ID: 1188559173

View in Genome Browser
Species Human (GRCh38)
Location X:31448273-31448295
Sequence GATAAAAAGGAAAAGGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1951
Summary {0: 1, 1: 1, 2: 15, 3: 198, 4: 1736}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188559173 Original CRISPR GATAAAAAGGAAAAGGAGGC AGG Intronic
900015881 1:149379-149401 TACAAAAAAGAAATGGAGGCCGG + Intergenic
900046145 1:507976-507998 TACAAAAAAGAAATGGAGGCCGG + Intergenic
900068347 1:749688-749710 TACAAAAAAGAAATGGAGGCCGG + Intergenic
900106757 1:984798-984820 ATAAAAAATGAAAAGGAGGCCGG - Intergenic
900153791 1:1195286-1195308 AACAGAAAGAAAAAGGAGGCCGG - Intronic
900253832 1:1686297-1686319 AAAAAAAAGAAAAGGGAGGCTGG - Intronic
900262831 1:1741077-1741099 AAAAAAAAGAAAAGGGAGGCTGG - Intronic
900882943 1:5394821-5394843 GATATAAAAGAAAGGGAGGAAGG + Intergenic
901155121 1:7131246-7131268 TATAAAAATGAAAAGGCGGCCGG - Intronic
901382219 1:8882044-8882066 AAGAAAAAAGAAATGGAGGCCGG + Intergenic
901567847 1:10133612-10133634 AATAAAGAGGAGAAAGAGGCCGG + Intronic
901854569 1:12036407-12036429 CAGAAAAAGAAAAAAGAGGCTGG + Intergenic
902342571 1:15793716-15793738 GAAAAAAAGAAAAATTAGGCGGG + Intergenic
902630912 1:17704038-17704060 TATAAAAAGAAGAAAGAGGCCGG - Intergenic
902706559 1:18209436-18209458 GAAAGAAAAGAAAAGAAGGCGGG - Intronic
902959370 1:19951633-19951655 GAAAAAATGAAAAAGAAGGCTGG + Intergenic
903047747 1:20576890-20576912 GAAAAAAGGGACAAGTAGGCAGG - Intergenic
903251609 1:22058023-22058045 GATAAAAATGTAAAGGAGGCCGG - Intronic
903311094 1:22456969-22456991 GGTTAAAAGGGAAAGAAGGCTGG + Intronic
903508714 1:23857271-23857293 AATAAATAGGAAAAGTAGGTGGG - Intronic
903604052 1:24561918-24561940 AAAAAAAAGAAAAAGGAGGGAGG + Intronic
903774905 1:25786774-25786796 GACAAAAGTGAAAAGGAGGATGG - Intergenic
903899985 1:26637165-26637187 AATAAGAAAGTAAAGGAGGCCGG - Intergenic
904163017 1:28535230-28535252 GATGAAAAGGTAAGGGATGCAGG - Intronic
904455379 1:30644834-30644856 AAAGAAAAGGAAAAGGAGGGAGG - Intergenic
904862548 1:33549701-33549723 GATAAGAAAGGGAAGGAGGCTGG + Intronic
905289135 1:36909595-36909617 GATAAAAAAGAAAAAAAGGCCGG - Intronic
905439653 1:37986880-37986902 GATAAAAAGGAAGAGAAAGTAGG + Intronic
905566768 1:38971799-38971821 AAAGAAAAGAAAAAGGAGGCCGG + Intergenic
905778351 1:40685845-40685867 GAAAAAAAAAAAAAGTAGGCTGG + Intergenic
906055413 1:42912367-42912389 AATAAAAAGGTAGAGGAGGGGGG - Intergenic
906114138 1:43344830-43344852 AATAAAATGGAAAAGGGGCCAGG + Intronic
906172762 1:43741598-43741620 CTTAAAAATGAAGAGGAGGCTGG + Intronic
906176283 1:43775986-43776008 AAGAAAAAGGAATAGAAGGCAGG - Intronic
906803089 1:48754577-48754599 GAGAAAAAGGAAAAGGGGACTGG + Intronic
906810973 1:48826603-48826625 GATATAAAGCAAGAGGAGGCTGG + Intronic
906954439 1:50360338-50360360 GATAAAAGGTTACAGGAGGCTGG + Intergenic
907231270 1:53001272-53001294 GAGAAAAAGGGAAAGGAGGATGG + Intronic
