ID: 1188558926

View in Genome Browser
Species Human (GRCh38)
Location X:31445430-31445452
Sequence GCCAATCCAGAATTTCTTAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 123}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188558926_1188558929 7 Left 1188558926 X:31445430-31445452 CCCCTAAGAAATTCTGGATTGGC 0: 1
1: 0
2: 0
3: 7
4: 123
Right 1188558929 X:31445460-31445482 CAAGAAAAATATATTGCTGCTGG 0: 1
1: 0
2: 0
3: 14
4: 343

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188558926 Original CRISPR GCCAATCCAGAATTTCTTAG GGG (reversed) Intronic
902260357 1:15220510-15220532 CCCAATACTGACTTTCTTAGGGG + Intergenic
905014272 1:34766460-34766482 GAAAATATAGAATTTCTTAGAGG - Intronic
906769261 1:48470228-48470250 GCCAATACAAACTTTCTAAGAGG - Intronic
907036003 1:51216808-51216830 TCCAATCCAGGATTACTTAATGG + Intergenic
909912370 1:81276839-81276861 GCCATTACAGAATTCTTTAGAGG - Intergenic
910252847 1:85216159-85216181 GACAATCCAGAATTACTTGGAGG + Intergenic
910678742 1:89841713-89841735 GCCTTTCCAGAATTACTTGGTGG - Intronic
910928099 1:92416827-92416849 GGCAATCCAGAATTTAACAGAGG - Intergenic
915732581 1:158064752-158064774 GCCAAGCCAGCCTTTCTTAGAGG + Intronic
915857046 1:159399275-159399297 GCCTGGCCAGAATTTCTTACAGG - Intergenic
918668647 1:187184603-187184625 TCTAATCCAGAATTTCTTTTTGG + Intergenic
918967075 1:191364955-191364977 GCCAATACAGAAGTTATTAATGG - Intergenic
919511992 1:198476431-198476453 GCCAATTCAGAACTTGTTATTGG + Intergenic
1063465357 10:6239970-6239992 GACAATGAAGAATTTCTGAGGGG + Intergenic
1070271946 10:74965104-74965126 CCCAATCCAGAAGTTTTTGGGGG - Intronic
1072339449 10:94432518-94432540 CCCAATCCAAAATTTCCTAGTGG + Intronic
1074526719 10:114269279-114269301 GCCCATCCAGATTTTCTAATGGG - Intronic
1086606167 11:88699152-88699174 GTCATTCCCAAATTTCTTAGAGG - Intronic
1087276555 11:96166739-96166761 GCCTATCTAGAACTTTTTAGAGG + Intronic
1088074615 11:105831670-105831692 GACAATCCACAATTTATCAGAGG - Intronic
1088727805 11:112655011-112655033 GCAAAACCACAAGTTCTTAGAGG - Intergenic
1090273474 11:125403975-125403997 GAAAATCCAAAATTCCTTAGAGG - Intronic
1090528391 11:127562465-127562487 ACAAATCCAGTATTTCTTGGAGG + Intergenic
1094734640 12:33221325-33221347 TCCAATCCAGAATTTCAGACTGG - Intergenic
1098540230 12:71647588-71647610 GTCGATCCAGAATTTCTTTAAGG + Intronic
1100480264 12:94971107-94971129 GCCAAGCCAGATTTTCTCATGGG - Intronic
1102866232 12:116377140-116377162 CCCAGCCCAGAATTTCTTAAAGG - Intergenic
1103161655 12:118734280-118734302 TCCAATCCAGAAGTCCCTAGGGG - Intergenic
1113874614 13:113586189-113586211 GCGAATCCTGCATTTCTTGGGGG + Intronic
1113886205 13:113659725-113659747 GCCCAGCCATAATTTCTTAATGG + Intergenic
1117495275 14:56296170-56296192 GCCAATCCAGAAGATCTTGCGGG - Intronic
1121043099 14:90766478-90766500 TCCTGTCCAGAATTTCTTATTGG - Intronic
1125076360 15:35623455-35623477 TACAATCCAGAATTTTTTAAAGG + Intergenic
1131855453 15:96588743-96588765 GCCAATTCAGAGTTTCCTGGTGG + Intergenic
1131920655 15:97324478-97324500 GCAGATCCGTAATTTCTTAGAGG + Intergenic
1132094945 15:98976666-98976688 GCCACTCCAGAATTTTCTGGTGG + Intronic
1132568969 16:635831-635853 GCCCCCACAGAATTTCTTAGGGG + Intronic
1134012523 16:10865988-10866010 GCCAATCTAGTATTGCTAAGAGG - Intergenic
