCTCAGTCTTGGG + Intronic
1068367059 10:56065244-56065266 CTCTTTTTCTTCCCAGTCTCAGG + Intergenic
1068519301 10:58061816-58061838 CTCTTTTTCTTCCCAGTCTCAGG - Intergenic
1068552785 10:58425462-58425484 CTCTTTTTTGTCCCAGTCTCGGG - Intergenic
1068676958 10:59778559-59778581 CTCTTTTTGTTCCCAGTTTCGGG - Intergenic
1069067681 10:63960846-63960868 CTCTTTTTCTTCCCAGTCTCAGG + Intergenic
1069069754 10:63981127-63981149 CTCTTTTTCTTCCCAGTCTCAGG + Intergenic
1069089907 10:64187556-64187578 CTCTTTTTCTTCACAGTCTCGGG + Intergenic
1069175857 10:65287240-65287262 CTCTTTTTCTTCCCAGTCTCAGG - Intergenic
1069211157 10:65761416-65761438 CTCTTTTTCTTCCCAGTCTCAGG - Intergenic
1069213490 10:65790928-65790950 CTCTTTTTCTTCCCAGTCTCTGG + Intergenic
1069663134 10:70137106-70137128 CTCTTTTTCATCCCAGTCTCAGG - Intergenic
1069735173 10:70649280-70649302 CTCTTTCTGAGCTCTGTAGCTGG - Intergenic
1070226878 10:74516895-74516917 CTCTTTTTCTTCCCAGTCTCAGG - Intronic
1070407584 10:76110796-76110818 CTCTTTTTCTTCCCAGTCTCAGG + Intronic
1070533179 10:77355245-77355267 CTCTTTTTCTTCACAGTCTCAGG + Intronic
1070586547 10:77771076-77771098 CTCTTTCTGGCCTGAGTATCAGG - Intergenic
1071246732 10:83773314-83773336 CTCTTTTTCTTCCCAGTCTCGGG - Intergenic
1071354791 10:84783787-84783809 CTCTTTCACATCCCTGTCTCAGG + Intergenic
1071803283 10:89088588-89088610 CTCTTTGGGATACCAGTCTCTGG + Intergenic
1071849266 10:89551829-89551851 TTCTTTTTCTTCTCAGTCTCAGG + Intronic
1071973831 10:90935078-90935100 CTCTTTTTCCTCCCAGTCTCAGG + Intergenic
1072068865 10:91897192-91897214 CTCTTTTTCTTCCCAGTCTCTGG + Intergenic
1072488140 10:95875660-95875682 CTCTTTTTGTTCCCAGTCTCAGG - Exonic
1072787950 10:98296896-98296918 CTCTTTCTTATCTCTATTTCTGG + Intergenic
1073153319 10:101326944-101326966 CTCTTTTTCTTCCCAGTCTCAGG + Intergenic
1073153604 10:101328867-101328889 CTCTTTTTCTTCCCAGTCTCAGG + Intergenic
1073730833 10:106285721-106285743 CTCTCTCTGCTCCCAGTGTCTGG - Intergenic
1073810889 10:107151392-107151414 CTCTTTTTCTTCCCAGTCTCAGG - Intronic
1073898339 10:108188983-108189005 CTTTGTCTGATCTTAGTATCAGG - Intergenic
1074773441 10:116748573-116748595 CTCTTTTTCTTCCCAGTCTCAGG - Intergenic
1074836973 10:117304851-117304873 CTCTTTTTGTTCCCAGTTTCAGG + Intronic
1075050424 10:119179098-119179120 CCCTTTCTTATTTCAGCCTCAGG + Intergenic
1075543790 10:123338211-123338233 CTCTTTTTGTTCCCAGTCTCAGG - Intergenic
1076430385 10:130397977-130397999 CTCTTTTTGTTCCCAGTTTCAGG + Intergenic
1076464669 10:130670865-130670887 CTCTTTTTGTTCCCAGTTTCAGG - Intergenic
1076464944 10:130672796-130672818 CTCTTTTTGTTCCCAGTTTCAGG - Intergenic
1076759923 10:132598749-132598771 CTCTTTTTCTTCCCAGTCTCAGG - Intronic
1076760210 10:132600674-132600696 CTCTTTTTCTTCCCAGTCTCAGG - Intronic
1077193229 11:1264762-1264784 CTCTTTTTCTTCTCAGTCTTGGG - Intergenic
1077277889 11:1725040-1725062 ATCCTTCTGTTCTCAGTATCTGG - Intergenic
1077547326 11:3180116-3180138 CTCTTTTTCTTCCCAGTCTCAGG - Intergenic
1077865594 11:6218763-6218785 CCCTTTCTGATGTCTTTCTCAGG - Exonic
1078612839 11:12836707-12836729 CAGTTTCTGATTTCAGTCCCTGG + Intronic
1078713068 11:13813832-13813854 CTCTTTTTCTTCCCAGTCTCAGG - Intergenic
1078929223 11:15900780-15900802 CTCTCTCTGCTCTCAGCCTCTGG - Intergenic
1079121959 11:17692336-17692358 CTCTTACGGCTCTCAGCCTCCGG - Intergenic
1079585019 11:22114925-22114947 CTATTTCTTATCTCAGTGTGAGG + Intergenic
1079586293 11:22129668-22129690 CTCTTTGTCTTCCCAGTCTCAGG - Intergenic
1079701401 11:23553152-23553174 CTCTTTTTCTTCCCAGTCTCGGG - Intergenic
1079799085 11:24845855-24845877 CTCTTTTTCTTCCCAGTCTCAGG + Intronic
1079905485 11:26241239-26241261 CTCTTTTTCTTCCCAGTCTCGGG + Intergenic
1080140951 11:28919406-28919428 CTTTTTCGCATATCAGTCTCAGG - Intergenic
1080153255 11:29077821-29077843 CTCTTTTTCTTCCCAGTCTCAGG + Intergenic
1080153522 11:29079749-29079771 CTCTTTTTCTTCCCAGTCTCAGG + Intergenic
1080316965 11:30960060-30960082 CTCTATCTGATCATACTCTCAGG + Intronic
1080338204 11:31224166-31224188 CTCTTTTTCTTCCCAGTCTCAGG + Intronic
1080739486 11:35050142-35050164 CTCTTTTTCTTCCCAGTCTCTGG + Intergenic
1080987413 11:37485325-37485347 CTCTTTTTCTTCCCAGTCTCAGG + Intergenic
1081119433 11:39247130-39247152 CTCTTTCAGAATCCAGTCTCTGG - Intergenic
1081157937 11:39717227-39717249 CTCTTTTTGTTCTGAGTTTCAGG + Intergenic
1081175298 11:39920945-39920967 CTCTTTTTCTTCTCAGTCTTGGG + Intergenic
1081277061 11:41163207-41163229 CTCTTTTTCTTCCCAGTCTCAGG + Intronic
1081309700 11:41554660-41554682 CTCTTTTTCTTCCCAGTCTCAGG + Intergenic
1081387398 11:42487723-42487745 CTCTTTTTGTTCCCAGTTTCAGG + Intergenic
1081479900 11:43476465-43476487 CTCTTTTTGCTCCCAGTTTCAGG - Intronic
1081598886 11:44478104-44478126 CTCTTTTTCTTCCCAGTCTCGGG + Intergenic
1081939605 11:46929340-46929362 CTCTTTTTGTTCCCAGTTTCAGG + Intergenic
1082287629 11:50334520-50334542 CTCTTTTTCTTCTCAGTCTCAGG - Intergenic
1082766342 11:57170905-57170927 CTCTTTTTGTTCCCAGTTTCAGG - Intergenic
1083943784 11:65912776-65912798 TTCTCTCTGGTCTCAGTCTCTGG + Intergenic
1084909671 11:72378309-72378331 CTCTTTTTGTTCCCAGTTTCAGG - Intronic
1085194168 11:74658086-74658108 CTCTTTTTGTTCCCAGTTTCAGG - Intronic
1085194447 11:74660009-74660031 CTCTTTTTCTTCCCAGTCTCGGG - Intronic
1085720738 11:78910342-78910364 CTCTTTCTGTTGGCATTCTCAGG - Intronic
1085751400 11:79164889-79164911 CTCTTTTTGTTCCCAGTCTTGGG + Intronic
1086306815 11:85488503-85488525 CTCTTTTTCTTCCCAGTCTCAGG + Intronic
1086580206 11:88390826-88390848 CTCTTTCTCTTCCCAATCTCTGG - Intergenic
1086840223 11:91675718-91675740 CTCTTTTTCTTCTCAGTCTTGGG + Intergenic
1086840504 11:91677649-91677671 CTCTTTTTCTTCCCAGTCTCAGG + Intergenic
1086963929 11:93008323-93008345 CTCTTTTTCTTCCCAGTCTCAGG + Intergenic
1086995570 11:93352615-93352637 CTCTTTTTCTTCCCAGTCTCAGG - Intronic
1087723208 11:101690294-101690316 CTCTTTATCTTCTCAGTTTCAGG - Intronic
1087761502 11:102108567-102108589 CTCTTTCTAAGCACAGCCTCAGG - Intergenic
1087763834 11:102128507-102128529 CTCTTTTTCTTCCCAGTCTCAGG + Intronic
1088035090 11:105301660-105301682 TTCTTTCTTCTCTCAGTCACTGG + Intergenic
1088377776 11:109160673-109160695 CGCTTTTTCATCCCAGTCTCGGG - Intergenic
1088398437 11:109394570-109394592 CTCTTTTTCTTCCCAGTCTCGGG + Intergenic
1088650314 11:111952172-111952194 CTCTTTTTCTTCCCAGTCTCGGG + Intronic
1089405364 11:118193043-118193065 CTCTTTTTCTTCCCAGTCTCGGG + Intergenic
1089649405 11:119902763-119902785 CTCTTTCTCTTCCCAGTTTCGGG - Intergenic
1090265933 11:125352931-125352953 CTCCTTCTGAACTTTGTCTCGGG - Intronic
1090415996 11:126540880-126540902 CCCTTTCTTCTCTGAGTCTCAGG + Intronic
1090506178 11:127318029-127318051 CTCTTTTTCTTCTCAGTCTTGGG - Intergenic
1091269682 11:134298762-134298784 CTCTTTTTCTTCCCAGTCTCAGG + Intronic
1091858772 12:3760027-3760049 CTCTTTCTTTCCCCAGTCTCGGG + Intronic
1092059635 12:5537907-5537929 CTTTTCCTTTTCTCAGTCTCTGG + Intronic
1092325669 12:7528510-7528532 CTCTTTTTCTTCCCAGTCTCAGG + Intergenic
1092326445 12:7535765-7535787 CTCTTTTTCTTCCCAGTCTCGGG + Intergenic
1092872525 12:12818686-12818708 CTCTTTTTCTTCCCAGTCTCGGG - Intronic
1092921048 12:13232218-13232240 CTCTTTTTCTTCCCAGTCTCAGG + Intergenic
1093300204 12:17443851-17443873 CTCTTTTTCTTCCCAGTCTCAGG + Intergenic
1093324864 12:17760942-17760964 CTCTTTTTCTTCTCAGTCTCGGG - Intergenic
1093536485 12:20229908-20229930 CTCTTTTTCTTCTGAGTCTCGGG - Intergenic
1093536785 12:20231816-20231838 CTCTTTTTCGTCCCAGTCTCGGG - Intergenic
1093908838 12:24722996-24723018 CTCTTTTTCTTCCCAGTCTCAGG + Intergenic
1093978559 12:25450652-25450674 TTCTTTTTCTTCTCAGTCTCAGG + Intronic
1094420423 12:30264735-30264757 CTCTTTTTCTTCCCAGTCTCAGG + Intergenic
1094483213 12:30901465-30901487 CTCTTTTTCTTCCCAGTCTCAGG + Intergenic
1094489086 12:30947447-30947469 CTCTTTTTCTTCCCAGTCTCAGG - Intronic
1094489367 12:30949352-30949374 CTCTTTTTCCTCCCAGTCTCGGG - Intronic
1094540919 12:31362697-31362719 CTCTTGCTGCTTTCAGTTTCTGG - Intergenic
1094706230 12:32916560-32916582 CTCTTTTTCTTCCCAGTCTCGGG + Intergenic
1094748380 12:33374625-33374647 CTCTCGCTGATCTCTTTCTCAGG + Exonic
1095135758 12:38600379-38600401 CTCTTTTTCTTCACAGTCTCAGG + Intergenic
1095511309 12:42953951-42953973 TTCTTTTTTTTCTCAGTCTCTGG + Intergenic
1095623416 12:44284400-44284422 CTCTTTTTCTTCCCAGTCTCGGG + Intronic
1095773363 12:45986920-45986942 CTCTTTTTCTTCCCAGTCTCAGG + Intronic
1095839128 12:46672555-46672577 CTCTTTTTCTTCCCAGTCTCGGG + Intergenic
1095968899 12:47888015-47888037 CTCTTTCTCTTCCCAGTCTCAGG - Intronic
1096441622 12:51648487-51648509 CTCTTTTTCTTCCCAGTCTCAGG - Intronic
1096593357 12:52677076-52677098 CGATTTCAGATCTAAGTCTCTGG + Exonic
1097445484 12:59666948-59666970 CTCTTTTTCTTCCCAGTCTCTGG - Intronic
1097686147 12:62692741-62692763 ACCTTTCAGATCACAGTCTCTGG - Intronic
1097754376 12:63392470-63392492 CTCTTTCTGATCTTAGTGCTTGG - Intergenic
1097904506 12:64905997-64906019 CTCCTTCTTATGACAGTCTCAGG - Intergenic
1097998935 12:65920764-65920786 CTCTTTTTCTTCCCAGTCTCAGG + Intronic
1098078376 12:66758153-66758175 CTCTTTTTGTTCCCAGTTTCAGG - Intronic
1098205530 12:68105346-68105368 CTCTTTCTTATGGCAGTTTCAGG + Intergenic
1098650465 12:72960610-72960632 TTCTTTCTGACCTCAGAGTCAGG + Intergenic
1098778635 12:74654903-74654925 CTCTTTTTCTTCCCAGTCTCGGG - Intergenic
1098837599 12:75441133-75441155 CTCTTTTTCTTCCCAGTCTCAGG + Intergenic
1098926720 12:76359604-76359626 CTCCTTTTCATCCCAGTCTCGGG - Intronic
1098946211 12:76592415-76592437 CTCTTTTTCTTCCCAGTCTCAGG + Intergenic
1099003985 12:77215675-77215697 CTCTTTGTCTTCCCAGTCTCAGG + Intergenic
1099004259 12:77217600-77217622 CTCTTTTTCTTCCCAGTCTCGGG + Intergenic
1099490650 12:83284151-83284173 CTCTTTTTCTTCCCAGTCTCAGG + Intergenic
1099503536 12:83445407-83445429 CTCTTTTTGTTCCCAGTTTCGGG + Intergenic
1099507645 12:83499369-83499391 CTCTTTTTGTTCCCAGTTTCTGG + Intergenic
1099683308 12:85856051-85856073 CTCTTTTTCTTCCCAGTCTCAGG + Intergenic
1099700229 12:86074238-86074260 CTCTTTTAGTTCTCAGTTTCGGG + Intronic