907483331 1:54759707-54759729 AACAAAAAAGAAAAGAAGGCTGG + Intronic
907824219 1:57999913-57999935 GAAAAGAAGGAAAAGAAGGAAGG + Intronic
907957233 1:59241526-59241548 AATGAAGAGGAAAAGGAGGTGGG - Intergenic
908282365 1:62554174-62554196 GATAAAAAAGCAAAGGCGGCTGG + Intronic
908325267 1:63017474-63017496 ACTAAAAGGGAAAAAGAGGCAGG - Intergenic
908397786 1:63742095-63742117 GAAGAAAAGGAAGAGGAGGAAGG + Intergenic
908414535 1:63900155-63900177 TATAGAAAGGAAAAGTTGGCCGG + Intronic
908635019 1:66154039-66154061 GATAAAAAGGTAAAGAAAGAAGG - Intronic
908764750 1:67544407-67544429 GATAACATGGAAAAGCAGGTTGG - Intergenic
908958363 1:69664015-69664037 TATAAAAATTAAAACGAGGCCGG - Intronic
909098029 1:71314105-71314127 TTTAAAAAGGAAAAACAGGCTGG - Intergenic
909646427 1:77922062-77922084 AATAAAAAGGTCCAGGAGGCTGG - Intronic
909737690 1:78984906-78984928 GATAAAAAGGAAAAAGAGGGAGG + Intronic
909775214 1:79476745-79476767 GAGAAAAAGTACAAAGAGGCAGG + Intergenic
909975926 1:82046154-82046176 GTGAAAAAGGAAGAGGAGGCAGG - Intergenic
910046915 1:82928483-82928505 AAAAAAAAAGAAAAGGAGGAAGG - Intergenic
910150663 1:84139761-84139783 GAAAAAAAGGAAAAAGGGCCGGG + Intronic
910256627 1:85254684-85254706 GTTAAAAAGCAAAAGGTGCCGGG - Intronic
910293307 1:85619214-85619236 GATAAAAAGAGAAAAGAGCCGGG - Intergenic
910409913 1:86931293-86931315 GGTAAAAAGGCAAATGAGGTAGG + Intronic
910480544 1:87653938-87653960 AATAAAAAGAAAAAGAAGGCTGG + Intergenic
910505793 1:87948994-87949016 AAGCAAAAGGAAGAGGAGGCAGG + Intergenic
910896888 1:92079299-92079321 AAAAAAAAAAAAAAGGAGGCGGG - Intergenic
911005599 1:93218806-93218828 CATAAAAGTGCAAAGGAGGCTGG - Intronic
911034473 1:93526318-93526340 GATGAAAAGGAGATGGAGCCTGG - Intronic
911187885 1:94921541-94921563 GTTAAAGAGGGAAAGGAGGCAGG + Intronic
911214566 1:95178241-95178263 AATAAAAATTAAAAAGAGGCCGG - Intronic
911584059 1:99669810-99669832 ATTAAAAAGGAGAAGGAGGAGGG + Intronic
911854244 1:102856602-102856624 GAAAATAAAGAAAAGGAGGGGGG - Intergenic
912032488 1:105265877-105265899 GTTAGAAAGGAGAAGGAGGTGGG - Intergenic
912317760 1:108681749-108681771 GAGAAAAAGGAAAAAGTGGGAGG - Intergenic
912416589 1:109512451-109512473 CAGAAAGAGGAAAGGGAGGCCGG - Intergenic
912437426 1:109671593-109671615 GACATAAAGAGAAAGGAGGCTGG - Intronic
912596591 1:110884757-110884779 AATAAAAGGGAAAAAAAGGCTGG - Intronic
912625174 1:111200295-111200317 GATATAAAGGAAGAGGAGGAAGG + Intronic
912739959 1:112185182-112185204 GGTAAAAATGAAAAGGAAGAAGG + Intergenic
912939599 1:114033241-114033263 GAGAAAAAGAAAAATGAAGCAGG - Intergenic
913077387 1:115352506-115352528 GAGAAGCAGGATAAGGAGGCTGG - Intergenic
913315757 1:117549956-117549978 GATAGAAAGTAAAAGGAAGCAGG - Intergenic
913679433 1:121174661-121174683 AAAAAAAAGGAATAAGAGGCCGG - Intronic
913944260 1:125142881-125142903 GAAAAAGAGGAAAAGAAGGGAGG + Intergenic
913963596 1:143357042-143357064 AAAAATAAGGAAAGGGAGGCTGG - Intergenic
