ID: 1188551107

View in Genome Browser
Species Human (GRCh38)
Location X:31365503-31365525
Sequence CTGTGTTACAAAAAGGTACT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 178}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188551103_1188551107 26 Left 1188551103 X:31365454-31365476 CCAGAGCTGCTGGGGATCATTAA 0: 1
1: 0
2: 0
3: 6
4: 88
Right 1188551107 X:31365503-31365525 CTGTGTTACAAAAAGGTACTTGG 0: 1
1: 0
2: 0
3: 13
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188551107 Original CRISPR CTGTGTTACAAAAAGGTACT TGG Intronic
907812002 1:57880114-57880136 CTGTGTTTGCCAAAGGTACTAGG - Intronic
907813960 1:57900143-57900165 ATGTTTTATAAAAAGGGACTAGG + Intronic
910145385 1:84074535-84074557 CTGTGTTTCACAGAGGGACTGGG - Intergenic
911947324 1:104128787-104128809 CTGTGTTAGAAAAACTTACCTGG - Intergenic
912277661 1:108276971-108276993 CTGTGGTAAGAAAAGATACTTGG + Intergenic
912290565 1:108417386-108417408 CTGTGGTAAGAAAAGATACTTGG - Intronic
912948024 1:114100802-114100824 CTGTGTTAAAGACAGGTATTGGG - Intronic
914924576 1:151873199-151873221 CTGTGTTACAAATAAGTTCAAGG - Intergenic
917099276 1:171429441-171429463 CTGTGTTAGAAACAAGTGCTTGG - Intergenic
918955107 1:191198384-191198406 TTTTGTTAAAAAAAGTTACTTGG - Intergenic
920124886 1:203686294-203686316 CTGTCTCACAAACAGGAACTCGG + Intronic
921416146 1:214889415-214889437 TTCTGTTATAAAAAGGTAATTGG + Intergenic
921426215 1:215003840-215003862 CTGTGTTACAAAAAGGGAAAAGG - Intergenic
922344433 1:224684631-224684653 CTCTGTTAGAAAAAGCCACTGGG + Intronic
923425884 1:233869060-233869082 GTGTTTTAAATAAAGGTACTAGG + Intergenic
923518177 1:234715116-234715138 CTGTATTAGAAAAATGCACTGGG + Intergenic
924607345 1:245546349-245546371 CTGTTTTTAAAAAAGGTACTCGG + Intronic
924657945 1:245990438-245990460 CTGTGTGACCAAAAGGAAGTAGG - Intronic
1068725632 10:60299330-60299352 CAGTGTTACAAAAAGCAATTTGG - Intronic
1070581555 10:77724448-77724470 ATGTCTTAGATAAAGGTACTTGG - Intergenic
1071310040 10:84334776-84334798 CTGTTTTTCAAAGAGTTACTTGG + Intronic
1071419316 10:85474730-85474752 CTATGTAATAAAAATGTACTTGG + Intergenic
1071853604 10:89600624-89600646 CTGTGAGACAAAAATGTACAGGG + Intronic
1074397884 10:113113789-113113811 CTCTCTTAAAAAAAGGTCCTTGG - Intronic
1075373738 10:121960557-121960579 CTGTGTAAATAAAAGATACTAGG - Intronic
1078296940 11:10081217-10081239 CTGTGGTCCAAGAAGATACTTGG - Intronic
1079142509 11:17821728-17821750 CTGTATTACAGCAATGTACTTGG - Intronic
1079267699 11:18950639-18950661 TTATGTTACAAAGAGGTGCTAGG + Intergenic
1086074888 11:82839929-82839951 CTGTGATAAAAATAGGTACAGGG - Intronic
1086702704 11:89917932-89917954 TTGTGTTACAGACAGGCACTAGG - Intronic
1086703463 11:89926518-89926540 TTGTGTTACAGACAGGCACTAGG + Intergenic
1089655311 11:119942932-119942954 CTGTGTTACAGACAGGGACACGG - Intergenic
