ID: 1188553361

View in Genome Browser
Species Human (GRCh38)
Location X:31384596-31384618
Sequence CTTCAACAGCAGCATACTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 157}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188553361 Original CRISPR CTTCAACAGCAGCATACTGT TGG (reversed) Intronic
901034687 1:6329298-6329320 GTTCAAAAGAAGCAAACTGTGGG + Intronic
903062921 1:20682869-20682891 CTCCAACAGCTGCAGACTGCCGG + Exonic
908688075 1:66744814-66744836 CTTCAACACCAGACTGCTGTAGG - Exonic
909695406 1:78463316-78463338 TTTCAAAGACAGCATACTGTTGG + Intronic
918191806 1:182182920-182182942 CTTGAACTTCACCATACTGTAGG + Intergenic
921942195 1:220853730-220853752 GTTCAGCAGCACCATGCTGTAGG - Intergenic
923318784 1:232807399-232807421 TGTCAACAACAGCATCCTGTTGG - Exonic
923816890 1:237390004-237390026 CCTAAACATCAGCATTCTGTAGG - Intronic
1064713581 10:18152095-18152117 GTTCAACTGCAGCTAACTGTGGG - Intronic
1069804693 10:71112980-71113002 GTTCAGCAGCACCATGCTGTAGG - Intergenic
1070040357 10:72772204-72772226 GTTCAGCAGCACCATGCTGTAGG + Intronic
1070527337 10:77306468-77306490 CTGCAACAGCAGCAAACAGCTGG - Intronic
1072019856 10:91387577-91387599 CTGCAAAGGCAGCATCCTGTAGG - Intergenic
1072054886 10:91745224-91745246 ATTCAACAGCACCATGCCGTAGG + Intergenic
1072224518 10:93356071-93356093 CAGCAGCAGCAGAATACTGTGGG + Intronic
1074094007 10:110292074-110292096 CTTCAACTGTAAAATACTGTGGG + Exonic
1074778794 10:116785635-116785657 CATGAACAGCAGCATGCGGTGGG - Intergenic
1076392356 10:130112094-130112116 CTTCAACTGCAGCAGAATGATGG - Intergenic
1076926329 10:133490001-133490023 GTTCAGCAGCACCATGCTGTAGG - Intergenic
1078390711 11:10933176-10933198 CTGCAACAGCAGCACCCTGTGGG + Intergenic
1079612584 11:22451620-22451642 TTTCAACAACAGCAAACTGCTGG - Intergenic
1080716995 11:34812505-34812527 GTTCAGCAGCACCATACTGTAGG + Intergenic
1081040292 11:38201496-38201518 ATTCAGCAGCATCATGCTGTAGG + Intergenic
1086941087 11:92799274-92799296 CTTGAACAGCAGCATAGTATGGG - Exonic
1089672194 11:120064239-120064261 CTTCAACAGATGAATTCTGTGGG - Intergenic
1091031506 11:132192730-132192752 TCTCAACGGCAGCAGACTGTTGG - Intronic
1091672996 12:2466637-2466659 CTGCACCAGCAGCATCCTGTGGG - Intronic
1093142663 12:15527549-15527571 GTTCAGCAGCACCATACTGTAGG + Intronic
1094471694 12:30807462-30807484 CTTCAGCAGCACCATGCTGTAGG + Intergenic
1095777632 12:46026740-46026762 GTTCAGCAGCACCATGCTGTAGG - Intergenic
1099390527 12:82073446-82073468 CTTCAACAGCAGCAAGTTGATGG + Intergenic
1101364359 12:104058000-104058022 GTTCAGCAGCACCACACTGTAGG - Intronic
1103718451 12:122960221-122960243 CTTCCACAGCCGCATCCTGCTGG + Exonic
1110639824 13:77810007-77810029 ATTCAAAAGCAGAATAATGTTGG + Intergenic
1111954847 13:94745338-94745360 CTTCAACAGTAGCAAACTATGGG + Intergenic
1115194345 14:30779863-30779885 CTCCAACAGCAACATGCTGATGG + Intergenic
1116974701 14:51102833-51102855 CAACAGCAGCAGCATACTCTAGG - Intergenic
1117095355 14:52291682-52291704 CTTGAATAGCACCACACTGTTGG + Intergenic
1118077336 14:62314378-62314400 TTTCCCAAGCAGCATACTGTAGG + Intergenic