914031263 1:143962308-143962330 AAAAAAAAGGAATAAGAGGCCGG - Intronic
914057956 1:144182631-144182653 AAAAATAAGGAAAGGGAGGCTGG - Intergenic
914121190 1:144783734-144783756 AAAAATAAGGAAAGGGAGGCTGG + Intergenic
914158184 1:145105654-145105676 AAAAAAAAGGAATAAGAGGCCGG + Intronic
914773949 1:150718784-150718806 AATAAATAAGAAAATGAGGCCGG - Intronic
914840128 1:151241504-151241526 AAGAAAAAGAAAAAGGGGGCAGG + Intronic
915046045 1:153018114-153018136 GAGAGCAAGGAAAAGCAGGCTGG + Intergenic
915455001 1:156034590-156034612 GTTAAAAAGTAAAACAAGGCTGG - Intergenic
915746309 1:158161729-158161751 GCTAGAAAGAGAAAGGAGGCAGG + Intergenic
915769234 1:158401655-158401677 GAAAAAAAGGAAAAAGGGGTAGG + Intergenic
916023456 1:160814306-160814328 GAGAAAGAGGAAGAGGAGGAGGG + Intronic
916046450 1:161003557-161003579 GAAAAAAAAGAAAATTAGGCCGG - Intronic
916472731 1:165139776-165139798 AAGAAAAAAGAAAAGGAGGTGGG + Intergenic
916534864 1:165694211-165694233 AAAAAAAAAAAAAAGGAGGCAGG + Intronic
916551465 1:165853746-165853768 GATAAGAATGAAAAAGATGCAGG - Intronic
916619610 1:166482027-166482049 GATAAAAAGAAAAAGAATGAAGG - Intergenic
916636304 1:166673037-166673059 GATAGAAAGGAGAAGGAACCTGG + Intergenic
916792770 1:168137745-168137767 GCTAAAAAGGGAAAGAAGGAAGG + Intergenic
916875462 1:168963988-168964010 GAGAAACAGGAAAAGGAAGGAGG - Intergenic
916914931 1:169396255-169396277 TAGAAAAACAAAAAGGAGGCTGG + Intronic
917119209 1:171631115-171631137 AATAAAAAGTAAAAAGAGGTCGG + Intergenic
917336126 1:173926086-173926108 GAGAAACAGCAAAGGGAGGCTGG + Intergenic
917405380 1:174700653-174700675 GAAAAGAAATAAAAGGAGGCAGG + Intronic
918158112 1:181870628-181870650 GATAAAAAAGAAAACAAGCCAGG + Intergenic
918426332 1:184413822-184413844 AGTCAAAAGGAAAAGGAGGAAGG + Intronic
918445315 1:184611462-184611484 AATACACAGGAAGAGGAGGCTGG - Intronic
918546210 1:185687452-185687474 GAGAGAAAAGAAAAGGAGGAAGG - Intergenic
918560119 1:185855414-185855436 AATAAAAAGAAGAAGCAGGCAGG - Intronic
918641900 1:186851415-186851437 GGTAAAGATGAAAATGAGGCAGG + Intronic
918665615 1:187146835-187146857 GAAAAAAAGGAAATGAAGGAAGG - Intergenic
918727606 1:187945960-187945982 GATAAGAAGGAAAATGATGTAGG + Intergenic
918845361 1:189602478-189602500 GATAAAAAAAAAAAAAAGGCGGG - Intergenic
918901066 1:190418343-190418365 CATAAAAAGAATAAGAAGGCTGG - Intronic
919655710 1:200195329-200195351 AATAAAAAGGTAAACTAGGCAGG + Intergenic
919795302 1:201318013-201318035 GTTAAAGAGCAAAAGGAGGAAGG + Intronic
919868531 1:201802482-201802504 AAAGAAAAGAAAAAGGAGGCCGG + Intronic
919908843 1:202097498-202097520 AAAAAAAAAAAAAAGGAGGCAGG - Intergenic
920099468 1:203507899-203507921 GACAAAAGAGAAAAGGAAGCAGG - Intronic
920304036 1:205007483-205007505 GAGAAAAAAGAAAGGGAGGGAGG + Intronic
920360326 1:205410990-205411012 GAAAGAAAAGAAAAGGAGGGAGG + Intronic
920439165 1:205967049-205967071 AAAAAAAAGATAAAGGAGGCTGG + Intergenic