1093616307 12:21229888-21229910 CTGTTTTTCAACATGGTACTGGG - Intronic
1097532584 12:60823639-60823661 ATGTGTTACAATTAGTTACTGGG + Intergenic
1098739948 12:74160887-74160909 CTGAGTTACTAAAAGATAATTGG - Intergenic
1099768227 12:87018466-87018488 CTGTGTTCTGAAAAGGTACTTGG - Intergenic
1100939766 12:99713396-99713418 CTGTTAAACAAAAAGGAACTAGG - Intronic
1101043843 12:100784338-100784360 CTGTGTTCCAAAAGGGGACAAGG - Intronic
1101492742 12:105224329-105224351 CTGGGATACAAAAAGGAACTGGG + Intronic
1105064774 12:133186889-133186911 TTGTGTTACAAAAAAGAAGTGGG - Intronic
1106814360 13:33390413-33390435 CTTTGTTAGAACAAGTTACTAGG + Intergenic
1106975114 13:35202219-35202241 CTGTGTTCCTGAAAGGTCCTGGG + Intronic
1107996447 13:45865619-45865641 CTCTGTTACAAATTGGCACTGGG + Intergenic
1108109676 13:47055437-47055459 CTATGTGAGAAAAAGATACTGGG + Intergenic
1108560611 13:51640531-51640553 CTGTGTGATAAAGAGGCACTAGG - Intronic
1111578910 13:90197164-90197186 TTGTTTTGTAAAAAGGTACTTGG + Intergenic
1113073402 13:106444619-106444641 CTCTATTACAGAAAGGAACTTGG - Intergenic
1117381513 14:55168597-55168619 CTGTGATAGAAGAAGTTACTAGG - Intronic
1117477386 14:56110272-56110294 ATGTGGTCCAAAAAGATACTTGG - Intergenic
1118424618 14:65646585-65646607 CTGACTTACACAAAGGTTCTTGG - Intronic
1122441106 14:101732467-101732489 CTGTGTTTCTAATGGGTACTGGG + Exonic
1125018083 15:34957388-34957410 ATGTGTTACAGAAGTGTACTTGG + Intronic
1125237883 15:37537143-37537165 CTGTGTCACAAATATGTAGTAGG + Intergenic
1126715757 15:51515683-51515705 CTGTGTTAAAAATAGGCACAAGG + Intronic
1127236932 15:57063947-57063969 AAATGTAACAAAAAGGTACTAGG - Intronic
1130867520 15:87945238-87945260 CTGTCTCACAAAAAGGAATTAGG - Intronic
1132320535 15:100921472-100921494 TTTTGTTTCAAAAAGGAACTAGG + Intronic
1137793908 16:51198715-51198737 CTATGTTCCAAAAAGGAACTCGG - Intergenic
1138824747 16:60305427-60305449 TTGTGTTACAAAAAAATATTTGG - Intergenic
1145287440 17:21516795-21516817 CTGAGTTACAGAAAGGAACAGGG - Intergenic
1145390183 17:22449583-22449605 CTGAGTTACAGAAAGGAACAGGG + Intergenic
1145715466 17:27015628-27015650 CTGTGAGAAAAAAAGATACTTGG - Intergenic
1145849957 17:28083354-28083376 CTCTGTTCCAAAAACATACTTGG - Intronic
1146579643 17:34025331-34025353 CTGTGTGCCAAAATGGTGCTGGG + Intronic
1148141570 17:45332977-45332999 CTGCCTTACAAAAGGGTAGTGGG - Intergenic
1156638966 18:39066832-39066854 CTGTGCCAGAAAAAGGTACAAGG + Intergenic
1157640964 18:49214107-49214129 CAGTGGTACAAAAAGATACATGG + Intronic
1158407666 18:57174560-57174582 CTGTGTTTGAAAAAAGTACGGGG + Intergenic
1158443188 18:57495575-57495597 CTGTTTAACAAAATGGTGCTGGG + Intergenic
1158518914 18:58153963-58153985 CAATGTTTCACAAAGGTACTTGG - Intronic
1159615739 18:70577615-70577637 CTGTGTTGCAAAAGGGAGCTGGG + Intergenic