1100678338 12:96892573-96892595 CTCTTTTTCTTCCCAGTCTCGGG + Intergenic
1100678625 12:96894508-96894530 CTCTTTTTGTTCCCAGTTTCAGG + Intergenic
1100811681 12:98345012-98345034 CTCTTTTTCTTCCCAGTCTCAGG - Intergenic
1101113147 12:101505891-101505913 CTCTTTTTCTTCCCAGTCTCAGG + Intergenic
1101113428 12:101507828-101507850 CTCTTTTTCTTCCCAGTCTCAGG + Intergenic
1101215347 12:102575993-102576015 CTCTTTTTCTTCCCAGTCTCGGG + Intergenic
1101336945 12:103805129-103805151 CTCATTCAGATCTCAGTTTTTGG - Intronic
1101358895 12:104008010-104008032 CTCTTTTTCTTCCCAGTCTCAGG + Intronic
1101663398 12:106787534-106787556 CTCTTTTTCTTCCCAGTCTCAGG - Intronic
1102148599 12:110672909-110672931 CTCTTTTTCTTCCCAGTCTCAGG + Intronic
1102248714 12:111371298-111371320 CTCTTTTTGTTCTCAGTTTCGGG - Intergenic
1102523055 12:113491265-113491287 CTCTTTTTCTTCCCAGTCTCGGG + Intergenic
1102794880 12:115679958-115679980 CTCTTTTTGCTCCCAGTTTCAGG + Intergenic
1103015848 12:117493987-117494009 CTCTTTTTCTTCCCAGTCTCCGG + Intronic
1103603905 12:122072520-122072542 ATCTCTCTGCTCTCAGCCTCTGG - Intergenic
1103880604 12:124163225-124163247 CTCTTTTTCTTCCCAGTCTCAGG - Intronic
1104118452 12:125773378-125773400 ATCTGTCTGCTGTCAGTCTCTGG - Intergenic
1104200290 12:126582464-126582486 CTGTTTCTGATCTCATTCAGGGG + Intergenic
1104202735 12:126607463-126607485 TCCTTTCTGACCTCAGTCTGGGG + Intergenic
1104404731 12:128508098-128508120 CTCTTTTTCTTCCCAGTCTCAGG - Intronic
1104413992 12:128582754-128582776 CTCTTTTTCTTCCCAGTCTCAGG + Intronic
1105530134 13:21211618-21211640 CTCTTTTTCTTCCCAGTCTCGGG + Intergenic
1105753657 13:23445000-23445022 CTCTTTTTCTTCCCAGTCTCAGG + Intergenic
1106331473 13:28743458-28743480 CACTTTGTGACCCCAGTCTCAGG - Intergenic
1106624697 13:31408688-31408710 CTCTTTGAGATCACAGCCTCTGG + Intergenic
1106678144 13:31983522-31983544 CTCTTTTTCTTCCCAGTCTCGGG + Intergenic
1106678486 13:31985751-31985773 CTCTTTTTCTTCCCAGTCTCAGG + Intergenic
1106791649 13:33161756-33161778 CTCTTTTTCTTCCCAGTCTCGGG - Intronic
1107678340 13:42819691-42819713 CTCTTTTTCTTCCCAGTCTCAGG - Intergenic
1108066453 13:46582408-46582430 CTCTTATTGATCTCAGCCACTGG - Intronic
1108326997 13:49343567-49343589 CTCTTTCTTCTCTCTCTCTCTGG - Intronic
1108419690 13:50235252-50235274 CTCTTTTTGTTCCCAGTTTCAGG + Intronic
1108492590 13:50995894-50995916 CCCAGTCTCATCTCAGTCTCAGG + Intergenic
1108724443 13:53164523-53164545 CTCTTTTTGTTCCCAGTTTCAGG - Intergenic
1108790840 13:53967353-53967375 CTCTTTTTCTTCCCAGTCTCAGG + Intergenic
1109221882 13:59647931-59647953 CTCTTTTTCTTCCCAGTCTCAGG + Intergenic
1109356904 13:61242464-61242486 CTCTTTTTGCTCCCAGTTTCAGG - Intergenic
1109475775 13:62878160-62878182 CTCTTTTTCTTCCCAGTCTCAGG - Intergenic
1109482570 13:62974759-62974781 CTCTTTTTCTTCCCAGTCTCAGG - Intergenic
1109526127 13:63579440-63579462 CTCTTTTTCTTCCCAGTCTCAGG - Intergenic
1109720976 13:66276399-66276421 CTCTTTCTCTTCCTAGTCTCGGG + Intergenic
1109824008 13:67693294-67693316 CTCTTTTTCTTCCCAGTCTCAGG - Intergenic
1109969490 13:69748285-69748307 CTCTTTTTCTTCCCAGTCTCAGG - Intronic
1110083502 13:71346702-71346724 CTCTTTTTCTTCCCAGTCTCAGG - Intergenic
1110340624 13:74385796-74385818 CTCTTTTTCTTCCCAGTCTCCGG - Intergenic
1110342085 13:74403450-74403472 CTCTTTTTCTTCCCAGTCTCGGG - Intergenic
1110453104 13:75659406-75659428 CTCTTTTTCTTCCCAGTCTCGGG - Intronic
1110470382 13:75853407-75853429 CTCTTTCTTCTCTTAGTCTTGGG + Intronic
1110495112 13:76159313-76159335 CTCCTTCTGATTTCAGTCCCTGG + Intergenic
1110683234 13:78341366-78341388 CTCTTTTTCTTCCCAGTCTCAGG - Intergenic
1110916417 13:81026694-81026716 CTCTTTTTCTTCCCAGTCTCAGG - Intergenic
1111067171 13:83108195-83108217 CTCTTTTTATTCCCAGTCTCAGG + Intergenic
1111459159 13:88518070-88518092 CTCTTTCTCCTTTCAGTCTTGGG - Intergenic
1111471892 13:88694759-88694781 CTCTTTTTCTTCCCAGTCTCAGG - Intergenic
1111472169 13:88696708-88696730 CTCTTTTTCTTCCCAGTCTCGGG - Intergenic
1111474014 13:88723538-88723560 CTCTTTTTCTTCCCAGTCTCAGG + Intergenic
1111617814 13:90683384-90683406 CTCTTTTTGTTCCCAGTTTCAGG + Intergenic
1111654028 13:91130377-91130399 CTCTTTTTCTTCCCAGTCTCGGG - Intergenic
1112101713 13:96197172-96197194 CTCTTTTTCTTCCCAGTCTCGGG - Intronic
1112785293 13:102944763-102944785 CTCTTTTTCATCTCAGTGTGTGG + Intergenic
1112973514 13:105289178-105289200 CTCTTTTTCATCCCAGTCTCAGG - Intergenic
1113064670 13:106360814-106360836 CTCTTTTTCTTCCCAGTCTCGGG - Intergenic
1113102384 13:106734691-106734713 CTCTTTTTCTTCCCAGTCTCAGG - Intergenic
1113572519 13:111368997-111369019 CTCTTTTTCTTCCCAGTCTCGGG - Intergenic
1113968870 13:114173025-114173047 CTCTTTTTGTTCCCAGTTTCAGG + Intergenic
1114216929 14:20664089-20664111 CTCTTTTTCATCCCAGTCTCGGG - Intergenic
1114388823 14:22283710-22283732 CTCTTTTTCTTCCCAGTCTCAGG + Intergenic
1114598341 14:23933585-23933607 CTCTTTCTCATCTAACTCTTCGG + Intergenic
1114712289 14:24790705-24790727 CTCTTTTTCTTCCCAGTCTCAGG + Intergenic
1114911688 14:27207135-27207157 CTCTTTTTGTTCCCAGTTTCTGG + Intergenic
1115116052 14:29881417-29881439 CTCTTTTTCTTCCCAGTCTCGGG + Intronic
1115130483 14:30047671-30047693 CTCTTTTTCTTCCCAGTCTCAGG - Intronic
1115348517 14:32368113-32368135 CTCTCTCTCATCTCAATTTCTGG + Intronic
1115381217 14:32741852-32741874 CTCTGTCTGGTTTCAGTATCAGG + Intronic
1115484223 14:33894125-33894147 CTCTTTTTCTTCCCAGTCTCAGG + Intergenic
1115504464 14:34079967-34079989 CTCTTTTTCTTCCCAGTCTCAGG + Intronic
1115627825 14:35212589-35212611 ATCTTTCTGAGCTCATTTTCTGG + Intronic
1115917372 14:38331000-38331022 CTCTTTTTGTTCCCAGTTTCGGG - Intergenic
1116079070 14:40150428-40150450 CTCTTTTTCTTCCCAGTCTCAGG - Intergenic
1116477974 14:45364068-45364090 CCCTTCCTTATCTCTGTCTCTGG + Intergenic
1116565006 14:46433370-46433392 CTCTTTTTGTTCCCAGTTTCAGG - Intergenic
1116622392 14:47222950-47222972 CTCTTTTTCTTCCCAGTCTCAGG - Intronic
1116895899 14:50314406-50314428 CTCTTTTTCTTCTCGGTCTCGGG + Intronic
1116907302 14:50416485-50416507 CTCTTTCAGCTTTCTGTCTCAGG + Intergenic
1117186117 14:53242584-53242606 CTCTTTTTCTTCTCAGTCTTGGG + Intergenic
1117826049 14:59704785-59704807 TTCTTCCTGATCACAGTGTCCGG - Intronic
1118657338 14:67966984-67967006 CTCTTTTTCTTCCCAGTCTCGGG - Intronic
1118657604 14:67968906-67968928 CTCTTTTTCTTCCCAGTCTCAGG - Intronic
1119216696 14:72874924-72874946 CTCTTTTTCTTCCCAGTCTCAGG - Intronic
1119465658 14:74856064-74856086 CTCTTTGTGATCACAGTCAAGGG + Intronic
1119768635 14:77206314-77206336 CTCTTCCTGATCTCTGCCCCTGG + Intronic
1119807310 14:77490746-77490768 GCCTCTCCGATCTCAGTCTCAGG - Intronic
1120056164 14:79926544-79926566 CTCTTTTTCTTCCCAGTCTCAGG + Intergenic
1120104512 14:80479344-80479366 CTCTTTTTGTTCCCAGTTTCAGG - Intronic
1120152848 14:81056260-81056282 CTCTTTTTCTTCGCAGTCTCGGG + Intronic
1120276809 14:82385997-82386019 CTCTTTTTCTTCTCAGTCTCAGG + Intergenic
1120276812 14:82386045-82386067 CTCTTTTTCTTCCCAGTCTCAGG + Intergenic
1120392967 14:83930854-83930876 CTCTTTTTCTTCCCAGTCTCAGG + Intergenic
1120541186 14:85753050-85753072 CTCTTTTTGTTCCCAGTTTCAGG - Intergenic
1120625846 14:86825449-86825471 CTATTTCTGACCTCATTCTATGG - Intergenic
1120678729 14:87453497-87453519 TTCTTTCTTATCTGAGTCTATGG - Intergenic
1120688396 14:87564643-87564665 CTCTTTTTCTTCCCAGTCTCGGG + Intergenic
1120690416 14:87586454-87586476 CTATTTCTCATGTCAGTCTATGG - Intergenic
1120735239 14:88045285-88045307 CCCTTTCTTCTCTCAGCCTCTGG - Intergenic
1120809330 14:88786836-88786858 CTCTTTTTCCTCCCAGTCTCAGG + Intronic
1121293988 14:92801660-92801682 ATCTTTATGATCTCAGTGTAAGG - Intronic
1121469163 14:94138688-94138710 CACTTACTGATCTCAGTCCTGGG + Intergenic
1121483669 14:94297352-94297374 CTCTTTCTCTTCCCAGTCTCGGG - Intergenic
1121536327 14:94693532-94693554 CTCTTTTTCTTCCCAGTCTCGGG + Intergenic
1121611402 14:95283338-95283360 CTCTTTTTCTTCCCAGTCTCGGG + Intronic
1121803035 14:96791347-96791369 ATATGGCTGATCTCAGTCTCTGG + Intergenic
1122005378 14:98699133-98699155 CTCTTTTTCTTCCCAGTCTCGGG - Intergenic
1122265107 14:100542961-100542983 GTCTTTCTGACCTCAGACCCTGG + Intronic
1122570995 14:102700858-102700880 CTCTTTTTCTTCCCAGTCTCGGG - Intronic
1122999378 14:105284207-105284229 CTCTGTGTGATTTCAGTCTTCGG - Intronic
1125259517 15:37806891-37806913 CTCTTTTTCTTCCCAGTCTCGGG + Intergenic
1125304057 15:38290564-38290586 CTCTTTTTGTTCCCAGTCTTGGG - Intronic
1125881268 15:43198065-43198087 CTCTTTTTCTTCCCAGTCTCAGG + Intronic
1126873067 15:53010368-53010390 CTCTTTTTCTTCTCAGTCTCTGG - Intergenic
1126929312 15:53630377-53630399 CTCTGTCTGGTTTCAGTATCAGG - Intronic
1126994694 15:54427444-54427466 CTCTTTTTCTTCCCAGTCTCAGG + Intronic
1127097746 15:55529908-55529930 CTCTTTTTCTTCCCAGTCTCGGG + Intergenic
1127144837 15:56013645-56013667 CTCTTTTTCTTCCCAGTCTCAGG - Intergenic
1127777813 15:62281838-62281860 CTCTTTTTCTTCCCAGTCTCAGG - Intergenic
1127837009 15:62798050-62798072 CTCTTTCTTAACTCTGTCTCTGG - Intronic
1127898590 15:63324170-63324192 CTTTGTCTGGTCTCAGCCTCGGG + Exonic
1128212525 15:65912558-65912580 CTCTTTATGATCTCATTACCAGG - Intronic
1128303514 15:66582265-66582287 CTCCTTTTCTTCTCAGTCTCGGG + Intronic
1128436270 15:67652404-67652426 CTGTTTCTGGTCTGGGTCTCAGG + Intronic
1130051984 15:80491212-80491234 CTCTTTTTCTTCCCAGTCTCAGG - Intronic
1130181799 15:81637212-81637234 CTCTTTTTCATCCCAGTCTTGGG + Intergenic
1130417076 15:83703693-83703715 CTCTTTTTCTTCCCAGTCTCGGG + Intronic
1131451048 15:92540383-92540405 CTCTTTTTGTTCCCAGTTTCAGG - Intergenic
1131473916 15:92719949-92719971 CTCTTTCTGTTCTCTGTTCCTGG - Intronic
1131499215 15:92945348-92945370 CTTTTTCTCATCTCTCTCTCAGG - Intronic
1131618155 15:94038312-94038334 CTCTTTTTGTTCCCAGTTTCAGG - Intergenic
1132388057 15:101415920-101415942 CTCTTTTTCTTCCCAGTCTCGGG + Intronic
1132765476 16:1532217-1532239 CTATTTCTGTTCTCAGCCCCCGG - Intronic
1132936639 16:2484538-2484560 CACTTTCTGACCTCACTGTCAGG + Intronic
1132980958 16:2738449-2738471 CTCTTTCTGATCTTCTTCACTGG + Intergenic