1121027218 14:90625433-90625455 CTCCAAGAGCAGCATACGGTGGG - Intronic
1122060764 14:99135304-99135326 CTCCAACAGCATCATTCTGCAGG + Intergenic
1124711247 15:32014202-32014224 CTTCAAGAGCAGGAGGCTGTGGG - Intergenic
1126240867 15:46441761-46441783 CTTCAACAGCAGAATGATATTGG - Intergenic
1126549806 15:49915387-49915409 GTTCAACAGCAGAATATGGTGGG + Intronic
1126815858 15:52452561-52452583 GTTCAGCAGTATCATACTGTAGG + Intronic
1129297971 15:74610216-74610238 CTGCAGCAGCAGGATCCTGTGGG + Intronic
1134336151 16:13301398-13301420 CAGCAACAGCAGCATTATGTGGG - Intergenic
1134357066 16:13492212-13492234 CTTCCCCAGCAACATTCTGTGGG + Intergenic
1138090096 16:54166830-54166852 GTCCAACAGAAGCATAATGTGGG + Intergenic
1138938592 16:61761648-61761670 CTTTAACAGCATCTTCCTGTGGG + Intronic
1145809795 17:27757685-27757707 GATGAACAGCAGCATACTGAAGG + Intronic
1146386716 17:32383471-32383493 CTTCATAAGCCTCATACTGTTGG - Intergenic
1149266042 17:54928702-54928724 CTTCAGCAACAGTATAGTGTAGG - Intronic
1155010468 18:21772789-21772811 CTGCAACTGCGGGATACTGTTGG + Intronic
1155113702 18:22742621-22742643 GTTCAGCAGCACCACACTGTAGG + Intergenic
1155978007 18:32152761-32152783 GTTCAGCAGCACCACACTGTAGG - Intronic
1157285293 18:46373445-46373467 CTTCCACAGCAGGATACTGTGGG - Intronic
1157741534 18:50097593-50097615 CTGCAGCAGCAGCAGAATGTAGG + Intronic
1159598177 18:70403448-70403470 CTTCATCTGCAGCTTACTCTGGG - Intergenic
1162265753 19:9572560-9572582 GTTCAGGAGCACCATACTGTAGG + Intronic
1165566185 19:36730293-36730315 GTTCAGCAGCAGCATGCTGTAGG + Intronic
1168694892 19:58398510-58398532 CCTCAGCACCAGCATACAGTAGG + Intergenic
925808983 2:7679867-7679889 CCTCCACAGCAGCATCTTGTGGG + Intergenic
926894172 2:17666567-17666589 CTGTAAAAGCAGCATTCTGTGGG + Intronic
927187167 2:20490213-20490235 CTCCAGCAGCAGCATCCTCTGGG - Intergenic
931331720 2:61293535-61293557 CTCCAGCAGCAACAAACTGTAGG + Exonic
932451885 2:71816043-71816065 CTCCAACAGCACCATTCTGTTGG - Intergenic
939847586 2:147267534-147267556 ATTCAGCAGCACCACACTGTAGG - Intergenic
940379995 2:153003466-153003488 CTTAAACAGCAACAGAATGTTGG - Intergenic
943102479 2:183505172-183505194 GTTCAGCAGCATCATGCTGTTGG - Intergenic
943191207 2:184681438-184681460 GTGCAAAAGTAGCATACTGTCGG + Intronic
943955282 2:194180758-194180780 CTTCAACAGCATGAAGCTGTGGG + Intergenic
948739962 2:240039849-240039871 GTTCAGCAGCACCATGCTGTAGG - Intergenic
1168804590 20:664874-664896 CTGCAACGGCAGCATGTTGTTGG - Intronic
1168908238 20:1423782-1423804 CTTCCACAGCAGCATAAACTAGG - Intergenic
1170863492 20:20130774-20130796 GTTCAGCAGCACCACACTGTAGG - Intronic
1171508347 20:25658171-25658193 GTTCACCAGCACCATGCTGTAGG - Intergenic
1172238935 20:33399001-33399023 ATTCAACAGTAGTATAATGTAGG - Intronic
1173756589 20:45521948-45521970 CTTCCACAGGAAAATACTGTTGG + Intergenic
1174466453 20:50721398-50721420 CTACAACAGGAACATACTGATGG - Intergenic
1175431703 20:58909572-58909594 CTTCAACGGTAGGATGCTGTGGG + Exonic
1175588750 20:60169935-60169957 CTTCACCTGCTGCATACTCTAGG - Intergenic
1175612359 20:60362302-60362324 CTCCAACAGCTGCATAAGGTAGG - Intergenic
1178532690 21:33388640-33388662 CTTCAACTTCAACCTACTGTAGG - Intergenic