920445643 1:206014131-206014153 GATAAAAAGGTTAAGGAGGTGGG + Intronic
920466734 1:206193207-206193229 AAAAAAAAGGAATAAGAGGCCGG - Intronic
920540341 1:206773470-206773492 AATAACAAGGAAAAGAAGTCAGG + Intergenic
921037530 1:211396085-211396107 TAGAAAATGGAAAAGGAGGACGG - Intergenic
921112663 1:212054290-212054312 AAGAACAAGGAAAAGGAGACTGG - Intronic
921132171 1:212229332-212229354 GAAGAAAGGGAAAAGGAGGAAGG - Intergenic
921339587 1:214121341-214121363 GATAAACAAGAAATGGAGCCTGG - Intergenic
921436080 1:215124104-215124126 GATGAAAAGGAAAAGGCAACAGG - Intronic
921451200 1:215307869-215307891 GATAAAAAGTAAAATGAACCTGG + Intergenic
921506126 1:215972469-215972491 GAACAAAAGGGAAAGGTGGCAGG - Intronic
921543050 1:216442371-216442393 GGTAAAAAGAAACGGGAGGCTGG + Intergenic
921660355 1:217793817-217793839 GTGAAAACTGAAAAGGAGGCCGG + Intronic
921704566 1:218307480-218307502 GATGAAAAGGTTAAGGAAGCTGG + Exonic
921918118 1:220636262-220636284 TATAAAAAGGAAAATGAAGCAGG - Intronic
921986535 1:221318580-221318602 CATAAAAAGGCCAAAGAGGCTGG - Intergenic
922103709 1:222495073-222495095 TACAAAAAAGAAATGGAGGCCGG + Intergenic
922124665 1:222711400-222711422 TATATACAGGAAAAGGAGGAGGG + Intronic
922145322 1:222938436-222938458 GTTCTAAAGAAAAAGGAGGCTGG + Intronic
922213263 1:223501200-223501222 GAGGGAAAGGAAAAGGAGGAGGG - Intergenic
922264025 1:223967590-223967612 TACAAAAAAGAAATGGAGGCCGG + Intergenic
923185470 1:231568862-231568884 TACAAAAAAGAAAAGAAGGCTGG - Intronic
923410495 1:233703685-233703707 GATAAAATGCAAGAAGAGGCAGG + Intergenic
923521445 1:234738022-234738044 GATAAAAAGAGAGAGGAGACAGG + Intergenic
923564816 1:235068760-235068782 GAAATAAATGAAGAGGAGGCGGG - Intergenic
923881033 1:238104419-238104441 GATAAAAAGAAAATGGAGGCTGG - Intergenic
923944798 1:238872298-238872320 AATAAAAAGTAAAATAAGGCCGG - Intergenic
924141863 1:241033057-241033079 TATCAAAAAGAAAAGGGGGCTGG + Intronic
924153125 1:241149451-241149473 AGTAAAAAAGAAAATGAGGCTGG - Intronic
924156015 1:241177377-241177399 GAAAATAAGGAACAGGAGCCTGG + Intronic
924345873 1:243072585-243072607 TACAAAAAAGAAATGGAGGCCGG + Intergenic
924375340 1:243402129-243402151 TTTAAAAAGTAAAAGGAGGCTGG + Intronic
924453578 1:244200126-244200148 GTTAAAAAAAAAAAGGAGGTGGG + Intergenic
924461475 1:244263398-244263420 AATAAAGGGGAAAAGGAGGAAGG + Intergenic
924556059 1:245119635-245119657 TCTAAAAAAAAAAAGGAGGCTGG + Intronic
924586238 1:245363490-245363512 AAGAAAAGAGAAAAGGAGGCCGG - Intronic
924671181 1:246127597-246127619 GTGAAATATGAAAAGGAGGCTGG + Intronic
924736472 1:246761369-246761391 AATAAGAAGAAAAAAGAGGCCGG - Intronic
924925781 1:248678187-248678209 GACAAAAAGGACAATAAGGCAGG + Intergenic
1062879422 10:966156-966178 GAGAAAAAGAAGAAGGAGGCTGG + Intergenic
1062897069 10:1111602-1111624 CATCAAAAGGAAAAGGTGACTGG - Intronic
1063034004 10:2267371-2267393 TATAAAGAGGAGAAGGAGGAAGG + Intergenic