1133378898 16:5313541-5313563 CTCTTTCTCTTCCCAGTCTCGGG - Intergenic
1134136457 16:11679629-11679651 TTATTTCTGCTCTCAGTTTCTGG + Exonic
1134331815 16:13258586-13258608 CTCTTTTTGTTCCCAGTTTCGGG - Intergenic
1134853777 16:17502940-17502962 CTCTTTCTTATCTCTCTCCCTGG - Intergenic
1134878325 16:17722161-17722183 CTCTTTTTCTTCCCAGTCTCTGG - Intergenic
1135968706 16:27056433-27056455 CTCTTTTTCTTCACAGTCTCAGG + Intergenic
1136532105 16:30876680-30876702 CTCTCTCTTATCTCAGGCTTTGG - Intronic
1137818698 16:51423194-51423216 CTCTTTTTTTTCCCAGTCTCGGG - Intergenic
1137841017 16:51640956-51640978 CTCTTTTTCTTCCCAGTCTCGGG - Intergenic
1138024871 16:53514481-53514503 CTCTTTTTGTTCCCAGTTTCAGG - Intergenic
1138588837 16:57988337-57988359 CTCTTTCTCTTCCCAGTCTTGGG - Intergenic
1138700871 16:58862097-58862119 CTCTTTTTCTTCCCAGTCTCGGG - Intergenic
1138704825 16:58904435-58904457 CTGTTTCTGACGTCAGTCCCTGG + Intergenic
1138859816 16:60743274-60743296 CTCTTTTTGTTCCCAGTTTCGGG - Intergenic
1139776882 16:69321983-69322005 CTCTTTTTCTTCCCAGTCTCGGG - Intronic
1140759032 16:78094762-78094784 CTCTTTTTCTTCCCAGTCTCGGG - Intergenic
1140824366 16:78692095-78692117 CTCTTTTTCTTCCCAGTCTCAGG + Intronic
1140839306 16:78824532-78824554 CTCTTTTTCTTCCCAGTCTCGGG - Intronic
1140868848 16:79088375-79088397 CTTTATCTGATCAGAGTCTCAGG - Intronic
1141850171 16:86639784-86639806 CCCTTCCTGATCTCACTCCCTGG - Intergenic
1141914578 16:87086384-87086406 TTCTTTCTGATCGCAGTAGCTGG - Intronic
1142176849 16:88649408-88649430 CTCTTTCGGATGGCAGGCTCGGG - Intronic
1142261708 16:89045534-89045556 CTCTTCCTCACCTCTGTCTCAGG + Intergenic
1142793011 17:2283203-2283225 CTCTTTGTAAGCTGAGTCTCAGG - Intronic
1143117118 17:4587345-4587367 CTCTTGCTGTCCTCCGTCTCAGG + Intronic
1143210969 17:5187131-5187153 CTCTTTTTCTTCCCAGTCTCGGG - Intronic
1143316056 17:6034362-6034384 CTCTTTTTCTTCCCAGTCTCAGG - Intronic
1144028823 17:11301879-11301901 CTCTTTCTCTTCCCAGTCTCTGG - Intronic
1145124428 17:20288678-20288700 CTCTTTTTCTTCCCAGTCTCAGG - Intronic
1145985431 17:29042880-29042902 CTCATTATGATCTTTGTCTCAGG - Exonic
1146641187 17:34542671-34542693 ATCTCTCTGGTCTCAGCCTCAGG - Intergenic
1147027325 17:37598567-37598589 CTCTTTCTCTCCTCTGTCTCCGG + Intronic
1147039258 17:37705036-37705058 CTCCATCAGATCTCAGTCTCAGG - Exonic
1147175371 17:38652798-38652820 CTCTTTCTTGGCTCACTCTCTGG - Intergenic
1147378036 17:40034549-40034571 ATCTGTCTGTTCTCAGGCTCTGG + Intronic
1147772663 17:42878568-42878590 CTCTTCTTGATCTCACTCCCAGG - Intergenic
1148552567 17:48559330-48559352 CAATTTCTGATCTCAGACTTGGG + Intronic
1148640332 17:49182921-49182943 CTCTTTTTCTTCCCAGTCTCAGG + Intergenic
1149452092 17:56757867-56757889 CTCTTTTTCCTCCCAGTCTCAGG + Intergenic
1149853996 17:60063022-60063044 CTCTTTTTCTTCCCAGTCTCGGG + Intronic
1150092469 17:62339939-62339961 CTCTTTTTCTTCCCAGTCTCAGG + Intergenic
1150211057 17:63441747-63441769 CCCTTGCTGGCCTCAGTCTCTGG - Intronic
1150637198 17:66921934-66921956 CTCTTTTTCTTCTCAGTCTTGGG + Intergenic
1150941586 17:69699250-69699272 CTCTTTTTAATCCCAGTCTAGGG - Intergenic
1150949466 17:69785903-69785925 CTCTTTTTCTTCCCAGTCTCGGG + Intergenic
1151017750 17:70576850-70576872 CTCTTTTTCTTCCCAGTCTCAGG + Intergenic
1151118298 17:71763830-71763852 CTCTTCCTAGTCTCAGTCTTGGG + Intergenic
1151984646 17:77534439-77534461 CTCTTTTTCTTCCCAGTCTCCGG + Intergenic
1152218020 17:79045660-79045682 CTCTTTCTGAGCTCTGTTCCTGG - Intronic
1153012106 18:548562-548584 CTCTTTTTGTTCCCAGTCTCAGG - Intergenic
1153101057 18:1470223-1470245 CTCTTTTTCTTCCCAGTCTCAGG - Intergenic
1153199519 18:2634270-2634292 CTCTTTTTCTTCCCAGTCTCGGG + Intergenic
1153316615 18:3728928-3728950 CTCTTTCCCATCTCTATCTCTGG - Intronic
1153403192 18:4704412-4704434 CTCTTTCTGATGTCAGACACGGG - Intergenic
1153449554 18:5211964-5211986 CTCTTTTTCTTCCCAGTCTCGGG - Intergenic
1154284057 18:13035307-13035329 CTCTTTTTGTTCCCAGTTTCGGG - Intronic
1155329101 18:24696495-24696517 CTCTTTTTCTTCCCAGTCTCAGG + Intergenic
1155632253 18:27907104-27907126 CTCTTTTTCTTCCCAGTCTCAGG - Intergenic
1155883341 18:31177644-31177666 CTCTTTTTCTTCCCAGTCTCAGG + Intergenic
1155988237 18:32253321-32253343 CTCTTTTTCTTCCCAGTCTCAGG - Intronic
1156062942 18:33103096-33103118 CTCTTTTTCTTCCCAGTCTCAGG - Intronic
1156081569 18:33341786-33341808 CTCTTTTTCTTCCCAGTCTCAGG + Intronic
1156281826 18:35646585-35646607 CTCTCTCTGATCACACTCTGGGG - Intronic
1156441262 18:37190602-37190624 CTCTTTCTTAGCTCAAACTCTGG - Intronic
1156538826 18:37890100-37890122 TTCTCTATGATCTCAGCCTCAGG + Intergenic
1156875093 18:42000626-42000648 TTCTTTTTCTTCTCAGTCTCAGG - Intronic
1157282674 18:46356480-46356502 CTCTCTCTGCCCTCAGGCTCAGG - Intronic
1157336167 18:46739128-46739150 CTCTTTCTGGTCTCAGCCCACGG - Intronic
1157456073 18:47829081-47829103 CTTTTTCTGTTCTCATTCACAGG - Exonic
1157738806 18:50074060-50074082 CTCTTTTTCTTCCCAGTCTCGGG - Intronic
1157767359 18:50310162-50310184 CTCTTTTTCTTCCCAGTCTCGGG - Intergenic
1157803868 18:50643766-50643788 CTCTTGTTGACCTCAGTCTAGGG + Intronic
1157895824 18:51466005-51466027 CTTTTTCTGCACTGAGTCTCAGG + Intergenic
1157973210 18:52295092-52295114 CTCTTTTTCTTCCCAGTCTCAGG - Intergenic
1158013831 18:52761075-52761097 CTCTTTTTCTTCCCAGTCTCTGG - Intronic
1158116099 18:53997524-53997546 CTCTTTTTGTTCCCAGTTTCGGG - Intergenic
1158552987 18:58452825-58452847 CTCTTTTTCTTCCCAGTCTCGGG - Intergenic
1158678588 18:59545906-59545928 CTCTTTTTCTTCTGAGTCTCAGG + Intronic
1159083311 18:63759908-63759930 CTCTTTTTCTTCCCAGTCTCAGG + Intronic
1159141169 18:64396766-64396788 CTCTTTTTCTTCCCAGTCTCAGG + Intergenic
1159275463 18:66214957-66214979 CTCTTTTTCTTCCCAGTCTCAGG + Intergenic
1159306039 18:66643654-66643676 CTCTTTCTCTTCCCAGTCTCAGG - Intergenic
1159316179 18:66776704-66776726 CTCTTTTTCTTCCCAGTCTCAGG - Intergenic
1159962250 18:74564962-74564984 CTCTTTTTCTTCCCAGTCTCAGG - Intronic
1160096336 18:75876990-75877012 CTCTTTTTCTTCCCAGTCTCAGG + Intergenic
1160096599 18:75878876-75878898 CTCTTTTTCTTCCCAGTCTCAGG + Intergenic
1160284365 18:77526418-77526440 CTCTTTTTCTTCCCAGTCTCGGG + Intergenic
1160956640 19:1696108-1696130 CTCTTTTTCTTCCCAGTCTCAGG + Intergenic
1161713491 19:5863115-5863137 CTCTTCCAGATCTCAGTGGCTGG - Intergenic
1162296005 19:9814099-9814121 CTCTTTTTCTTCCCAGTCTCAGG - Intronic
1162296411 19:9816833-9816855 CTCTTTTTCTTCCCAGTCTCAGG - Intronic
1163065533 19:14790523-14790545 CACTATCTGAACTCAGTCTCAGG - Intergenic
1163107884 19:15137290-15137312 CTCTTTTTCTTCCCAGTCTCAGG - Intergenic
1163427814 19:17248617-17248639 GTCTTTCTAATCCCTGTCTCGGG + Intronic
1164213810 19:23125182-23125204 CTCTTTTTCTTCCCAGTCTCTGG + Intronic
1164214327 19:23130381-23130403 CTCTTTCTCTTCCCAGTCTCAGG + Intronic
1164821554 19:31255053-31255075 CTTTGTCTGATCAGAGTCTCTGG - Intergenic
1164841323 19:31394565-31394587 CTCTTTTTCTTCCCAGTCTCAGG + Intergenic
1165888233 19:39094796-39094818 CTGTTTTTCTTCTCAGTCTCAGG - Intronic
1167403642 19:49289629-49289651 CTCTTTTTGTTCCCAGTTTCAGG + Exonic
1167556876 19:50202325-50202347 CTCTCTCTGATCTCACCCCCAGG - Intronic
1167759106 19:51433270-51433292 TTCTTTCTGATCACAGCCCCTGG + Intergenic
1167773810 19:51541757-51541779 CTCCTTCTGCTCTCAGACTGGGG + Intergenic
1168587134 19:57602729-57602751 CTCTTTTTCTTCCCAGTCTCAGG - Intronic
925013924 2:507594-507616 CTCCTTCTGTTCTCTGTTTCTGG - Intergenic
925257227 2:2500482-2500504 CTCTTTTTGTTCCCAGTTTCAGG - Intergenic
925537506 2:4933268-4933290 CTCTTTTTGTTCCCAGTCTCAGG + Intergenic
925781808 2:7388454-7388476 CTCTTTTTCTTCCCAGTCTCAGG - Intergenic
925782085 2:7390394-7390416 CTCTTTTTCTTCCCAGTCTCGGG - Intergenic
925805268 2:7642154-7642176 CTCTTTTTCTTCTCCGTCTCAGG - Intergenic
926213459 2:10888932-10888954 CTCTTTTTCTTCCCAGTCTCAGG - Intergenic
926269175 2:11352227-11352249 CTCTTTTTGTTCCCAGTTTCAGG - Intergenic
926816822 2:16805744-16805766 CTCTTTTTCTTCTCAGTCTTGGG - Intergenic
926947327 2:18202645-18202667 CTCTTTTTCTTCCCAGTCTCTGG + Intronic
927107120 2:19837313-19837335 CTCTTTCAGCTCTCAGTCCCAGG + Intergenic
927185395 2:20478631-20478653 CTCTTTTTCTTCCCAGTCTCAGG + Intergenic
927350235 2:22103721-22103743 CTCTTTTTCTTCTCAGTCTTAGG - Intergenic
927401729 2:22720255-22720277 CTCTTTTTCTTCCCAGTCTCAGG - Intergenic
927612740 2:24558342-24558364 CTCTTTTTCTTCCCAGTCTCGGG - Intronic
927640966 2:24845110-24845132 CTCTTTTTCTTCCCAGTCTCAGG + Intronic
928458668 2:31449206-31449228 CTCTTTTTCTTCCCAGTCTCAGG + Intergenic
928465742 2:31520687-31520709 CTCTTTTTGTTCCCAGTTTCAGG + Intergenic
928614902 2:33028081-33028103 CTTCTTCCGAACTCAGTCTCAGG - Intronic
928680252 2:33693958-33693980 CTCTTTTTCTTCCCAGTCTCAGG - Intergenic
928777233 2:34780495-34780517 CTCTTTTTCTTCCCAGTCTCAGG - Intergenic
929134383 2:38609218-38609240 CTCTTTTTCTTCTCAGTCTTGGG - Intergenic
929656441 2:43736948-43736970 GTCTTTCTGTCCTCAGCCTCAGG - Intronic
929715699 2:44307006-44307028 CCCTCTCTGTCCTCAGTCTCTGG + Intronic
929885548 2:45874544-45874566 CTCCTTCTTGTCTCACTCTCTGG + Intronic
930006946 2:46905161-46905183 CTCTTTTTCTTCCCAGTCTCGGG + Exonic
930076304 2:47408288-47408310 CTCTTTTTCTTCCCAGTCTCGGG + Intronic
930155416 2:48102668-48102690 CTCTTTTTGTTCCCAGTTTCAGG - Intergenic
930161518 2:48162300-48162322 CTCCTTCTCTTCTCAGACTCTGG - Intergenic
930217472 2:48711232-48711254 CTCTCTCAGATCTCAGTAACAGG + Intronic
930585443 2:53262670-53262692 CTCTTTTTCTTCCCAGTCTCAGG - Intergenic
931406273 2:61981578-61981600 CTCTTTCTCTTTCCAGTCTCGGG - Intronic
931629831 2:64288774-64288796 GTCTTTCTGATCTCTCACTCTGG - Intergenic
931698518 2:64890151-64890173 TGCTTTCTGGTCTCAGGCTCCGG + Intergenic
931929611 2:67115573-67115595 CTCTTTTTCTTCCCAGTCTCAGG + Intergenic
931963213 2:67504401-67504423 CTCTTTTTCTTCCCAGTCTCAGG + Intergenic
932904509 2:75734680-75734702 CTCTTTTTCTTCCCAGTCTCAGG - Intergenic
932924786 2:75960309-75960331 ATATTTCTGAACTCAGTCACCGG - Intergenic