1137399362 16:48140858-48140880 GCCAACCCAGACTTTCCCAGAGG + Exonic
1141213042 16:81998793-81998815 GCCCATCTTGAATTTCTGAGAGG - Exonic
1142700820 17:1659506-1659528 GTCAATCCAGTATTTCTGGGTGG + Exonic
1146232753 17:31128594-31128616 TCCAACCCAGAATTTCATATTGG - Intronic
1147911861 17:43860819-43860841 GTCATTCCAGAATTTCTCATTGG + Intronic
1150527938 17:65943481-65943503 TCCAACCCAGAATTTCTTATCGG - Intronic
1151443472 17:74148502-74148524 GCCATTCTGGAACTTCTTAGAGG + Intergenic
1152511168 17:80790023-80790045 GGCAAACCAGAATTTCTCTGTGG - Intronic
1153997733 18:10455808-10455830 ACCAAGACAGAATTTCTTTGGGG + Intronic
1154042998 18:10877068-10877090 TACAAGTCAGAATTTCTTAGTGG - Intronic
1156991892 18:43419175-43419197 ACCAATCAAGAATTTCTTGAGGG + Intergenic
1160553638 18:79712249-79712271 GCTGATGCAGAATTTCTAAGCGG - Intronic
1163625996 19:18390090-18390112 GCCCATCCTGAATCTCTGAGAGG + Intergenic
1164385431 19:27767498-27767520 GCGACTCCAGAAATTCTTATGGG - Intergenic
1164823628 19:31268316-31268338 GCCAACCCAGAGTTTCCTGGGGG - Intergenic
1165708015 19:37990090-37990112 CCCACTCCAGAATTTCACAGAGG - Intronic
1168533929 19:57153165-57153187 CCCAATCCACAATATCTTTGAGG + Intergenic
927408981 2:22804035-22804057 GCCAAACAAAAATTTCTCAGGGG - Intergenic
928152393 2:28843690-28843712 GCCACTTCAAGATTTCTTAGGGG - Intronic
932406496 2:71516054-71516076 CCCAATCCACATTTTCTGAGGGG + Intronic
932911621 2:75812109-75812131 CCCAATCCATAATTGTTTAGGGG + Intergenic
934500068 2:94852375-94852397 TCAAATCTAGAATGTCTTAGTGG - Intergenic
935294905 2:101640350-101640372 GCCCATCCAGAATTTAATACTGG - Intergenic
937643090 2:124235865-124235887 GTCATTCCAGATTTTCTTACAGG + Intronic
940534885 2:154928859-154928881 GCCCAGCCAGAATTTTTTAAAGG - Intergenic
1169468535 20:5863063-5863085 GTCAAGCCAGAAGTTCTCAGCGG - Exonic
1172247686 20:33457203-33457225 CCCAATCCAGAATTTCATGAGGG + Intergenic
1172690347 20:36785515-36785537 GCCAACCAAGAATCTCTTACTGG + Exonic
1172989401 20:39021887-39021909 GCAGATCCAGAATATCTTTGTGG + Exonic
1177019657 21:15838334-15838356 TCCAATAATGAATTTCTTAGGGG + Intronic
949809984 3:7996749-7996771 GCCCAGCCAGAATGTCTTAATGG + Intergenic
951814619 3:26740172-26740194 GACAATCCCACATTTCTTAGAGG + Intergenic
951846448 3:27089710-27089732 GTCAATCTAGGATTTCTTACTGG - Intergenic
952946384 3:38480355-38480377 GCTCATCCAGAGTTTCTTAAAGG - Intronic
953224826 3:41009515-41009537 GCTCATCCAGAAATTCTGAGTGG + Intergenic
954828930 3:53401536-53401558 GGCCATCCAGGACTTCTTAGGGG + Intergenic
960681427 3:120251211-120251233 TCCAATCCAGAATTTCACATCGG + Intronic
963672425 3:148268779-148268801 GGCAATTCAGAAATACTTAGAGG - Intergenic
963738376 3:149048137-149048159 TCCAATCCAGAATTCTTTAAAGG - Exonic
964130847 3:153284864-153284886 ACAAATCCAGAATTGATTAGTGG + Intergenic
965523679 3:169694442-169694464 GGCCATCTAGTATTTCTTAGAGG + Intergenic
966195929 3:177313724-177313746 GCCAATCTAAAATTTATTAGGGG - Intergenic
966597192 3:181734904-181734926 TCCAAGCCTGAATTTCTTATTGG + Intergenic
972612795 4:40670790-40670812 GATAAACCAGAATTTCTTTGAGG - Intergenic
972702309 4:41506162-41506184 ACCAATAAAGAATGTCTTAGTGG + Intronic
974115685 4:57576439-57576461 GCCAAAGCAGAACTTCTTTGAGG + Intergenic
975510499 4:75189652-75189674 GCCAAACCAGAATTTCCCATGGG + Intergenic