1159951910 18:74490270-74490292 CTGATTTAAAAAAAGCTACTAGG - Intergenic
1164559006 19:29275697-29275719 CTGAGTTACACAAATGTCCTTGG - Intergenic
1164773203 19:30828973-30828995 CGGTGTTACAAAAACATACCTGG + Intergenic
1165185045 19:34011766-34011788 CTTTGTGACAAAAAGGTTTTGGG + Intergenic
1167733566 19:51277301-51277323 CTGTGTTATAAAATGGTTCAAGG - Intergenic
1167883232 19:52479584-52479606 CAGTGCTTCAAAAAAGTACTGGG - Intronic
925921161 2:8638890-8638912 CTGTGGTCCAAAAAATTACTAGG + Intergenic
927059636 2:19404274-19404296 CTGTGTTAGAAACAGATATTTGG + Intergenic
928265488 2:29807962-29807984 CTTTGTTAAAAAAAGGAGCTTGG - Intronic
929611390 2:43273407-43273429 CTTCTTTAGAAAAAGGTACTTGG + Intronic
930532008 2:52600334-52600356 CTGTGTAAGAAAAAGCTACATGG - Intergenic
930794270 2:55371003-55371025 CTGTCTCAAAAAAAGGTCCTTGG + Intronic
934591814 2:95560103-95560125 CTGTGTTACAAGAGTGTGCTTGG + Intergenic
935108934 2:100074053-100074075 CTGAGTTACAACAAGGGACCAGG - Intronic
939263311 2:139837753-139837775 CTTTGTCACAAAATGATACTAGG + Intergenic
940262628 2:151798246-151798268 CTGTTTTAAAAAACAGTACTAGG + Intronic
940359515 2:152782349-152782371 CTCTGTTACACACAGGTGCTGGG + Intergenic
941204906 2:162559905-162559927 CTGTATCACAAAAATTTACTGGG + Intronic
941744058 2:169067578-169067600 CTTTGTTTTAAAAAGGAACTAGG + Intronic
942498992 2:176568533-176568555 CTGTGATGCAAGAAGGTAATTGG - Intergenic
944820985 2:203430701-203430723 CTATGTTCCTAAAAGTTACTGGG + Exonic
946085024 2:217162118-217162140 ATGTGACACTAAAAGGTACTGGG + Intergenic
947618347 2:231573312-231573334 CTGAGTTACAAAATGGTGCTGGG - Intergenic
1170212207 20:13856664-13856686 CTGTCTTTCAAAAAGGAAGTTGG - Intronic
1170532574 20:17309341-17309363 CTGTGTTCCAGAAAGTTAATAGG + Intronic
1171254408 20:23677970-23677992 CTGTGGTTCAAGAAGGTATTTGG + Intergenic
1173174662 20:40755211-40755233 CAGTGTTTCAAAAAGGCACATGG + Intergenic
1173363973 20:42368644-42368666 GTGTGTAACTAAAAGGTGCTGGG + Intronic
1175858271 20:62134546-62134568 CTGGGTTACAGAGATGTACTTGG - Exonic
1179915738 21:44477022-44477044 CTTTGTAATAAAAAGGAACTGGG + Intergenic
1182600240 22:31456840-31456862 CTATGCTACAAAAAGGTTTTTGG + Intronic
949242934 3:1892691-1892713 TTCTGTTAGAAACAGGTACTTGG - Intergenic
949661711 3:6286419-6286441 CTGTGGTCCAAGAAGGTGCTTGG - Intergenic
950280821 3:11706606-11706628 GTGTGTTTCAAAAAGCCACTTGG + Intronic
951839612 3:27020542-27020564 CTGTGTTCAACAAATGTACTTGG + Intergenic
953075177 3:39563153-39563175 TTGGCTTACAAAAAGGTAGTGGG - Intergenic
953773305 3:45795583-45795605 TTGCCTTCCAAAAAGGTACTTGG + Intronic
955493285 3:59504766-59504788 CTTTGATACACAAAGGAACTCGG - Intergenic
956809825 3:72853944-72853966 TTGTATTACAAAAAGACACTTGG - Intronic
957541925 3:81582474-81582496 ATGTGTTACAAAAATGAAATGGG - Intronic
957692146 3:83585473-83585495 CTGTGTTTAGAAAAGGTACTTGG + Intergenic