1179769148 21:43600910-43600932 CATCAACAGCAGCATACTGCAGG + Intronic
1184056350 22:42052828-42052850 CTTGAACAGCAGCTAATTGTAGG + Intronic
951233996 3:20212951-20212973 CTTCAGCAGCAGGATTCTATTGG - Intergenic
952409697 3:33036200-33036222 CTTAAACAGCTGCATACAGAAGG + Intronic
952646793 3:35669726-35669748 CTTCAATAGAAGAAAACTGTTGG - Intronic
952972684 3:38662633-38662655 GTTCAGCAGCAACACACTGTAGG + Intergenic
953172632 3:40521834-40521856 CCTCAACAGAAGCAAACTATAGG - Intergenic
953575423 3:44109543-44109565 CTAGAAGAGCAGCACACTGTGGG + Intergenic
953852129 3:46472336-46472358 CTTCAACAGTAGCACACAGGAGG - Intronic
955395226 3:58552470-58552492 GTTCAGCAGCACCATGCTGTAGG - Intergenic
955499318 3:59568590-59568612 CTTCAACTACAGCACACTGCTGG + Intergenic
955952791 3:64259116-64259138 TTTCAAAATTAGCATACTGTGGG - Intronic
959604400 3:108226114-108226136 ATGCAACAGCAGCATATTTTGGG + Intergenic
959800732 3:110492462-110492484 ATTCAACACCAGGATACAGTGGG + Intergenic
962763309 3:138538286-138538308 GTTCAGCAGCACCACACTGTAGG + Intronic
963033485 3:141003402-141003424 CTTCAACAGAATCATGCTATCGG - Intergenic
963404116 3:144840659-144840681 CTTCAGCAGCATCACACTATAGG - Intergenic
963457958 3:145570920-145570942 CTTCAATAGTAGAATACAGTAGG + Intergenic
966372039 3:179260743-179260765 CTGAAACTGCAGTATACTGTGGG + Intronic
967502861 3:190220528-190220550 CTTGAACAACAGCATATCGTTGG + Intergenic
969473823 4:7409399-7409421 GTTCAGCAGCACCATGCTGTTGG - Intronic
970665921 4:18336546-18336568 CTTCATCAGCAGCATATGGCTGG - Intergenic
971797346 4:31244696-31244718 ATTCAGCAGCACCACACTGTAGG + Intergenic
973242870 4:47976767-47976789 CTTTGACAGCAGCATCGTGTAGG + Intronic
976839130 4:89410792-89410814 CCTCAACACTAGCAGACTGTGGG - Intergenic
978818843 4:112940610-112940632 ATTCAACAGCATGATACTGATGG - Intronic
979497869 4:121404903-121404925 TTTCAACAGCAACATACTAAAGG - Intergenic
980868045 4:138576758-138576780 ATTCAGCAGCACCATGCTGTAGG + Intergenic
981159554 4:141481723-141481745 GTTCAGCAGCAGTATGCTGTAGG - Intergenic
981900692 4:149858378-149858400 ATTCAGCAGCACCATGCTGTAGG + Intergenic
982317759 4:154048466-154048488 CTTCACCAGCTGCCTCCTGTAGG + Intergenic
983455562 4:167958751-167958773 CTTCAACAGCATCATGATATAGG + Intergenic
987581351 5:19797119-19797141 TTTTAAAAGCAGCATACAGTTGG - Intronic
988846414 5:35132296-35132318 CATCAACATCTGCATACTCTAGG + Intronic
989390339 5:40894066-40894088 ATTCAGCAGCAGCACACTATAGG - Intergenic
992654976 5:78900202-78900224 ATTCAGCAGCACCACACTGTAGG - Intronic
993241020 5:85385463-85385485 ATTTAGCAGCAGCATGCTGTAGG - Intergenic
994416952 5:99484352-99484374 CATCAGAAGCTGCATACTGTGGG - Intergenic
994463022 5:100090822-100090844 CATCAGAAGCTGCATACTGTGGG + Intergenic
994597170 5:101854205-101854227 GTTCAGCATCAGCACACTGTAGG + Intergenic
995278792 5:110308861-110308883 GTTTAGCAGCACCATACTGTAGG + Intronic
995780752 5:115773007-115773029 CTTTAAAAGCAGCACACTTTTGG - Intergenic
995827534 5:116317395-116317417 GTTCAACAGCAACATGCTGTAGG - Intronic
998270966 5:140706153-140706175 CTGCAACAGAAGCATTCTCTAGG + Exonic