1063225361 10:4010551-4010573 CATAAAAATGAAAAAGAGACTGG - Intergenic
1063446113 10:6118462-6118484 AAGAAAAAAAAAAAGGAGGCCGG - Intergenic
1063451437 10:6152881-6152903 TAAAAAAAGGAAGAAGAGGCTGG + Intronic
1063617119 10:7610040-7610062 GAAAAAAAAGAAAGGGAGGGGGG - Intronic
1064180398 10:13109527-13109549 ATTCAAAAGGAAAAAGAGGCTGG + Intronic
1064210403 10:13356334-13356356 TTTAAAAAGTAAAAAGAGGCCGG - Intergenic
1064210533 10:13357302-13357324 GTTAAAAAGGAAAGGAAGGGAGG - Intergenic
1064213616 10:13381529-13381551 TTCAAGAAGGAAAAGGAGGCTGG + Intergenic
1064409959 10:15096763-15096785 GATAAAAGGGAGAAGGAGTATGG - Exonic
1064494232 10:15890976-15890998 GAGACAAAGAAAAAGGAGGAAGG + Intergenic
1064503404 10:16000298-16000320 GATAGAAAGGCAAAGCAGACTGG - Intergenic
1064520944 10:16200184-16200206 AATTAAAAGAAAAAGGAGGCTGG + Intergenic
1064662408 10:17618753-17618775 AAAAAAAAGGAAAGGAAGGCTGG + Intergenic
1064695530 10:17961457-17961479 AACAGAAAGGAAAAGCAGGCAGG - Intronic
1065038130 10:21661605-21661627 AATAAAAAGGAAATGGAGAAAGG - Intronic
1065101087 10:22334340-22334362 GAAAATAAGGAAAAGGAGAGAGG - Intergenic
1065227533 10:23559764-23559786 GATCAAAAGGAAGAGAAGACAGG - Intergenic
1065624705 10:27618713-27618735 GGCAAAAAAGAAAAGGTGGCAGG + Intergenic
1065743735 10:28819682-28819704 AAAAAAAAAAAAAAGGAGGCGGG + Intergenic
1065863703 10:29894897-29894919 AATAAAGAGGAAACTGAGGCTGG + Intergenic
1065867115 10:29923976-29923998 GATAATTAGGGAAAGGAAGCAGG + Intergenic
1065886644 10:30083729-30083751 CATAAGAAAGAAAAGGTGGCTGG + Intronic
1066131303 10:32396924-32396946 TACAAAAAGAAAAAGAAGGCTGG + Intergenic
1066488451 10:35871748-35871770 AATAAAAAAAAAAAGGTGGCAGG + Intergenic
1066576590 10:36832415-36832437 GATAAAAAAAAAAAGGGGGGGGG + Intergenic
1066664781 10:37771968-37771990 GATTAAAAGGTAAAGGAGGCCGG + Intergenic
1066730469 10:38432230-38432252 TACAAAAAAGAAATGGAGGCCGG - Intergenic
1067814163 10:49459376-49459398 AATGAAAAGGGAAAGGAGGAGGG + Intronic
1068022304 10:51600536-51600558 GTTAAAAAGTAAAAAGAAGCAGG + Intronic
1068056380 10:52016869-52016891 GAGAAGAAGGAAAGGGAGGAGGG + Intronic
1068165015 10:53319079-53319101 GATAAAAATGAAGAGGAAGAAGG + Intergenic
1068219466 10:54025858-54025880 GATAAAATGGAAAAAGATGGAGG - Intronic
1068287465 10:54959147-54959169 GATGAAGAGAAAAAGGAGGAGGG + Intronic
1068441625 10:57062811-57062833 GAAAAAAAGGAAATGTAGGAGGG - Intergenic
1068513791 10:58000674-58000696 AAGAAAGAGGAAAAGGAGGCAGG + Intergenic
1068677155 10:59779951-59779973 GACAAAGAGGAAAAGGATGAAGG + Intergenic
1068846432 10:61680913-61680935 AATAAAGAGGAAGAGGAGGAAGG + Intronic
1068922367 10:62498124-62498146 GTTAAATAAGAAAAGGAGGGGGG + Intronic
1068978481 10:63036085-63036107 TATAAAAATAAAAAGAAGGCAGG + Intergenic
1068997906 10:63228542-63228564 GATAAAAACAAGAAGCAGGCTGG + Intronic
1069004623 10:63303600-63303622 GATTAAAAGCACAAGCAGGCCGG - Intronic