958002615 3:87770573-87770595 CTATGGTCCAAAAAGATACTTGG + Intergenic
958143548 3:89594665-89594687 ATGTGTTACAAAAAGGACATAGG + Intergenic
959341411 3:105136136-105136158 CTGAGTTACTACAATGTACTTGG + Intergenic
960637691 3:119800224-119800246 CTTTGCTAAAAAAAGGTGCTTGG - Intronic
964983035 3:162710044-162710066 CTGTTTTACAAAAAGCTGATTGG + Intergenic
965473518 3:169125139-169125161 CTCTGTGAACAAAAGGTACTAGG + Intronic
967429638 3:189367108-189367130 TAGTGTTACAGAAAAGTACTAGG - Intergenic
972072135 4:35034777-35034799 CTGTGGTTGAATAAGGTACTCGG - Intergenic
972263472 4:37435571-37435593 CTGTCTTAGAAAAAAGTACCTGG + Intronic
973119737 4:46506952-46506974 CTGTGATTCTAAAAGGTACTTGG - Intergenic
973343474 4:49029801-49029823 CTGTGTTACAAATAAGTTCAAGG - Intronic
974408195 4:61503995-61504017 CTGTCTTACAAAAAGGGGGTTGG - Intronic
974638715 4:64600823-64600845 CTCTGTTACAAAAAGGGAATTGG + Intergenic
975774466 4:77769625-77769647 CTGTTTTAAAAAAATGCACTGGG - Intronic
978461965 4:108966065-108966087 CTGTATTATAACAAGGTAATTGG + Intronic
979868839 4:125790768-125790790 CTGTGATACAAAATGAAACTTGG - Intergenic
980202403 4:129673022-129673044 CTATGTAACAAAAACATACTGGG + Intergenic
981488176 4:145310110-145310132 TTTTGTTATAATAAGGTACTTGG - Intergenic
986049902 5:4079799-4079821 CTGTGTGTCAAAAATGTTCTGGG - Intergenic
987433769 5:17867821-17867843 CTGTGTTCAGAAAAGATACTTGG - Intergenic
990342437 5:54836661-54836683 CTTTTTTAAAAAAAAGTACTGGG - Intergenic
990833512 5:59987436-59987458 CTGTGTTAGAAAAAGGTATGAGG - Intronic
994614696 5:102089632-102089654 CAGAGTTAAAACAAGGTACTGGG + Intergenic
995503264 5:112831879-112831901 CTCTGATACACAAAGGTATTTGG - Intronic
995946903 5:117658907-117658929 CTCTGTTAAAAAAAGGTTTTTGG + Intergenic
996643454 5:125786897-125786919 CTGTGTAACAAAAAAGATCTTGG - Intergenic
997114446 5:131111552-131111574 GTGGGTTACAAAAAGTTAATTGG + Intergenic
997477029 5:134149100-134149122 CTGTGTTACATGAACATACTGGG + Exonic
998439334 5:142143489-142143511 CAGTGGTAGAAAATGGTACTTGG - Intronic
999103028 5:149043118-149043140 CTGTATTAGAAAAAGGCAGTTGG - Intronic
999723778 5:154418222-154418244 CTGTGGTACAACATGGTCCTTGG + Exonic
1004880154 6:19999594-19999616 CTCTGGTTCAAAAAGATACTGGG + Intergenic
1005067590 6:21833725-21833747 GTGTGTTATAAAAAGGGACTTGG + Intergenic
1006146048 6:31960323-31960345 CTGGGTTACAAAGAGGTAGGAGG + Exonic
1006978531 6:38125663-38125685 TAGTGTTACCAAAAGGTATTTGG + Intronic
1009345372 6:62608120-62608142 CTGAGTGACAGAAAGCTACTTGG - Intergenic
1010382048 6:75236613-75236635 CTGTGTTAGAAATTGGTTCTGGG - Intergenic
1011899855 6:92278793-92278815 ATGTGTTATAATAAGGCACTTGG + Intergenic
1013434302 6:110086706-110086728 CTGTGTTTCAAAAAGTTAAATGG - Intergenic
1013565063 6:111350579-111350601 CTGTCTTATAAAAAGGGAATGGG - Intronic