933008092 2:77022040-77022062 CTCTTTTTCTTCCCAGTCTCGGG - Intronic
933156932 2:78986460-78986482 CTCTTTTTCTTCCCAGTCTCAGG - Intergenic
933317372 2:80731922-80731944 CTCTTTTTATTCCCAGTCTCAGG - Intergenic
933602218 2:84344642-84344664 CTCTTTTTCTTCCCAGTCTCAGG + Intergenic
933947035 2:87295907-87295929 CTCTTTTTCTTCCCAGTCTCAGG - Intergenic
933981677 2:87555777-87555799 CTCTTTTTGTTCCCAGTTTCAGG - Intergenic
934614368 2:95762237-95762259 CGCTTCCCGGTCTCAGTCTCTGG + Intergenic
934646533 2:96062262-96062284 CGCTTCCAGGTCTCAGTCTCTGG - Intergenic
934839933 2:97618344-97618366 CGCTTCCAGGTCTCAGTCTCTGG - Intergenic
935151202 2:100438055-100438077 CTCTTTTTCTTCCCAGTCTCTGG + Intergenic
935188238 2:100753673-100753695 CTCCTTCTGTGCTCAGTCTCAGG - Intergenic
935484024 2:103630321-103630343 GACTCTCTGATCTCAGTCACAGG - Intergenic
935514079 2:104013205-104013227 CTCTTTTTCTTCCCAGTCTCAGG - Intergenic
935625766 2:105171225-105171247 CTCTTTTTCTTCCCAGTCTCAGG - Intergenic
935626096 2:105173469-105173491 CTCTTTTTCTTCCCAGTCTCAGG - Intergenic
935662204 2:105476774-105476796 CTCCTTCTACTCTCAGTATCTGG - Intergenic
936312159 2:111395040-111395062 CTCTTTTTGTTCCCAGTTTCAGG + Intergenic
936333155 2:111565662-111565684 CTCTTTTTCTTCCCAGTCTCAGG + Intergenic
936586564 2:113763483-113763505 CTCTTTTTCTTCTCAGTCTCAGG - Intergenic
936792185 2:116163687-116163709 CTCTTTTTTTTCTCAGTCTTGGG + Intergenic
936792507 2:116165869-116165891 CTCTTTTTCCTCCCAGTCTCAGG + Intergenic
936827692 2:116602105-116602127 CTCTTTTTCTTCCCAGTCTCAGG + Intergenic
936936991 2:117848212-117848234 CTCTTTTTCTTCCCAGTCTCGGG + Intergenic
937422939 2:121773470-121773492 CTCTTTCTGTTTTCAGTTTAAGG - Intergenic
937518579 2:122684472-122684494 CTCTTTTTCTTCCCAGTCTCAGG - Intergenic
937646824 2:124274932-124274954 CTCTTTTTCTTCCCAGTCTCTGG - Intronic
938850234 2:135252068-135252090 CTCTTTTTCTTCCCAGTCTCAGG + Intronic
938868972 2:135453944-135453966 CTCTTTTTGTTCCCAGTTTCGGG - Intronic
939137462 2:138314606-138314628 CTCTTTTTCTTCCCAGTCTCAGG - Intergenic
939137744 2:138316534-138316556 CTCTTTTTCTTCCCAGTCTCGGG - Intergenic
939272778 2:139960960-139960982 CTCTTTTTCTTCCCAGTCTCAGG + Intergenic
939278375 2:140030979-140031001 CTCTTTTTCTTCACAGTCTCAGG + Intergenic
939568787 2:143815651-143815673 CTCTTTTTCTTCCCAGTCTCAGG - Intergenic
939833892 2:147104750-147104772 CTGCTTCAGATCACAGTCTCTGG - Intergenic
940193021 2:151062476-151062498 CTCTTTTTCTTCCCAGTCTCAGG - Intergenic
940815089 2:158288830-158288852 CTCTTTTTCTTCCCAGTCTCAGG - Intronic
941137422 2:161734503-161734525 CTCTTTTTCTTCCCAGTCTCGGG + Intronic
941346064 2:164371172-164371194 CTCTTTTTCTTCCCAGTCTCAGG - Intergenic
941469029 2:165861732-165861754 CTCTTTTTCTTCCCAGTCTCAGG - Intronic
941477742 2:165969120-165969142 CTCTTTTTGTTCCCAGTTTCAGG + Intergenic
941545927 2:166851484-166851506 CTCTTTCTCTTCCCAGTCTCAGG - Intergenic
941741773 2:169043344-169043366 CTCTTTTTCTTCCCAGTCTCAGG + Intergenic
941742053 2:169045279-169045301 CTCTTTTTCTTCCCAGTCTCAGG + Intergenic
941821070 2:169843767-169843789 CTCTGTCTGATTTTGGTCTCAGG + Intronic
942640767 2:178058563-178058585 CTCTTTTTCTTCCCAGTCTCGGG + Intronic
942946812 2:181681758-181681780 CTCTTGCTCCCCTCAGTCTCGGG + Intergenic
943205148 2:184885599-184885621 CTCTTTTTCTTCCCAGTCTCAGG - Intronic
943251422 2:185524859-185524881 CTCTTTTTGTTCCCAGTTTCAGG + Intergenic
943491243 2:188558456-188558478 CTCTTTTTCTTCCCAGTCTCAGG + Intronic
943978028 2:194508969-194508991 CTCTTTTTCTTCCCAGTCTCAGG - Intergenic
944831571 2:203538313-203538335 CTCTTTTTCTTCCCAGTCTCAGG - Intergenic
944956874 2:204821869-204821891 CTCTTTTTCTTCCCAGTCTCAGG + Intronic
945610230 2:211992194-211992216 CTCTTTTTCTTCCCAGTCTCTGG - Intronic
945713358 2:213329103-213329125 CTCTTTTTCTTCCCAGTCTCAGG + Intronic
945759899 2:213902334-213902356 CTCTTTTTCTTCCCAGTCTCAGG - Intronic
945817841 2:214627468-214627490 CTCTTTTTCTTCCCAGTCTCAGG - Intergenic
945961419 2:216139279-216139301 CTCTTTTTCTTCCCAGTCTCGGG - Intronic
946310996 2:218882568-218882590 CTCTTTCTGATCTCAGGCCATGG + Intronic
946610804 2:221455598-221455620 GTCCTTCTGGTCTCTGTCTCGGG - Exonic
946930240 2:224663571-224663593 CTCTTTTTCTTCCCAGTCTCAGG - Intergenic
947237183 2:227953226-227953248 CTCTTTTTCTTCCCAGTCTCAGG + Intergenic
947912432 2:233810236-233810258 CTCTTTTTGTTCCCAGTTTCAGG - Intronic
948241626 2:236442325-236442347 CTGTTTCTGCACTCAGTCTGTGG + Intronic
948286256 2:236787711-236787733 CTCTTTTTCTTCCCAGTCTCAGG + Intergenic
948649021 2:239427291-239427313 TTAATGCTGATCTCAGTCTCAGG + Intergenic
948785854 2:240352553-240352575 CTCTTTTTCTTCCCAGTCTCAGG - Intergenic
1168731372 20:84416-84438 CTCTTTATGATCTCTGACTTTGG + Intergenic
1169599395 20:7240192-7240214 CTCTTCCTTCTCTCACTCTCTGG + Intergenic
1169999373 20:11597427-11597449 CTCTTTTTCTTCCCAGTCTCAGG - Intergenic
1170106746 20:12759679-12759701 CTCTTTTTCTTCCCAGTCTCGGG - Intergenic
1170118876 20:12891264-12891286 CTCTTTTTCTTCCCAGTCTCAGG + Intergenic
1170365055 20:15589018-15589040 CTCTTTTTCTTCCCAGTCTCAGG - Intronic
1171164757 20:22959897-22959919 CTCTTTTTCTTCCCAGTCTCAGG + Intergenic
1171262851 20:23748491-23748513 CTCTGTCTAATCCCAGCCTCAGG - Intronic
1171265707 20:23770956-23770978 CTCTGTCTAATCCCAGCCTCAGG - Intergenic
1171271978 20:23824695-23824717 CTCTGTCTAATCCCAGCCTCAGG - Intronic
1172228710 20:33322729-33322751 CTCTTTCTGATAAAGGTCTCTGG - Intergenic
1172799848 20:37568043-37568065 CTGCTTCTGATCTCAGATTCTGG + Intergenic
1173057867 20:39633918-39633940 CGCTTTCTGACTTCATTCTCCGG + Intergenic
1173071043 20:39765347-39765369 CTCTTTTTCTTCCCAGTCTCAGG + Intergenic
1173179378 20:40791909-40791931 CTTTTTCTGATTTCATTTTCAGG + Intergenic
1173375044 20:42475532-42475554 CTTTCCCTGGTCTCAGTCTCCGG - Intronic
1173537757 20:43829031-43829053 CTCTTTTTCTTCCCAGTCTCAGG - Intergenic
1174057897 20:47811092-47811114 CCCTTTCTGCTCTCAGTTTAGGG - Intergenic
1174069068 20:47887379-47887401 AGCTTTCTGCTCTCAGTCCCTGG - Intergenic
1174160381 20:48546222-48546244 CCCTTTCTGCTCTCAGTTTAGGG + Intergenic
1174212123 20:48888061-48888083 CTCTTTTTGTTCCCAGTTTCGGG - Intergenic
1174865888 20:54135373-54135395 CTCTTTCTCTTCCCAGTCTCAGG - Intergenic
1174951193 20:55042697-55042719 CTCTTTTTCTTCTCAGTCTTGGG + Intergenic
1175008365 20:55709949-55709971 CTCTTTTTCTTCCCAGTCTCAGG + Intergenic
1175417008 20:58808404-58808426 CTCATTCTGATGTCAGGCACTGG + Intergenic
1175749203 20:61483622-61483644 TTCCTTCTCATCCCAGTCTCAGG - Intronic
1176935202 21:14859780-14859802 CTCTTTTTCTTCCCAGTCTCTGG - Intergenic
1177117401 21:17102863-17102885 CTCTTTTTGTTCCCAGTCTCGGG + Intergenic
1177127564 21:17214864-17214886 ATCTTTCTGATCTCTGCATCAGG - Intergenic
1177224646 21:18238269-18238291 CTCTTTCTCTTCCCAGTCTCGGG - Intronic
1177334806 21:19708808-19708830 CTCTTTTTCTTCCCAGTCTCAGG + Intergenic
1177477802 21:21645832-21645854 CTCTTTTTGTTCCCAGTTTCAGG + Intergenic
1177523890 21:22267775-22267797 CTCTTTTTCCTCCCAGTCTCAGG + Intergenic
1177614282 21:23498101-23498123 CTCTTTTTCTTCCCAGTCTCGGG - Intergenic
1178004201 21:28197816-28197838 CTCTTTTTCTTCTCAGTCTTGGG - Intergenic
1178099430 21:29252183-29252205 CTCTTTTTCTTCCCAGTCTCAGG - Intronic
1178468859 21:32874160-32874182 CTCTTTTTCTTCTCAGTCTTGGG - Intergenic
1178469141 21:32876096-32876118 CTCTTTTTCTTCTCAGTCTTGGG - Intergenic
1178801989 21:35804681-35804703 CTCTTTTTCTTCCCAGTCTCAGG - Intronic
1178972544 21:37193919-37193941 CTATTGCAGATCTCTGTCTCTGG - Intronic
1179235426 21:39541305-39541327 CTCTTTTTGTTCCCAGTTTCAGG - Intergenic
1179235896 21:39545510-39545532 CTCTTTTTCTTCCCAGTCTCAGG + Intergenic
1179316538 21:40248812-40248834 CTCTTTTTCTTCCCAGTCTCAGG - Intronic
1180590413 22:16932493-16932515 CACTTTCTGCCTTCAGTCTCAGG - Intergenic
1181184149 22:21089925-21089947 CTCTTTCTGACCACACTCACTGG - Intergenic
1181935748 22:26437162-26437184 CTGCTTCTGACCTCATTCTCTGG - Intronic
1182330006 22:29545022-29545044 CTCTTTTTGTTCCCAGTTTCAGG - Intronic
1182451781 22:30426070-30426092 CCCTGTCTGAGCCCAGTCTCCGG - Intronic
1182679797 22:32070021-32070043 CTCTTTCTGAACCCAGCCACTGG + Intronic
1182700305 22:32231407-32231429 CTGTTGCTGTTGTCAGTCTCCGG - Intronic
1182889060 22:33801216-33801238 CTCTTTTTCTTCCCAGTCTCAGG + Intronic
1183442752 22:37832540-37832562 CTCTTTCTGATACGAGTGTCTGG + Intronic
1184015248 22:41781186-41781208 CTATTTCAGATGTCAGTCTTGGG - Intronic
949424945 3:3906725-3906747 CTCTTTTTCTTCCCAGTCTCGGG + Intronic
949506168 3:4729752-4729774 CTTTTTCTTTTCTCAGTCTTAGG + Intronic
950263522 3:11559036-11559058 CTCTTTCTGAACTCGGACTCTGG - Intronic
950443042 3:13020992-13021014 TTCTTTCTGCCCTCACTCTCTGG - Intronic
950800916 3:15551282-15551304 CTCTTTTTCTTCCCAGTCTCCGG + Intergenic
950843093 3:15987133-15987155 CTCTTTTTCTTCCCAGTCTCAGG - Intergenic
950843367 3:15989065-15989087 CTCTTTTTCTTTTCAGTCTCAGG - Intergenic
951058349 3:18173956-18173978 CTCTTTTTCTTCCCAGTCTCAGG - Intronic
951146182 3:19229948-19229970 CTCTTTTTCTTCCCAGTCTCAGG - Intronic
951199552 3:19862175-19862197 CTCTTTTTCTTCCCAGTCTCGGG - Intergenic
951284098 3:20788324-20788346 CTCTTTTTCTTCCCAGTCTCAGG + Intergenic
951362145 3:21738073-21738095 CTTTCCCTGATCTCAGCCTCAGG + Intronic
951444170 3:22757723-22757745 CTCTTTCTGATCAGATTCTCGGG - Intergenic
951553128 3:23895333-23895355 CTCTCTATGATCTCAGTTCCAGG + Intronic
951700893 3:25495724-25495746 GTCTTTCTGATCTCAGTAATTGG + Intronic
951793855 3:26516674-26516696 CTCTTTTTTTTCCCAGTCTCAGG + Intergenic
952029632 3:29125666-29125688 CTCTTTTTCTTCCCAGTCTCAGG + Intergenic
952255277 3:31689828-31689850 CTCTTTTTCTTCCCAGTCTCAGG + Intronic
952563004 3:34617843-34617865 CTCTTTTTGTTCCCAGTTTCAGG - Intergenic
952739874 3:36724748-36724770 CTCTTTTTCTTCCCAGTCTCAGG + Intronic
953685671 3:45076650-45076672 CTCTTTTTCTTCCCAGTCTCGGG + Intergenic
953685954 3:45078588-45078610 CTCTTTTTCTTCCCAGTCTCAGG + Intergenic
953712664 3:45287752-45287774 CTCTTTTTCTTCCCAGTCTCAGG + Intergenic