976359104 4:84156599-84156621 CCCCATCCAGAATTTCTTGGTGG - Intergenic
977104190 4:92859443-92859465 TTCAATCCAGAATATCTTTGAGG + Intronic
979749532 4:124261138-124261160 GCCATTCTAGAATGTGTTAGTGG - Intergenic
982456972 4:155621625-155621647 GCCAATGCAGAGATTCTTAATGG + Intergenic
985868748 5:2537253-2537275 GGCAATCCATAATTTATGAGTGG - Intergenic
986357356 5:6941977-6941999 CCTAATCCTGATTTTCTTAGCGG + Intergenic
988433740 5:31149545-31149567 GCCAATCCAGTATTACATAATGG + Intergenic
988725070 5:33918934-33918956 GGCAATTCAGAATTTCTTCTGGG + Intergenic
990944254 5:61233341-61233363 GCCAAATCAGAATTTCTGGGTGG + Intergenic
995165144 5:109030997-109031019 GCCATCCCAGTATTTCTTGGTGG + Intronic
995536257 5:113139371-113139393 CTCAATCCAGAATCTCTTACAGG + Intronic
995815417 5:116162252-116162274 GCCAATCCAAAATACCTGAGTGG - Intronic
996623504 5:125540035-125540057 GCCACTCCAGCTTTTATTAGTGG + Intergenic
996973454 5:129401209-129401231 GCTAATCCATCATTTCTTAAAGG - Intergenic
998499276 5:142617858-142617880 GCCAATCCACTATTTGTTAAAGG + Intronic
1001687409 5:173604605-173604627 GACATTCAAGAATTTCTTGGAGG - Intergenic
1006125164 6:31833153-31833175 GCCAATTCAGAATCTCAAAGAGG + Intergenic
1006813407 6:36835494-36835516 GCCAATCTAGAGATTCTTAAGGG - Intronic
1011892430 6:92181987-92182009 GCTAATCTAGAAGTTCCTAGGGG - Intergenic
1014032283 6:116719409-116719431 GCAAAACCATATTTTCTTAGAGG + Intronic
1014878154 6:126686533-126686555 CACAATCCCAAATTTCTTAGAGG - Intergenic
1019869494 7:3746081-3746103 GCAAACCCACAATATCTTAGAGG - Intronic
1021969740 7:25953695-25953717 TCCAATGCAGTCTTTCTTAGGGG + Intergenic
1034402486 7:150873589-150873611 TCCCAACCAGAATTTTTTAGGGG + Intergenic
1034468761 7:151245010-151245032 GCCACTCCAGATTTTCTCAATGG - Intronic
1035275369 7:157745135-157745157 GCCACCCCAGCATTTCTCAGGGG + Intronic
1036509150 8:9384394-9384416 ACGAATTCAGAATTTCTTGGAGG + Intergenic
1036711039 8:11078733-11078755 GCCTACCCAGAATTTCCTAACGG - Intronic
1038582107 8:28756911-28756933 GACAATCCAGTTTTTCTTAATGG - Intergenic
1039066938 8:33617325-33617347 GCCTGTCCAGAGTTTCTTGGTGG + Intergenic
1052271733 9:26634623-26634645 GCCAATGCAGAATTTCTAGGGGG + Intergenic
1053657105 9:40228161-40228183 TCAAATCTAGAATGTCTTAGTGG + Intronic
1053907467 9:42857456-42857478 TCAAATCTAGAATGTCTTAGTGG + Intergenic
1054369222 9:64374441-64374463 TCAAATCTAGAATGTCTTAGTGG + Intronic
1054527493 9:66148064-66148086 TCAAATCTAGAATGTCTTAGTGG - Intronic
1054676853 9:67864189-67864211 TCAAATCTAGAATGTCTTAGTGG + Intronic
1057129679 9:92645094-92645116 GCCCAGCCAGAATTTCTTTTTGG - Intronic
1186879020 X:13846179-13846201 GGGAATTCAGAATTTCGTAGAGG - Intronic
1187278114 X:17834270-17834292 TAGTATCCAGAATTTCTTAGAGG - Intronic
1187292905 X:17972520-17972542 GCCAAAGGAGAATCTCTTAGAGG - Intergenic
1187973461 X:24681931-24681953 GGAAATCCAGAATTTCATACTGG - Intergenic
1188534238 X:31178685-31178707 GCCAGTGCAGACTGTCTTAGAGG - Exonic
1188558926 X:31445430-31445452 GCCAATCCAGAATTTCTTAGGGG - Intronic
1197423862 X:126271658-126271680 TCCAACCCAGAATTTCATATTGG - Intergenic
1198117829 X:133561275-133561297 GCCAATTTGGAATTTCTTAATGG + Intronic
1198511176 X:137353332-137353354 GCCAATGGAGAAGTTCTCAGAGG + Intergenic