1014757160 6:125314171-125314193 CTGTTTAATAAAAAGGTAATTGG + Intergenic
1015884754 6:137905184-137905206 CTCTGTTACTAAAGGGGACTGGG + Intergenic
1017186542 6:151606468-151606490 CTGTGGTCTAAAAAGATACTTGG + Intronic
1019882091 7:3870547-3870569 CTTTTTTACAAAAAGGTAAATGG - Intronic
1021873844 7:25030266-25030288 ATGTGTTACAAAGTGGTATTCGG + Intergenic
1022947174 7:35298531-35298553 CTGTGTTGCAAAAATGAAGTTGG + Intergenic
1023130700 7:37000100-37000122 GTGTGTTTGAAAAAGGTTCTTGG - Intronic
1025614715 7:63107756-63107778 TTGTGTTGCAAAAGGGGACTTGG + Intergenic
1027819161 7:83021529-83021551 TTGTGTTACAACAGTGTACTTGG - Intronic
1028824882 7:95260365-95260387 CTGAGTTATAAAATAGTACTGGG + Intronic
1030439633 7:109571908-109571930 CTGTGGTAAACAAAGATACTAGG + Intergenic
1030804136 7:113893081-113893103 CTGTGTAAAAGAAAGGTAGTGGG - Intronic
1034054535 7:148020775-148020797 GTGTGTTACAACAAAGTAGTCGG - Intronic
1035113366 7:156503613-156503635 CTGTGTTTGAGAAAGGGACTTGG - Intergenic
1036931326 8:12959122-12959144 CTGTGTTACAAAGATGTTCTTGG - Intronic
1037588063 8:20291704-20291726 ATGTGTTACAAATAGGTAATTGG - Intronic
1039225061 8:35379205-35379227 CTGTGTGACTATAAGTTACTAGG - Intronic
1042449119 8:68923669-68923691 CTGTGTTACCAAAGTGAACTGGG - Intergenic
1042805482 8:72766446-72766468 CTGGGTTAAACAAAGTTACTAGG + Intronic
1043362710 8:79494048-79494070 CAGTGTATGAAAAAGGTACTTGG - Intergenic
1047635273 8:126754978-126755000 CTGTGAGACAAAAAGATACCAGG + Intergenic
1048924708 8:139261143-139261165 CTGTGTTACACATTGGAACTTGG - Intergenic
1050023298 9:1307484-1307506 CTGTGTGCAAAAAAGGTGCTCGG + Intergenic
1050634349 9:7595192-7595214 CTGTGGTCCAAAAATGTGCTTGG + Intergenic
1051280031 9:15433549-15433571 CAGGGTTAGAAAAAGGTTCTTGG + Exonic
1052546532 9:29888158-29888180 CAGTGTGACAAATAGGTGCTAGG + Intergenic
1053195745 9:36117081-36117103 CTGTGTCACAAACAGGATCTTGG - Exonic
1056647864 9:88430580-88430602 CTATGTTAAAGACAGGTACTGGG - Intronic
1186511322 X:10132007-10132029 ATGTGTTACAGAACGGAACTGGG + Intronic
1188551107 X:31365503-31365525 CTGTGTTACAAAAAGGTACTTGG + Intronic
1189397353 X:40634896-40634918 CTGTTTTACAGAAAGGAAATAGG - Intronic
1189889013 X:45579113-45579135 CTGTGTTCAGAAAAGATACTTGG + Intergenic
1190035023 X:47014464-47014486 CTGTTTTACAAAAAGTTCATGGG - Intronic
1192252734 X:69426287-69426309 CTGTGTTGAAGAAAGGTACAGGG + Intergenic
1192885403 X:75332160-75332182 CTGTGTTCTGAAAAGTTACTGGG + Intergenic
1196038638 X:111175760-111175782 CTTTGTTACACAAAGTTGCTTGG - Intronic
1197267423 X:124390127-124390149 CTTTGCTACAAAAACGTAGTTGG - Intronic
1200355897 X:155550440-155550462 ATGGATTACAAAAAGATACTTGG + Intronic
1200360472 X:155600461-155600483 ATTTGTTACAAAAAGGGAATTGG + Intronic
1201367218 Y:13220904-13220926 CTCTGTTACTAAATGGTGCTGGG - Intergenic