953943098 3:47119701-47119723 CTCTTTTTCTTCCCAGTCTCGGG + Intronic
954502875 3:51037004-51037026 CTCTTTTTCTTCCCAGTCTCAGG + Intronic
954732507 3:52676552-52676574 CTCTTTTTCTTCCCAGTCTCGGG + Intronic
954759407 3:52863217-52863239 CTCTTTTTCTTCCCAGTCTCGGG - Intronic
954841636 3:53516589-53516611 GTCTTTCTGCTTTCAGTCACAGG - Intronic
954955219 3:54512829-54512851 CTCTTTTTCTTCCCAGTCTCAGG - Intronic
955201601 3:56856574-56856596 CTCTCCCTGACCTCTGTCTCTGG + Intronic
955826167 3:62950535-62950557 CTCTTTATCTTCTCAGTCTTGGG + Intergenic
955973470 3:64458969-64458991 CTCTTTTTCTTCCCAGTCTCAGG - Intergenic
956185799 3:66560801-66560823 CTCTTTTTCTTCCCAGTCTCAGG - Intergenic
956318299 3:67965135-67965157 CTCTTTTTCTTCCCAGTCTCGGG - Intergenic
956412518 3:68993714-68993736 CTCTTTTTCTTCCCAGTCTCGGG - Intronic
956503136 3:69909334-69909356 CTCTTTTTCCTCCCAGTCTCAGG + Intronic
957003231 3:74910904-74910926 CTCTTTTTGTTCCCAGTTTCGGG + Intergenic
957113331 3:75993487-75993509 CTCTTTTTCTTCCCAGTCTCAGG + Intronic
957273129 3:78056635-78056657 CTCTTTTTCCTCCCAGTCTCAGG + Intergenic
957403554 3:79748861-79748883 CTCTTTTTCTTCCCAGTCTCAGG + Intronic
957403812 3:79750770-79750792 CTCTTTTTCTTCTCAGTCTAGGG + Intronic
957413967 3:79877092-79877114 CTCTTCCTCTTCTCAGGCTCTGG + Intergenic
957630643 3:82712129-82712151 CTCTTTTTCTTCCCAGTCTCAGG - Intergenic
957736815 3:84214365-84214387 CTCTTTTTCTTCCCAGTCTCGGG - Intergenic
957981886 3:87520650-87520672 CTCTTTTTCTTCCCAGTCTCAGG + Intergenic
958146359 3:89630377-89630399 CTCTTTTTCTTCCCAGTCTCAGG + Intergenic
958146682 3:89632636-89632658 CTCTTTTTCTTCCCAGTCTCGGG + Intergenic
958600492 3:96289960-96289982 CTCTTTTTCCTCCCAGTCTCGGG + Intergenic
958631613 3:96690698-96690720 ATCTTTCTCATCTCAGTATATGG - Intergenic
959172365 3:102859058-102859080 CTCTTTTTCTTCCCAGTCTCAGG - Intergenic
959235508 3:103717643-103717665 CTCTTTTTCTTCCCAGTCTCAGG - Intergenic
959342323 3:105147884-105147906 CTCTTTTTCTTCCCAGTCTCAGG - Intergenic
959727250 3:109558328-109558350 CTTTTTCTGTTCCCAGTTTCGGG + Intergenic
959968554 3:112382567-112382589 CTCTTTTTATTCCCAGTCTCAGG + Intergenic
959975087 3:112449998-112450020 CTCTTTTTCTTCCCAGTCTCGGG - Intergenic
960354303 3:116632347-116632369 CTCTTTTTCTTCCCAGTCTCAGG - Intronic
960468367 3:118027302-118027324 CTCTTTTTCTTCCCAGTCTCAGG + Intergenic
960496614 3:118383204-118383226 CTCTTTTTCTTCCCAGTCTCAGG + Intergenic
960501694 3:118445546-118445568 CTCTTTTTCTTCCCAGTCTCCGG - Intergenic
960709588 3:120514359-120514381 CATTTTATGATCTAAGTCTCTGG + Intergenic
961788409 3:129361082-129361104 CTCTTTTTCATCCCAGTCTCGGG - Intergenic
961789457 3:129365356-129365378 CTCTTTTTCTTCCCAGTCTCAGG - Intergenic
961962138 3:130865797-130865819 CTCTTTTTTATCCCAGTCTTGGG + Intronic
962216203 3:133524053-133524075 CTTTTTCTGTTCTCATTCACAGG - Intergenic
962368814 3:134804154-134804176 CTCTTTTTCTTCCCAGTCTCAGG - Intronic
962659235 3:137584820-137584842 CTCTTTTTCTTCCCAGTCTCAGG - Intergenic
962689260 3:137877368-137877390 CTCTTTTTCTTCCCAGTCTCAGG + Intergenic
962964804 3:140343580-140343602 GTATTTCTGATCTCAGTGACTGG + Intronic
962999055 3:140659612-140659634 CTCTGCCAGATGTCAGTCTCAGG - Intergenic
963339611 3:144019132-144019154 CTCCTTTTCTTCTCAGTCTCCGG - Intronic
963388979 3:144632969-144632991 CTCTTTTTCTTCCCAGTCTCAGG + Intergenic
963492823 3:146022360-146022382 CTCTTTTTCTTCCCAGTCTCAGG + Intergenic
963563913 3:146903461-146903483 ATCTTTCTGATCTCAGTTGATGG - Intergenic
963716861 3:148812697-148812719 CTCTTTCTGTTCCCAGTTTCTGG + Intronic
963912612 3:150827631-150827653 CACTTTCTGATCTCAGAAACTGG + Intergenic
964190389 3:153993647-153993669 CTCTTTTTCTTCCCAGTCTCAGG + Intergenic
964426876 3:156562805-156562827 CTCTTTTTGTTCCCAGTTTCGGG + Intergenic
964456113 3:156868472-156868494 CTCTTTGTGAGCTCAGGCACAGG - Intronic
964589065 3:158340645-158340667 CTCTTTCTGTTCCCAGTGTCGGG + Intronic
964589354 3:158342544-158342566 CTCTTTCTGTTCCCAGTTTCAGG + Intronic
964654711 3:159053108-159053130 CTCTTTTTGTTCCCAGTTTCAGG + Intronic
964836036 3:160939734-160939756 CTCTTTTTCTTCCCAGTCTCAGG + Intronic
964836322 3:160941664-160941686 CTCTTTTTCTTCCCAGTCTCGGG + Intronic
964917931 3:161858432-161858454 ATGTTTATGATCTCAGTTTCAGG + Intergenic
965045379 3:163571503-163571525 CTCTTTTTCTTCACAGTCTCTGG + Intergenic
965086727 3:164110070-164110092 CTATTTCTTATATCAGTCTCTGG + Intergenic
965086764 3:164110834-164110856 CTCTTTTTCTTCCCAGTCTCAGG - Intergenic
965162205 3:165148745-165148767 CTTTGTCTGATTTCAGTATCAGG - Intergenic
965361095 3:167738993-167739015 CTCTTGCTCATCTTAGTGTCTGG - Intronic
965420612 3:168453986-168454008 CTCTTTTTCTTCCCAGTCTCGGG - Intergenic
965596730 3:170418551-170418573 CCCTCTCTCATCTCAGTCTCTGG - Intergenic
965839501 3:172887398-172887420 CTCTTTGTGAGCTCCCTCTCTGG + Intergenic
966343142 3:178947577-178947599 CTCTTTTTCTTCCCAGTCTCAGG + Intergenic
966620614 3:181959533-181959555 GTCCTTCTGATTTCAGCCTCAGG - Intergenic
966733185 3:183167724-183167746 CTCTTTTTCTTCCCAGTCTCAGG - Intergenic
966838798 3:184071219-184071241 CTCTTTTTGTTCCCAGTTTCGGG - Intergenic
967106303 3:186257430-186257452 CACTTTCTGGACTCAGGCTCCGG + Intronic
967246119 3:187488237-187488259 CTCTTTTTGTTCACAGTTTCAGG + Intergenic
967395535 3:189004534-189004556 CTCTTTTAGCTCTCACTCTCTGG + Intronic
967551453 3:190800478-190800500 CTCTTTTTCTTCCCAGTCTCAGG + Intergenic
967551669 3:190802030-190802052 CTCTTTTTCTTCCCAGTCTCAGG + Intergenic
967565179 3:190963735-190963757 CTCTTTTTCTTCCCAGTCTCAGG + Intergenic
967908193 3:194519236-194519258 CTCTTTTTCTTCCCAGTCTCGGG + Intergenic
968523480 4:1045035-1045057 CTGGGTCTGATCACAGTCTCAGG - Intergenic
968666808 4:1826944-1826966 CTCCGTCTGTTCTGAGTCTCAGG + Intronic
968749556 4:2380866-2380888 CTCTTTTTCATCCCAGTCTCAGG + Intronic
969050307 4:4368377-4368399 CTCTTTTTCTTCCCAGTCTCAGG + Intronic
969072739 4:4552485-4552507 CTCTTTCTCTTCCTAGTCTCGGG + Intergenic
969902462 4:10362545-10362567 CTCTTTTTCTTCCCAGTCTCGGG - Intergenic
970054413 4:11954094-11954116 CTTTTCCAGATCTCAGTCTTCGG - Intergenic
970218175 4:13780654-13780676 CTCTTTTTCTTCCCAGTCTCGGG - Intergenic
970222685 4:13826429-13826451 CTCTTTTTCTTCCCAGTCTCGGG + Intergenic
970262637 4:14244288-14244310 CTCTTTTTCTTCCCAGTCTCGGG + Intergenic
970306213 4:14735001-14735023 CTCTTTTTCTTCCCAGTCTCAGG - Intergenic
970398908 4:15699536-15699558 CTCTTTCTGTTCCCAGTTTCAGG - Intronic
970426681 4:15952565-15952587 CTCTTTTTCTTCCCAGTCTCGGG - Intergenic
970868272 4:20783376-20783398 CTCTTTTTCTTCCCAGTCTCAGG - Intronic
970869118 4:20794158-20794180 CTCTTTTTCTTCCCAGTCTCGGG + Intronic
970977261 4:22056333-22056355 CTCTTTTTCTTCCCAGTCTCAGG + Intergenic
970979136 4:22076030-22076052 CTCTTTTTGTTCCCAGTTTCAGG + Intergenic
971260473 4:25052343-25052365 CTCTTTTTCTTCCCAGTCTCGGG + Intergenic
971539455 4:27797548-27797570 ATTTTTCGGAGCTCAGTCTCAGG - Intergenic
971831694 4:31703897-31703919 CTCTTTTTCTTCCCAGTCTCGGG - Intergenic
972002786 4:34059459-34059481 CTCTTTTTCTTCCCAGTCTCAGG - Intergenic
972100235 4:35406764-35406786 CTCTTTTTCTTCTCAGTCTCAGG + Intergenic
972370129 4:38415669-38415691 CTCTCTCCCATCTCAGTCTCAGG - Intergenic
972787658 4:42342364-42342386 TTCTGTCTGATTTCAGACTCGGG - Intergenic
972886577 4:43498702-43498724 CTCTTTTTCTTCCCAGTCTCGGG - Intergenic
972939308 4:44177737-44177759 CTCTTTTTCTTCCCAGTCTCAGG + Intronic
973015585 4:45133917-45133939 CTCTTTTTCTTCCCAGTCTCTGG - Intergenic
973078459 4:45961035-45961057 CTCTTTTTCTTCCCAGTCTCTGG - Intergenic
973156683 4:46963591-46963613 CTCTTTTTGTTCCCAGTTTCAGG + Intronic
973213190 4:47638699-47638721 CTCTTTTTCTTCCCAGTCTCGGG + Intronic
974104825 4:57458157-57458179 CTCTTTTTCTTCCCAGTCTCGGG - Intergenic
974494790 4:62613876-62613898 CTCTTTTTCTTCCCAGTCTCAGG - Intergenic
974495228 4:62616920-62616942 CTCTTTTTCTTCCCAGTCTCAGG + Intergenic
974678725 4:65133111-65133133 CTCTTTTTCTTCCCAGTCTCAGG + Intergenic
974982019 4:68968414-68968436 CTCTTTTTCTTCCCAGTCTCGGG + Intergenic
975311889 4:72912774-72912796 CTCTTTTTCTTCCCAGTCTCAGG + Intergenic
975312179 4:72914649-72914671 CTCTTTTTCTTCCCAGTCTCGGG + Intergenic
975350274 4:73338660-73338682 CTCTTTTTCTTCCCAGTCTCAGG - Intergenic
975507127 4:75149690-75149712 CTCTTTTTCTTCCCAGTCTCAGG - Intergenic
975558452 4:75687433-75687455 CTCTTTTTCATCCCAGTCCCAGG + Intronic
975706497 4:77117325-77117347 CTCTTTTTTTTCTCAGTCTCAGG - Intergenic
975804151 4:78095542-78095564 CTCTTTTTCTTCCCAGTCTCGGG - Intronic
975834335 4:78406350-78406372 CTCTTTCTCTTCCCAGTCTTAGG - Intronic
975896581 4:79099741-79099763 CTCTTTTTCTTCCCAGTCTCAGG + Intergenic
975919791 4:79371449-79371471 CTCTTTTTGTTCCCAGTTTCGGG - Intergenic
975942030 4:79659606-79659628 CTCTTTTTATTCTCAGTCTCGGG + Intergenic
976286558 4:83376408-83376430 CTCTTTTTGTTCCCAGTTTCGGG - Intergenic
976405399 4:84656787-84656809 CTCTTTTTCTTCACAGTCTCGGG - Intergenic
976811946 4:89107984-89108006 CTCTTTTTCTTCCCAGTCTCGGG + Intronic
976956221 4:90903436-90903458 CTCTTTTTCTTCCCAGTCTCGGG + Intronic
977005122 4:91558563-91558585 CTCTTTTTCTTCCCAGTCTCAGG - Intronic
977031885 4:91893607-91893629 CTCTTTTTCTTCTCAGTCTCTGG - Intergenic
977592356 4:98841267-98841289 CTCTTTTTCTTCCCAGTCTCAGG + Intergenic
977670278 4:99686553-99686575 CTCTTTTTCTTCCCAGTCTCAGG + Intergenic
977704189 4:100052975-100052997 CTCTTTTTCTTCCCAGTCTCGGG - Intergenic
977714473 4:100166705-100166727 CTCTTTTTCTTCCCAGTCTCGGG - Intergenic
977846340 4:101772340-101772362 CTCTTTTTCTTCCCAGTCTCAGG + Intronic
977880917 4:102204719-102204741 CTCTTTTTCTTCTCAGTCTCGGG - Intergenic
977996417 4:103501721-103501743 CTCTTTTTCTTCCCAGTCTCAGG + Intergenic
978034372 4:103975672-103975694 CTCTTTTTCTTCCCAGTCTCAGG + Intergenic
978616117 4:110598004-110598026 TTCTTTTTGATCACTGTCTCTGG - Intergenic
979063706 4:116099399-116099421 CTCTTTTTCTTCCCAGTCTCGGG + Intergenic
979294005 4:119010267-119010289 CTCTTTTTATTCCCAGTCTCGGG - Intronic