999371572 5:151058532-151058554 CATCCACAGCAGCATCCAGTTGG + Intronic
999412402 5:151363277-151363299 GTTCAGCAGCACCACACTGTAGG - Intergenic
999697486 5:154199608-154199630 CTGGAAGAGCAGCAGACTGTGGG - Intronic
1001192073 5:169640615-169640637 CTCCAAGGGCAGCAAACTGTGGG + Intronic
1003079623 6:3010744-3010766 GTTCAGCAGCACCACACTGTAGG + Intronic
1012500180 6:99879694-99879716 CCTCACCAGCAGCAGCCTGTTGG - Intergenic
1014130789 6:117829862-117829884 CTTCAGCAGCACCACACAGTAGG + Intergenic
1014290050 6:119547831-119547853 CTTTAAGAGCAGCATAGAGTAGG - Intergenic
1014678181 6:124394346-124394368 CTTTAACAGCATAATACTATAGG + Intronic
1015656897 6:135528887-135528909 CTTCTAAAGCAAAATACTGTAGG - Intergenic
1015854039 6:137604435-137604457 CTTCCACAGCAGGCTACTCTAGG + Intergenic
1021623873 7:22573721-22573743 CTTGCACATAAGCATACTGTTGG + Intronic
1021771830 7:24010811-24010833 GTTCAGCAGCACCACACTGTAGG - Intergenic
1022917356 7:34971763-34971785 CTTCAAGAGCTGCCTTCTGTTGG - Intronic
1028560362 7:92168460-92168482 ATTCAGCAGCACCATGCTGTAGG + Intronic
1029488426 7:100857142-100857164 CTTCAACAGCAGTACCCTGAAGG + Exonic
1030508804 7:110457400-110457422 CTTTACCAGCAGAAAACTGTTGG - Intergenic
1030772440 7:113490981-113491003 TTTCATCAGCAGGATACAGTGGG + Intergenic
1032650483 7:133872778-133872800 GTTCAACAGCCTCTTACTGTGGG - Intronic
1036586843 8:10132418-10132440 CTGCTATAGCAGCATACCGTAGG + Intronic
1037787979 8:21913543-21913565 CTTCAGCAGCAGCAGACGTTTGG - Exonic
1038349717 8:26764809-26764831 CTTCAAAAGCCGGATCCTGTAGG - Intronic
1040755911 8:50773617-50773639 CTGCAACAGCATCAGACTCTTGG + Intronic
1041664137 8:60426098-60426120 CTTCACCACCAGCCTACTGTGGG - Intergenic
1043932672 8:86108537-86108559 GTTCAGCAGCAGCAGAGTGTGGG + Intronic
1044590036 8:93905397-93905419 CTGCAAAAGCAGCATCATGTAGG + Intronic
1045832064 8:106474232-106474254 CATGAACAGCAGCATACTACTGG + Intronic
1045835092 8:106510901-106510923 CTTCAACAGAAGTATCCTTTGGG - Intronic
1048072708 8:131039470-131039492 CGGCAGCGGCAGCATACTGTAGG + Exonic
1049127631 8:140806248-140806270 CTTCAAAAACAGCATAGTATAGG - Intronic
1049766666 8:144358301-144358323 CAGCACCAGCAGCATGCTGTCGG + Exonic
1057296303 9:93845023-93845045 GTTCACCAGCACCATGCTGTAGG - Intergenic
1057516585 9:95727149-95727171 CACCAACAGCAGCATCATGTGGG - Intergenic
1061303445 9:129719301-129719323 GTTCAACAGCAGCCAACTGCAGG + Exonic
1186994719 X:15107692-15107714 GGTCAGCAGCATCATACTGTAGG - Intergenic
1188553361 X:31384596-31384618 CTTCAACAGCAGCATACTGTTGG - Intronic
1189445786 X:41080135-41080157 CATCAACACCAGTATATTGTTGG + Intergenic
1189991508 X:46599783-46599805 ATTCAACAGTAGCAAACTGGTGG - Intronic
1194132080 X:90093821-90093843 CTTCCAAAGCAGCAAATTGTTGG - Intergenic
1194530037 X:95035917-95035939 GTTCATCAGCACCATGCTGTAGG - Intergenic
1195073568 X:101304636-101304658 GTTCAGCAGCATCATGCTGTAGG - Intergenic
1196149435 X:112356300-112356322 ATTCAAAAGCAGAAGACTGTGGG - Intergenic
1199245045 X:145593953-145593975 GTTCAGCAGCAGCATGCTATAGG + Intergenic
1199463262 X:148107268-148107290 CTGCAACATCAGAATAGTGTGGG + Intergenic