979387636 4:120088153-120088175 CTCTTTTTCTTCTCAGTATCAGG - Intergenic
979418540 4:120474754-120474776 GTCTCTCAGATCACAGTCTCTGG - Intergenic
979447845 4:120835701-120835723 CTCTTTTTTTTCCCAGTCTCTGG + Intronic
979449025 4:120847353-120847375 CTCTTTCTCATCACCCTCTCTGG + Intronic
979854313 4:125612178-125612200 CTCTTTTTCTTCCCAGTCTCAGG + Intergenic
979891978 4:126109567-126109589 CTCTTTTTCTTCGCAGTCTCAGG - Intergenic
980509995 4:133772691-133772713 CTCTTTTTCTTCCCAGTCTCTGG - Intergenic
980738559 4:136921313-136921335 CTCTTTTTCTTCCCAGTCTCGGG - Intergenic
980846788 4:138333622-138333644 CTCTTTTTCTTCCCAGTCTCAGG - Intergenic
981281804 4:142967121-142967143 CTCTTTTTATTCCCAGTCTCTGG - Intergenic
981297873 4:143153894-143153916 CTCTTTTTCTTCCCAGTCTCGGG + Intergenic
981393400 4:144217958-144217980 CTCTTTTTCTTCCCAGTCTCAGG - Intergenic
981634803 4:146864385-146864407 TTTTTTCTAATCTAAGTCTCTGG - Intronic
981642922 4:146966366-146966388 CTCTTTTTCTTCCCAGTCTCAGG + Intergenic
981643201 4:146968304-146968326 CTCTTTTTCTTCCCAGTCTCGGG + Intergenic
981820202 4:148879259-148879281 CTCTTTTTCTTCCCAGTCTCAGG - Intergenic
981820477 4:148881179-148881201 CTCTTTTTCTTCCCAGTCTCAGG - Intergenic
981918204 4:150057647-150057669 CTCTTTTTGTTCCCAGTTTCAGG + Intergenic
981966437 4:150609432-150609454 CTCTTTCAGTTCTCTGTCCCCGG - Intronic
982121363 4:152146510-152146532 CTCTTTTTGTTCTCAGTTTCAGG - Intergenic
982192816 4:152876052-152876074 CTCTTTTTATTCCCAGTCTCGGG + Intronic
982306805 4:153941110-153941132 CTCTTCCTGAGCTCAGCCACTGG - Intergenic
982415608 4:155127976-155127998 CTCTTTTTCTTCCCAGTCTCGGG - Intergenic
982424821 4:155246564-155246586 CTCTTTTTCTTCCCAGTCTCGGG - Intergenic
982611824 4:157584110-157584132 CTCTTTTTCTTCCCAGTCTCAGG - Intergenic
982763988 4:159322674-159322696 CTCTTTTTCTTCCCAGTCTCAGG - Intronic
982829394 4:160042218-160042240 CTCTTTTTCTTCCCAGTCTCAGG - Intergenic
982901974 4:161017305-161017327 CTCTTTTTCTTCCCAGTCTCAGG + Intergenic
982966249 4:161912600-161912622 CTCTTTTTCTTCCCAGTCTCGGG + Intronic
983322531 4:166212595-166212617 CTCTTTTTCTTCCCAGTCTCAGG - Intergenic
983337621 4:166416735-166416757 CTCTTTTTCTTCCCAGTCTCAGG - Intergenic
983625608 4:169798764-169798786 CTCTTTTTCTTCCCAGTCTCTGG + Intergenic
983765431 4:171475374-171475396 CTCTTTTTCTTCCCAGTCTCGGG + Intergenic
984017447 4:174442644-174442666 CTCTTTTTCTTCCCAGTCTCGGG - Intergenic
984515232 4:180730703-180730725 CTCTTTTTCTTCCCAGTCTCAGG + Intergenic
984720534 4:182969059-182969081 CTCTTTTTCTTCCCAGTCTCGGG - Intergenic
984900189 4:184579799-184579821 CTCTTTTTCTTCCCAGTCTCAGG - Intergenic
984922675 4:184779421-184779443 CTCTTTTTGTTCCCAGTCTCAGG + Intronic
985304147 4:188520833-188520855 CTCTTTTTCTTCCCAGTCTCGGG + Intergenic
985809368 5:2071669-2071691 CTCTTTCTTTTCCCAGTCTTGGG + Intergenic
985970949 5:3377899-3377921 CTCTTCCTGTTCTCAGTCCCGGG - Intergenic
986046985 5:4048320-4048342 CTCATTCTGATCCCATTCTTCGG - Intergenic
986061600 5:4196930-4196952 CTCCTCTTGGTCTCAGTCTCCGG + Intergenic
986158527 5:5201163-5201185 CTCTCTCTGTCCTCAGTCCCCGG - Intronic
986908142 5:12520165-12520187 CTCTTTTTCTTCTCAGTCTTGGG - Intergenic
987098049 5:14567339-14567361 CTCTTTTTCTTCCCAGTCTCAGG - Intergenic
987227279 5:15856052-15856074 CTCTTTTTCTTCCCAGTCTCAGG - Intronic
987303103 5:16614990-16615012 CTCTTTCTCATCCCAGTCCCTGG - Intronic
987398694 5:17451559-17451581 CTCTTTTTCTTCCCAGTCTCGGG + Intergenic
987646310 5:20676578-20676600 CTTTTTCTGAGATCAGTCTTTGG + Intergenic
987672012 5:21022489-21022511 CTCTTTTTCTTCCCAGTCTCGGG + Intergenic
987984781 5:25133144-25133166 CTCTTTTTCTTCCCAGTCTCAGG + Intergenic
988129240 5:27081033-27081055 CTCTTTTTCTTCTCAGTCTTAGG - Intronic
988674027 5:33412711-33412733 CTCTTTTTCTTCCCAGTCTCAGG + Intergenic
989025965 5:37068831-37068853 CTCTTTCTGAAACAAGTCTCAGG + Intergenic
989361244 5:40603893-40603915 CTCTTTTTCTTCCCAGTCTCAGG - Intergenic
989637286 5:43549597-43549619 CTCTTTTTCTTCCCAGTCTCGGG + Intronic
989788650 5:45363874-45363896 CTCTTTTTCTTCCCAGTCTCGGG + Intronic
990085403 5:51970483-51970505 CTCTTTTTCTTCCCAGTCTCAGG - Intergenic
990595628 5:57309800-57309822 CTCTTTTTCTTCCCAGTCTCAGG + Intergenic
990789157 5:59456466-59456488 CTCTTTTTCTTCCCAGTCTCGGG + Intronic
990804422 5:59642676-59642698 CTCTTTTTCTTCCCAGTCTCAGG + Intronic
991195292 5:63924936-63924958 CTCTTTTTCTTCCCAGTCTCGGG + Intergenic
991340446 5:65602639-65602661 CTCTTTTTGTTCCCAGTTTCGGG - Intronic
991634444 5:68690077-68690099 CTATTTCTGCTCTCAGGATCAGG - Intergenic
991920198 5:71649075-71649097 CTCTTTCTGATCTTTCTCTCAGG + Exonic
992083173 5:73254211-73254233 CTCTTTTTCTTCCCAGTCTCAGG + Intergenic
992534086 5:77681090-77681112 CTCTTTTTCTTCCCAGTCTCGGG - Intergenic
992665377 5:79003435-79003457 CTCTTTCTGTTCTGTATCTCTGG - Intronic
992779265 5:80113533-80113555 CTCTTTTTCTTCCCAGTCTCTGG - Intronic
992838114 5:80660100-80660122 CTCTTTTTCTTCCCAGTCTCTGG - Intronic
993098400 5:83506747-83506769 CTCTTTTTCTTCTCAGTCTCGGG - Intronic
993309582 5:86312991-86313013 CTCTTTTTCTTCCCAGTCTCAGG + Intergenic
993351155 5:86852531-86852553 TTCTTTCTCATCTCTGTCTGTGG + Intergenic
993382892 5:87228231-87228253 CTCTCTCTCATCTCAGTATATGG - Intergenic
993547587 5:89230798-89230820 CTCTTGCTGATGTCACTCTCAGG + Intergenic
993950711 5:94171367-94171389 CTCTTTTTCTTCCCAGTCTCGGG + Intronic
994114473 5:96046727-96046749 CTCTTTTTCTTCTCAGTCTCAGG - Intergenic
994138407 5:96315510-96315532 CTCTTTCTGATCTCAGTTTCTGG - Intergenic
994208371 5:97060938-97060960 CACTTTGTGGTTTCAGTCTCAGG + Intergenic
994260413 5:97651995-97652017 CTCTTTCTCATATCTCTCTCTGG - Intergenic
994307135 5:98220194-98220216 TTCTTTCTCATGTCAGTCTATGG + Intergenic
994386845 5:99142919-99142941 CTCTTTTTCTTCCCAGTCTCTGG + Intergenic
994524092 5:100881939-100881961 CTCTTTTTCTTCCCAGTCTCAGG + Intronic
994919932 5:106031057-106031079 CTCTTTTTCTTCCCAGTCTCAGG - Intergenic
995823175 5:116261797-116261819 CTGTCTCTGTTCTCTGTCTCTGG + Intronic
995920812 5:117308977-117308999 CTCTTTCTGTTTTCAGTCATAGG + Intergenic
995925833 5:117372243-117372265 CTCATTCTGATTTTAGTCTTAGG + Intergenic
995969731 5:117953515-117953537 CTCTTTCTGTTCTCAGTTTCGGG + Intergenic
996222697 5:120952892-120952914 CTCTTTTTCTTCCCAGTCTCGGG + Intergenic
996238472 5:121164898-121164920 CTCTTTTTCTTCTCAGTCTCGGG + Intergenic
996243012 5:121225984-121226006 CTCTTTTTCTTCCCAGTCTCAGG + Intergenic
996333128 5:122353783-122353805 CTCTTTTTCTTCCCAGTCTCGGG + Intronic
996526710 5:124488192-124488214 CTCTTTTTCTTCCCAGTCTCAGG - Intergenic
996929347 5:128867286-128867308 CTCTTTTTCTTCCCAGTCTCAGG + Intronic
997081588 5:130746125-130746147 CTCTTTTTATTCCCAGTCTCAGG + Intergenic
997406100 5:133648117-133648139 CTCTTTTTCTTCCCAGTCTCAGG + Intergenic
997473900 5:134131780-134131802 CTCATCCTGACCTCAGTCTAAGG - Intronic
997506410 5:134421160-134421182 CTCTTTTTCTTCCCAGTCTCAGG - Intergenic
998217931 5:140251490-140251512 CTCTATCCGATGTCAGCCTCAGG + Intronic
998980467 5:147697128-147697150 CTCTTTTTCTTCCCAGTCTCAGG - Intronic
999040887 5:148410502-148410524 CTCTTTTTCTTCCCAGTCTCAGG + Intronic
999107908 5:149090129-149090151 CTCTTTATCTTCCCAGTCTCTGG + Intergenic
999345925 5:150819716-150819738 CTCTTTTTCTTCCCAGTCTCAGG - Intergenic
1000226700 5:159267897-159267919 CTCTTTCTCTTCCCAGTCTTGGG + Intronic
1000648275 5:163784741-163784763 CTCTTTTTCTTCTCAGTCCCAGG - Intergenic
1000676177 5:164125881-164125903 CTCTTTTTCTTCCCAGTCTCAGG - Intergenic
1001181499 5:169525181-169525203 CTCTTTTTCTTCCCAGTCTCAGG - Intergenic
1001684758 5:173585106-173585128 CTCTTTTTCTTCCCAGTCTCAGG - Intergenic
1002558828 5:180066386-180066408 CTCTTTTTCTTCCCAGTCTCAGG + Intronic
1003220608 6:4157734-4157756 CCCTTGCTGTTCTCAGTCCCAGG - Intergenic
1003299521 6:4864803-4864825 CTCTTTTTGTTCTCAGTTTCAGG + Intronic
1003401873 6:5797270-5797292 CTCTTTTTCTTCCCAGTCTCGGG - Intergenic
1004060875 6:12196922-12196944 CTCATTCTTAGCTCAGTTTCTGG - Intergenic
1004603849 6:17175850-17175872 CTCTTTCTGGTCTCATCCTCTGG + Intergenic
1004991215 6:21140813-21140835 CTCTTTTTCTTCCCAGTCTCGGG - Intronic
1005155577 6:22802257-22802279 CTCTTTCAGTTTTCACTCTCAGG + Intergenic
1005905112 6:30255732-30255754 CTCTTTTTCATCTCAGTCTTGGG - Intergenic
1006240602 6:32674301-32674323 CTCTTTTTCTTCCCAGTCTCGGG + Intergenic
1006543808 6:34762746-34762768 TTCTTTCTTATCCCTGTCTCTGG + Intronic
1007008236 6:38388005-38388027 CCCTTTCTAATCACAGTCCCTGG + Intronic
1007349583 6:41259204-41259226 CTCTTTTTCTTCCCAGTCTCAGG + Intergenic
1007971622 6:46057445-46057467 CTCTTTTTCTTCCCAGTCTCAGG + Intronic
1008154016 6:47990672-47990694 CTCTTTTTCTTCCCAGTCTCAGG + Intronic
1008345463 6:50421399-50421421 CTCTTTTTCTTCCCAGTCTCGGG + Intergenic
1008499712 6:52169122-52169144 CTCTTTTTGTTCCCAGTTTCGGG - Intergenic
1008500696 6:52179207-52179229 CTATTTCTCATCTCTTTCTCAGG + Intergenic
1008650261 6:53553943-53553965 CTCTTTTTCTTCCCAGTCTCAGG + Intronic
1008729837 6:54468020-54468042 CTCTTTTTCATCTCAGCCTCAGG + Intergenic
1008926882 6:56896489-56896511 CTCTTTTTCTTCCCAGTCTCAGG + Intronic
1009344474 6:62596265-62596287 CTCTTTTTCTTCCCAGTCTCAGG + Intergenic
1009538795 6:64925060-64925082 CTCTTTTTCTTCCCAGTCTCGGG - Intronic
1009980289 6:70719617-70719639 CTCTTTTTCTTCCCAGTCTCGGG - Intronic
1010263628 6:73844171-73844193 CTCTTTTTCTTCCCAGTCTCGGG + Intergenic
1010263902 6:73846045-73846067 CTCTTTTTCTTCCCAGTCTCTGG + Intergenic
1010636205 6:78261629-78261651 CTCTTTTTGTTCCCAGTTTCGGG - Intergenic
1010676316 6:78748586-78748608 CTCTTTTTTTTCTCAGTCTCAGG + Intergenic
1010764966 6:79768809-79768831 CTCTTTTTCTTCTCAGTCTCGGG - Intergenic
1011353759 6:86452742-86452764 CTCTTTCTCTTCCCATTCTCAGG + Intergenic
1011584443 6:88909256-88909278 CTCTGTCTGATGTCTGTCTCAGG - Intronic
1011828669 6:91341696-91341718 CTCTGTTTAATTTCAGTCTCTGG + Intergenic
1012161413 6:95889421-95889443 CTCTTTTTCTTCCCAGTCTCAGG - Intergenic
1012476794 6:99622343-99622365 CTCTTTTTCTTCCCAGTCTCAGG + Intergenic
1013144573 6:107375702-107375724 CTCTTTCTGGTTTTAGTCTCAGG - Intronic
1013404482 6:109830838-109830860 CTCTTTTTCTTCCCAGTCTCAGG + Intergenic
1013404764 6:109832758-109832780 CTCTTTTTTTTCCCAGTCTCAGG + Intergenic
1013688289 6:112610616-112610638 CTCTTTTTCTTCCCAGTCTCAGG + Intergenic
1013861521 6:114641727-114641749 CTCTTTTTCTTCCCAGTCTCAGG - Intergenic
1013938928 6:115636800-115636822 GTCTCTCTGATCTCAGACACAGG + Intergenic
1013950506 6:115775586-115775608 CTCTTTCTTACCCCAGACTCCGG + Intergenic
1014267063 6:119291335-119291357 CTCTTTTTCTTCCCAGTCTCAGG + Intronic
1014471375 6:121819125-121819147 CTCTTTTTCTTCCCAGTCTCAGG + Intergenic
1014665244 6:124229847-124229869 CTCTTTTTCTTCCCAGTCTCAGG + Intronic
1014730799 6:125029953-125029975 CTCTTTTTCTTCCCAGTCTCAGG - Intronic
1014773040 6:125478534-125478556 CTCTGTCTGACCTTACTCTCTGG - Intergenic
1014817397 6:125951064-125951086 CTCTTTTTCTTCCCAGTCTCAGG + Intergenic
1014998444 6:128183431-128183453 CTCTCTATCATCTAAGTCTCAGG + Intronic
1015249131 6:131108241-131108263 CTCTTTCTGTTCCCAGTTTCAGG - Intergenic
1015285295 6:131479572-131479594 TTATTTCTTTTCTCAGTCTCTGG + Intergenic
1015676938 6:135761340-135761362 CTCTTTTTCTTCCCAGTCTCAGG - Intergenic
1015735811 6:136398745-136398767 CTCTTTTTCTTCCCAGTCTCAGG + Intronic
1016246898 6:141993581-141993603 CTCTTTTTCTTCCCAGTCTCAGG + Intergenic
1016411000 6:143784677-143784699 CTCTTTTTCTTCCCAGTCTCAGG - Intronic
1016419857 6:143872591-143872613 CTCTTTTTCTTCCCAGTCTCAGG - Intronic
1016420140 6:143874497-143874519 CTCTTTTTCTTCCCAGTCTCAGG - Intronic
1016460224 6:144274017-144274039 CTCTTTTTGTTCCCAGTTTCGGG - Intergenic
1016477206 6:144440781-144440803 CTCTTTTTCTTCCCAGTCTCAGG - Intronic
1016477446 6:144442492-144442514 CTCTTTTTCTTCCCAGTCTCAGG - Intronic
1016592192 6:145758227-145758249 CTATTTGTAATCCCAGTCTCAGG + Intergenic
1016696624 6:147003762-147003784 CTCTTTCTGATCTACCTTTCAGG - Intergenic
1016782262 6:147972390-147972412 GTCTATCTGAGCTCAGTCTCAGG - Intergenic
1016867983 6:148788011-148788033 CTCTTTTTCTTCCCAGTCTCGGG - Intronic
1017281583 6:152631622-152631644 CTCTGTCTGATTTCCGTCTTTGG - Intronic
1017619212 6:156278006-156278028 CTCTTTTTCTTCCCAGTCTCAGG + Intergenic
1018270228 6:162069373-162069395 CTCTTTTTGTTCCCAGACTCAGG + Intronic
1018602490 6:165559954-165559976 CTCTTTTTCTTCCCAGTCTCAGG + Intronic
1018789838 6:167139647-167139669 ATCTTTTTGCTCTCAGGCTCTGG + Exonic
1018866737 6:167752302-167752324 CTCTTTTTCTTCCCAGTCTCAGG - Intergenic
1019834695 7:3371101-3371123 CTCTTCCTGCTCTGAGACTCAGG - Intronic
1019881761 7:3867429-3867451 CTCTTTTTCTTCCCAGTCTCGGG - Intronic
1020479465 7:8639905-8639927 GTCTTTTTGTTCTCAGTTTCAGG + Intronic
1021040735 7:15858591-15858613 CTCTTTTTCTTCCCAGTCTCAGG + Intergenic
1021391154 7:20094620-20094642 CTCTTTTTCTTCCCAGTCTCAGG - Intergenic
1021656599 7:22880026-22880048 CTCTTTTTCTTCCCAGTCTCAGG + Intergenic
1021887300 7:25152148-25152170 CTCTTTCTGATCTTTTTTTCTGG + Intronic
1022307904 7:29166388-29166410 TTCTTTCTGATTTAAGTGTCTGG + Intronic
1022542917 7:31155485-31155507 CTCTTTTTCTTCCCAGTCTCGGG - Intergenic
1022549589 7:31226464-31226486 CTCTTTTTGTTCCCAGTTTCAGG + Intergenic
1022549877 7:31228395-31228417 CTCTTTTTGTTCCCAGTTTCAGG + Intergenic
1022814572 7:33902607-33902629 CTCTGTCTCATCTCTTTCTCTGG - Intergenic
1023779882 7:43645966-43645988 CTCAAACTGCTCTCAGTCTCAGG + Intronic
1024674916 7:51629806-51629828 CTCTTTTTCTTCTCAGTCTTGGG - Intergenic
1025618041 7:63141327-63141349 CTCTTTTTCTTCCCAGTCTCAGG - Intergenic
1026133972 7:67643218-67643240 CTCTTTCTGTTCTGAATCTCTGG + Intergenic
1026228067 7:68460047-68460069 CTCTTTTTCTTCCCAGTCTCGGG - Intergenic
1026532236 7:71209741-71209763 CTCTTTTTCTTCCCAGTCTCGGG - Intronic
1026582601 7:71630725-71630747 CTCTTGCTGAATTCAGTCTCTGG - Intronic
1026619407 7:71937018-71937040 CTCTTTTTCTTCCCAGTCTCAGG + Intronic
1027472018 7:78585438-78585460 CCTTATCTCATCTCAGTCTCAGG - Intronic
1028249811 7:88527185-88527207 CTCTTTTTCTTCCCAGTCTCAGG - Intergenic
1028291764 7:89074591-89074613 CTCTTTTTATTCCCAGTCTCTGG + Intronic
1028292019 7:89076495-89076517 CTCTTTTTCTTCCCAGTCTCAGG + Intronic
1028744249 7:94309459-94309481 CTTTTTCTCATCTCCTTCTCAGG + Intergenic
1029033375 7:97492315-97492337 CTCTTTTTCTTCCCAGTCTCAGG - Intergenic
1029796896 7:102905952-102905974 CTCTTTTTCTTCCCAGTCTCAGG - Intronic
1029903693 7:104069620-104069642 CTCTTTTTCTTCTCAGTATCAGG - Intergenic
1030271449 7:107673027-107673049 CTCTTTCTGATCTCCTTCTAAGG - Intronic
1031175207 7:118340184-118340206 CTCTTTTTCTTCCCAGTCTCAGG + Intergenic
1031299073 7:120041771-120041793 CTCTTTTTCTTCCCAGTCTCAGG + Intergenic
1031299345 7:120043695-120043717 CTCTTTTTCTTCCCAGTCTCAGG + Intergenic
1031531571 7:122883338-122883360 CCCTTTCAGATCTCAATTTCTGG + Intronic
1031681289 7:124678126-124678148 CTTTTTCTGTTCTTTGTCTCAGG - Intergenic
1031977208 7:128101658-128101680 CTATTTGTGATCTCTGCCTCGGG - Intergenic
1032779887 7:135157064-135157086 CTCTTTTTCTTCCCAGTCTCAGG + Intronic
1033458163 7:141521135-141521157 CTCTTTCTGATTTCTCTTTCTGG - Intergenic
1033549140 7:142429953-142429975 CTCTTTTTCTTCTCAGTCTCTGG + Intergenic
1033580134 7:142725686-142725708 CTCTTTTTCTTCCCAGTCTCGGG - Intergenic
1033670308 7:143486323-143486345 CTCTTTTTCTTCCCAGTCTCGGG - Intergenic
1033816196 7:145076231-145076253 TTCTTTTTCATCTCAGTCTCAGG + Intergenic
1033834986 7:145299787-145299809 TTCTTTTTGTTCCCAGTCTCAGG - Intergenic
1033865691 7:145687876-145687898 CTCTTTTTCTTCCCAGTCTCAGG - Intergenic
1034622873 7:152469841-152469863 CTCTTTCTGTTCCTAGTTTCTGG + Intergenic
1034681244 7:152929849-152929871 CTCTTTTTCTTCCCAGTCTCGGG + Intergenic
1034750164 7:153560953-153560975 CTCTTTTTCTTCCCAGTCTCGGG - Intergenic
1035259396 7:157652160-157652182 CTCTGCCTGATCCCTGTCTCTGG - Intronic
1035356836 7:158280814-158280836 ATCTTTGTCATTTCAGTCTCGGG - Intronic
1035735712 8:1886086-1886108 GTCATTTTCATCTCAGTCTCAGG - Intronic
1035840837 8:2810624-2810646 CTCTTTTTCTTCCCAGTCTCAGG - Intergenic
1036098500 8:5751636-5751658 CTCTTTTTGTTCCCAGTTTCAGG - Intergenic
1036457541 8:8923291-8923313 CTCTTTTTCTTCCCAGTCTCGGG - Intergenic
1037003203 8:13746694-13746716 CTCTTTCTCTTCCCAGCCTCAGG - Intergenic
1037478804 8:19285507-19285529 CTCTGTGTGATCACATTCTCAGG + Intergenic
1037747355 8:21657071-21657093 CTCTTTTTGTTCCCAGTTTCAGG + Intergenic
1038167619 8:25101057-25101079 CTCTTTTTCTTCCCAGTCTCAGG - Intergenic
1038225606 8:25654425-25654447 TTCTTTCTGTTCTCAATCTCAGG + Intergenic
1038987301 8:32826270-32826292 CTCTTTTTCTTCCCAGTCTCGGG - Intergenic
1039185912 8:34915991-34916013 CTCTTTTTATTCCCAGTCTCAGG + Intergenic
1039612269 8:38929288-38929310 CCCTTTCTGCTCTGAATCTCTGG + Intronic
1039657115 8:39422445-39422467 CTCTTTCTCTTCCCAGTCTTGGG - Intergenic
1039657384 8:39424351-39424373 CTCTTTTTCTTCCCAGTCTCAGG - Intergenic
1040046905 8:42974103-42974125 CCCTTTCTGTTCTCAGCCTCTGG - Exonic
1040560321 8:48517961-48517983 CTCTTTTTCTTCCCAGTCTCAGG - Intergenic
1041075162 8:54162182-54162204 CTCTTTTTCTTCCCAGTCTCAGG + Intergenic
1041115504 8:54531801-54531823 CTCTTTTTCTTCCCAGTCTCAGG + Intergenic
1041194632 8:55388559-55388581 CTCTTTCTGCTCTCTGCCACAGG - Intronic
1041431629 8:57787548-57787570 CTCTTTTTCTTCCCAGTCTCTGG + Intergenic
1041774150 8:61505586-61505608 TTCTTTTTCTTCTCAGTCTCAGG + Intronic
1041919507 8:63166605-63166627 CTCTTTCTCTTCTCAGTCTCGGG + Intergenic
1042073778 8:64966618-64966640 CTCTTTTTCTTCCCAGTCTCAGG - Intergenic
1042412681 8:68482289-68482311 CTCTTTTTGTTCCCAGTTTCAGG + Intronic
1042443617 8:68857999-68858021 CTCTTTTTCTTCTCAGTCTCAGG - Intergenic
1042727371 8:71892737-71892759 CACTTTTTCTTCTCAGTCTCAGG + Intronic
1042952709 8:74218381-74218403 CTCTTTCTTGGCTCATTCTCAGG + Intergenic
1043141347 8:76593717-76593739 CTCTTTTTGTTCTCAGTTTCGGG + Intergenic
1043265764 8:78266133-78266155 CTCTTTTTCTTCCCAGTCTCTGG + Intergenic
1043296250 8:78666476-78666498 CTTTTAGTGATCCCAGTCTCTGG + Intronic
1043510671 8:80947112-80947134 TTCTTTTTCTTCTCAGTCTCAGG + Intergenic
1044193902 8:89352352-89352374 CTCTTTTTCTTCTCAGTCTTGGG - Intergenic
1044194157 8:89354235-89354257 CTCTTTTTCTTCTCAATCTCAGG - Intergenic
1044538076 8:93380693-93380715 CTCTTTTTCTTCCCAGTCTCAGG - Intergenic
1044718732 8:95124899-95124921 CTCTTTTTCTTCCCAGTCTCGGG + Intergenic
1044784535 8:95780480-95780502 CCCTTTTTGTTCCCAGTCTCGGG + Intergenic
1044784757 8:95782071-95782093 CTCTTTTTGTTCCCAGTTTCAGG + Intergenic
1044992324 8:97807058-97807080 CTCTTTTTCTTCCCAGTCTCGGG + Intronic
1045214000 8:100129194-100129216 CTCTTTTTCTTCCCAGTCTCGGG - Intronic
1045214301 8:100131093-100131115 CTCTTTTTCTTCCCAGTCTCAGG - Intronic
1045672148 8:104567214-104567236 CTCTTTTTCTTCCCAGTCTCAGG - Intronic
1045786455 8:105926811-105926833 CTCTTTTTCTTCCCAGTCTCAGG + Intergenic
1045961025 8:107968433-107968455 CCCCTTCCGTTCTCAGTCTCTGG - Intronic
1046454421 8:114440078-114440100 CTCTTTTTCTTCACAGTCTCAGG + Intergenic
1046519805 8:115309596-115309618 CTCTTTTTCTTCTCAGTCTTGGG - Intergenic
1046855602 8:119028375-119028397 CTCTTTTTATTCCCAGTCTCGGG - Intronic
1047049809 8:121098325-121098347 CTCTTTTTCTTCCCAGTCTCAGG - Intergenic
1047159981 8:122367358-122367380 CTCTTTCTGTTCCCAGTTTTGGG - Intergenic
1047397909 8:124519394-124519416 CTTTTTCTGTAGTCAGTCTCTGG - Intronic
1048189373 8:132274153-132274175 CTCTTTTTCTTCCCAGTCTCTGG - Intronic
1048460599 8:134618127-134618149 CTCTTTTTCTTCCCAGTCTCGGG + Intronic
1048491126 8:134894988-134895010 CCAGTTCTGATCTCAGCCTCAGG - Intergenic
1048505155 8:135014196-135014218 CTCTTTTTCTTCCCAGTCTCGGG + Intergenic
1048653422 8:136506729-136506751 CTCTTTTTCTTCCCAGTCTCAGG + Intergenic
1048655692 8:136533609-136533631 CTCTTTTTCTTCCCAGTCTCTGG - Intergenic
1048745904 8:137614972-137614994 CTCTTTTTCTTCTCAGTCTCGGG - Intergenic
1048746148 8:137616745-137616767 CTCTTTTTCTTCCCAGTCTCAGG - Intergenic
1048917601 8:139199648-139199670 CTCTTTTTCTTCCCAGTCTCAGG + Intergenic
1049085597 8:140476398-140476420 CTCTTTTTCTTCCCAGTCTCAGG - Intergenic
1049085936 8:140478661-140478683 CTCTTTTTCTTCCCAGTCTCGGG - Intergenic
1050385161 9:5082086-5082108 TTCTTTCTTTTCTCAGTCTCTGG - Intronic
1050633948 9:7590194-7590216 GTCTTTCTGTTTTCAATCTCAGG + Intergenic
1050805540 9:9671821-9671843 CTCTTTTTCTTCCCAGTCTCAGG + Intronic
1051125493 9:13798860-13798882 CTCTCTTTCTTCTCAGTCTCTGG + Intergenic
1051183959 9:14439586-14439608 CTCTTTCTGGCCTGAGGCTCAGG - Intergenic
1051382096 9:16469520-16469542 CTCTTTTTGTTCCTAGTCTCTGG + Intronic
1051453313 9:17222642-17222664 CTCTTTTTCTTCCCAGTCTCGGG + Intronic
1051559277 9:18422297-18422319 CTCTTTCTGAAGTAATTCTCTGG + Intergenic
1051689893 9:19700128-19700150 CTCTGTCTTATCTATGTCTCAGG - Intronic
1051890650 9:21939235-21939257 CTCTTTTTCTTCCCAGTCTCTGG + Intronic
1051930038 9:22374101-22374123 CTTTTTCTGACCTCAGGCTTTGG - Intergenic
1052019252 9:23507375-23507397 CTCTTTTTCTTCCCAGTCTCTGG + Intergenic
1052019529 9:23509287-23509309 CTCTTTTTCTTCCCAGTCTCTGG + Intergenic
1052853719 9:33393976-33393998 CTCTTTCTGTACACTGTCTCTGG + Intronic
1053384002 9:37672689-37672711 CTCTTTTTCTTCCCAGTCTCGGG - Intronic
1053744557 9:41181617-41181639 TTCTTTTTGATCTGGGTCTCTGG - Intronic
1054349826 9:64011510-64011532 TTCTTTTTGATCTGGGTCTCTGG - Intergenic
1054482714 9:65683593-65683615 TTCTTTTTGATCTGGGTCTCTGG + Intronic
1054683788 9:68249633-68249655 TTCTTTTTGATCTGGGTCTCTGG + Intronic
1054753562 9:68933615-68933637 ATCTTTCTATTCTCAGTTTCTGG + Intronic
1054980994 9:71205790-71205812 CTCATTCTGATGACAGTCTCAGG - Intronic
1054993462 9:71356811-71356833 CTCTCACTGATCTCTCTCTCTGG - Intronic
1055046769 9:71934434-71934456 CTCTTTCTGCTATCAGTATTTGG + Intronic
1055069850 9:72155123-72155145 CTCTTTTTCTTCCCAGTCTCAGG - Intronic
1055080650 9:72265186-72265208 CTCTTTTTCTTCCCAGTCTCAGG - Intergenic
1055363855 9:75523926-75523948 CTCTTTTTCTTCCCAGTCTCAGG + Intergenic
1055364145 9:75525860-75525882 CTCTTTTTCTTCCCAGTCTCGGG + Intergenic
1055372978 9:75620117-75620139 CTCTTTTTCTTCCCAGTCTCAGG + Intergenic
1055701219 9:78947834-78947856 CTCTTTTTCTTCCCAGTCTCAGG + Intergenic
1055827369 9:80343521-80343543 CTTTTTCTGATGTCTGTGTCTGG - Intergenic
1056129039 9:83566092-83566114 TTCTTTTTCTTCTCAGTCTCGGG - Intergenic
1056255235 9:84792368-84792390 AGCTTTCTGATGTCAGTTTCAGG + Intronic
1056639594 9:88359041-88359063 CTCTTTTTCTTCTCAGTATCAGG + Intergenic
1056670289 9:88622147-88622169 CTCTTTCTGATCACTTGCTCTGG + Intergenic
1056829134 9:89900148-89900170 CTCTTTTTCTTCCCAGTCTCAGG + Intergenic
1057317980 9:93982934-93982956 CTCTTTTTGTTCCCAGTTTCAGG + Intergenic
1058109405 9:101015907-101015929 CTTTTTCTGTTCTCAGTGTGTGG + Intergenic
1058194791 9:101959242-101959264 CTCTTTTTCTTCCCAGTCTCTGG - Intergenic
1058201561 9:102048432-102048454 CTTTGTCTGATTTCAGTATCAGG - Intergenic
1058350766 9:104019529-104019551 TTCTTTCAGATCCAAGTCTCTGG - Intergenic
1058401421 9:104624382-104624404 CTCTTTTTCTTCCCAGTCTCAGG + Intergenic
1058401689 9:104626297-104626319 CTCTTTTTCTTCACAGTCTCAGG + Intergenic
1058444491 9:105042772-105042794 CTCTTTCTGGTTTCTGTCTATGG + Intergenic
1058649371 9:107160378-107160400 CTCTTTTTCTTCCCAGTCTCAGG + Intergenic
1059040419 9:110808747-110808769 CTCTTTCAAACCACAGTCTCTGG + Intergenic
1059170622 9:112121231-112121253 GTTTTTCTGATTGCAGTCTCTGG + Intronic
1059568058 9:115403305-115403327 CTCTTTTTCTTCCCAGTCTCAGG + Intergenic
1059572468 9:115454113-115454135 CTCTTTTTCTTCCCAGTCTCAGG + Intergenic
1059666997 9:116456510-116456532 CTCTTTTTCTTCCCAGTCTCAGG - Intronic
1059803772 9:117776459-117776481 CTCTTTTTGATTTCAGCCTCTGG + Intergenic
1059978467 9:119743284-119743306 CTCTTTTTTTTCCCAGTCTCGGG + Intergenic
1059986169 9:119822764-119822786 CTCTTTTTCTTCCCAGTCTCAGG + Intergenic
1060312122 9:122471430-122471452 CTCTTTTTCTTCCCAGTCTCAGG + Intergenic
1060361860 9:122966748-122966770 CTCTTTTTCTTCCCAGTCTCAGG - Intronic
1060620439 9:125060792-125060814 CTCTTTTTCTTCCCAGTCTCAGG + Intronic
1060886279 9:127154807-127154829 CTGTCTGTGATCTCACTCTCTGG + Intronic
1061735405 9:132652927-132652949 CTCTTTGTCTTCCCAGTCTCGGG + Intronic
1062375340 9:136259484-136259506 CCCTTCCTGGTCTCAGTCTGTGG - Intergenic
1062616615 9:137399634-137399656 CTCTTTTTGTTCCCAGTTTCAGG - Intronic
1185968375 X:4633469-4633491 CTCTTTTTCTTCCCAGTCTCTGG - Intergenic
1186143453 X:6601589-6601611 CTCTTTTTCTTCCCAGTCTCAGG - Intergenic
1186231468 X:7459476-7459498 CTCTTTTTCTTCCCAGTCTCGGG + Intergenic
1186324104 X:8459895-8459917 CTCTTTTTCTTCCCAGTCTCGGG - Intergenic
1186992613 X:15085580-15085602 CTCTTTTTCTTCCCAGTCTCAGG + Intergenic
1187319079 X:18224281-18224303 CTCTTTGTGATCCCAGTTTGAGG - Intergenic
1187555059 X:20343701-20343723 CTCTTTTTCTTCCCAGTCTCAGG + Intergenic
1187667226 X:21627514-21627536 CTCTTTTTCTTCCCAGTCTCAGG - Intronic
1188550033 X:31353396-31353418 CTCTTTCTGATCTCAGTCTCAGG - Intronic
1188765125 X:34081314-34081336 CTCTTTTTCATCCCATTCTCAGG - Intergenic
1188794325 X:34442955-34442977 CTCTTTTTCTTCTCACTCTCTGG - Intergenic
1188860379 X:35248411-35248433 CTCTTTTTTTTCCCAGTCTCAGG + Intergenic
1188896058 X:35669823-35669845 CTCTTTTTCTTCCCAGTCTCAGG - Intergenic
1189028957 X:37429790-37429812 CTCTTTTTCTTCCCAGTCTCAGG - Intronic
1189132766 X:38517614-38517636 CTCTTTTTCTTCCCAGTCTCAGG - Intronic
1189371454 X:40432546-40432568 CTCTTTTTGTTCCCAGTTTCAGG + Intergenic
1189894064 X:45635017-45635039 CTCTTTTTCATCCCAGTCTCGGG + Intergenic
1190778457 X:53574429-53574451 CTCTTGCAGGTCTCAGTCACTGG + Intronic
1191093025 X:56644011-56644033 CTCTTTCTCAACTCATTCTATGG - Intergenic
1191598316 X:62973315-62973337 CTCTTTTTCTTCTCAGTCTTAGG - Intergenic
1191856289 X:65629546-65629568 CTCTTTCTCTTCCCAGTCTCGGG - Intronic
1191993836 X:67068532-67068554 CTCTTTGGGAGCTCTGTCTCAGG - Intergenic
1192056713 X:67780978-67781000 CTCTTTCAGCTCTGAGTCTGTGG + Intergenic
1192177629 X:68895732-68895754 CTCAGTCTGGTCTCAGGCTCTGG - Intergenic
1192270664 X:69576232-69576254 CTCTTTTTCTTCCCAGTCTCAGG - Intergenic
1192309587 X:69998909-69998931 CTCTTTTTCTTCCCAGTCTCGGG + Intronic
1192581325 X:72284514-72284536 CTCTTTTTCTTCCCAGTCTCAGG + Intronic
1192866909 X:75143607-75143629 CTCTTTTTCTTCCCAGTCTCGGG - Intronic
1193177186 X:78408444-78408466 CACTTTTTGATCTCAGTCTTAGG + Intergenic
1193222508 X:78943604-78943626 CTCTTTTTCTTCCCAGTCTCAGG - Intergenic
1193266691 X:79480438-79480460 CTCATTTTGATACCAGTCTCTGG - Intergenic
1193279512 X:79629706-79629728 CTCTTTTTCTTCCCAGTCTCAGG + Intergenic
1193348044 X:80427095-80427117 CTCTTTTTCTTCTCAATCTCAGG + Intronic
1193614443 X:83670692-83670714 CTCTTTTTCTTCCCAGTCTCAGG + Intergenic
1193759025 X:85442232-85442254 CTCTTTTTCTTCCCAGTCTCAGG - Intergenic
1193759300 X:85444145-85444167 CTCTTTTTCTTCCCAGTCTCGGG - Intergenic
1193807830 X:86015387-86015409 ATCTTTTTCATCTCAATCTCGGG + Intronic
1193808169 X:86017628-86017650 CTCTTTTTCTTCCCAGTCTCAGG + Intronic
1193813582 X:86080954-86080976 CTCTTTTTCTTCCCAGTCTCGGG - Intergenic
1193826559 X:86233682-86233704 CTCTTTTTCTTCCCAGTCTCGGG - Intronic
1194057785 X:89159161-89159183 CTCTTTTTCTTCTCCGTCTCAGG - Intergenic
1194141374 X:90214208-90214230 CTCTTTCTTTTCTCAGTCTCTGG + Intergenic
1194201498 X:90958062-90958084 CCCTTTGGGATCTCTGTCTCAGG - Intergenic
1194215641 X:91127930-91127952 CTCTTTTTCTTCCCAGTCTCAGG - Intergenic
1194324443 X:92495655-92495677 CTCTTTTTATTCCCAGTCTCGGG - Intronic
1194372039 X:93085953-93085975 CTTTTTCTGGTTTCAGTATCAGG + Intergenic
1194377140 X:93150866-93150888 CTCTTTTTCTTCCCAGTCTCAGG - Intergenic
1194496464 X:94622255-94622277 CTCTTTTTCTTCCCAGTCTCAGG - Intergenic
1194864805 X:99053046-99053068 CTCTTTTTCTTCCCAGTCTCAGG + Intergenic
1195126585 X:101814499-101814521 CTCTTTTTCTTCCCAGTCTCTGG - Intergenic
1195178993 X:102338835-102338857 CTCTTTTTCTTCCCAGTCTCAGG + Intergenic
1195209924 X:102645127-102645149 CTCTTTTTGTTCCCAGTTTCGGG - Intergenic
1195210206 X:102647045-102647067 CTCTTTTTCTTCCCAGTCTCGGG - Intergenic
1195880598 X:109588893-109588915 CTCTTTCTATTCCCAGTCTCAGG + Intergenic
1196545407 X:116958611-116958633 CTCTTTTTGTTCCCAGTTTCAGG + Intergenic
1196858345 X:120004535-120004557 CTCTTTTTCTTCCCAGTCTCAGG + Intergenic
1196935584 X:120727433-120727455 CTCTTTCTAGTCACAGTTTCTGG + Intergenic
1196979142 X:121192149-121192171 CTCTTTTTCTTCCCAGTCTCCGG + Intergenic
1197511245 X:127371776-127371798 CTCTTTTTCTTCCCAGTCTCAGG - Intergenic
1197566889 X:128099329-128099351 CTCTTTTTCTTCCCAGTCTCAGG - Intergenic
1197676488 X:129336010-129336032 CTCTTTTTCTTCCCAGTCTCAGG - Intergenic
1197914444 X:131520158-131520180 CTCTTTTTCTTCCCAGTCTCAGG + Intergenic
1198408039 X:136335358-136335380 CTGTCTCTGATTTCAGTATCAGG + Intronic
1198569051 X:137935527-137935549 CTCTTTTTGTTCCCAGTCTCGGG + Intergenic
1198734495 X:139771345-139771367 CTCTTTTTCTTCCCAGTCTCGGG + Intronic
1198734777 X:139773261-139773283 CTCTTTTTGTTCCCAGTTTCGGG + Intronic
1198861791 X:141078949-141078971 CTCTTTTTCTTCCCAGTCTCGGG - Intergenic
1198900900 X:141508427-141508449 CTCTTTTTCTTCCCAGTCTCGGG + Intergenic
1199325651 X:146494690-146494712 CTCTTTTTCTTCCCAGTCTCGGG + Intergenic
1199328632 X:146532148-146532170 AGCTTTCTGAACTTAGTCTCAGG + Intergenic
1199362738 X:146942405-146942427 CTCTTTTTGTTCCCAGTTTCGGG - Intergenic
1199400612 X:147394629-147394651 CTCTTTTTCTTCCCAGTCTCAGG + Intergenic
1199785832 X:151103948-151103970 CTCTTTCTGAGCTCAGTGGAGGG + Intergenic
1199792458 X:151168060-151168082 CTCTTTATCCTCCCAGTCTCGGG + Intergenic
1200487129 Y:3783312-3783334 CTCTTCCTTTTCTCAGTCTCTGG + Intergenic
1200633188 Y:5614864-5614886 CTCTTTTTATTCCCAGTCTCGGG - Intronic
1200680086 Y:6199994-6200016 CTTTTTCTGGTTTCAGTATCAGG + Intergenic
1201683671 Y:16677926-16677948 CGCTTTCTGATCTTAGTATTTGG - Intergenic
1201986304 Y:19971725-19971747 CTCTTCCTGATTTCAGTATCAGG - Intergenic