1069015122 10:63420722-63420744 AAAAAAAAAAAAAAGGAGGCTGG + Intronic
1069322158 10:67185420-67185442 GAAAAAAAGGAAAAAAAGGCCGG - Intronic
1069374944 10:67784247-67784269 GAGAAAGAAGAAAAGGAGGCAGG + Intergenic
1069404018 10:68078833-68078855 GATATGAAGGAAAAGCAAGCAGG - Intergenic
1069433893 10:68362493-68362515 GAACAAAAGGAAAATGTGGCTGG + Intronic
1069455330 10:68549500-68549522 GATAAAAAGGAAAATTAGTCTGG + Intergenic
1069496199 10:68905613-68905635 TATAAAATGGCAAAGGTGGCTGG + Intronic
1069686607 10:70322975-70322997 GATTAAAAGCAACATGAGGCAGG - Intronic
1069791526 10:71025848-71025870 AAAAAAAAAGAAAAGGAGGGAGG - Intergenic
1070052559 10:72903522-72903544 AATTAAAAGAAAAAGGGGGCTGG - Intronic
1070086608 10:73244197-73244219 GATAAAAAGGAACATGAGGCCGG + Exonic
1070118413 10:73551536-73551558 GAAACAAAGGAAAAGGAAGGGGG + Intronic
1070180622 10:74009902-74009924 AAAAAAAAGAAAAAGGTGGCTGG - Intronic
1070326122 10:75390395-75390417 GAGAAAAAGGAAGAGGAGGAGGG - Intergenic
1070379553 10:75868350-75868372 CATAAAAAGAAAAAGGAAACAGG - Intronic
1070597918 10:77845651-77845673 GAAAGAAAGGGAAAGGAGGGAGG + Intronic
1070957830 10:80475879-80475901 TATAAAAAGGATGGGGAGGCCGG - Intronic
1070991644 10:80738705-80738727 GAGAAAAAGGAAAAAGGGGCGGG - Intergenic
1071230121 10:83576639-83576661 TAAAAAATGGCAAAGGAGGCTGG - Intergenic
1071591209 10:86875023-86875045 AAAAAAAAGAAAAAGGAGCCAGG - Intronic
1071732937 10:88267278-88267300 GCTATAAAGCAAAAGGAGGCTGG + Intergenic
1071929587 10:90453386-90453408 GAAAAAAATGGAAAGGAGCCAGG + Intergenic
1072002376 10:91209458-91209480 ATTAAAAAGAAAAAGGAGGCCGG + Intronic
1072119481 10:92393981-92394003 AAAAAAAAGGACAAAGAGGCTGG - Intergenic
1072136628 10:92553125-92553147 AAGAAAAAGAAAAAGCAGGCTGG + Intronic
1072197483 10:93128796-93128818 GAGAGAAAGGAAAAGAAGGAAGG - Intergenic
1072313789 10:94182250-94182272 AATAAAAAAGAAATGAAGGCAGG - Intronic
1072450757 10:95537821-95537843 GATAAAAAGCCAAAAGAGGCCGG + Intronic
1072513687 10:96154420-96154442 GAAAAAAAAGAAAAGAAGGAGGG - Intronic
1072513692 10:96154450-96154472 GAAAAAAAAGAAAAGAAGGCAGG - Intronic
1072654103 10:97318857-97318879 GATGGAAAGGAAAGGGAGTCAGG - Intergenic
1072711789 10:97720475-97720497 AACAAAAAGTAAAAAGAGGCTGG + Intergenic
1072765884 10:98094965-98094987 AATTAAAAGGAAAGGAAGGCAGG + Intergenic
1072841355 10:98777750-98777772 AAGAAGAAGGACAAGGAGGCAGG - Intronic
1072918780 10:99558071-99558093 AAAAAAAAAAAAAAGGAGGCTGG - Intergenic
1073146955 10:101287460-101287482 GATAGATAGAAAAAGGAGGCAGG - Intergenic
1073416957 10:103391802-103391824 CAAAAAAAAGAAAAAGAGGCTGG - Intronic
1073447171 10:103588648-103588670 GTTAAAAAGGAGAGGAAGGCCGG + Intronic
1073560122 10:104489201-104489223 AAAAAAAAAAAAAAGGAGGCCGG - Intergenic
1073723272 10:106199207-106199229 ATTAAAAAGTAAAAAGAGGCCGG - Intergenic
1074543680 10:114386238-114386260 AATAAAAAGGAAAAGGAACTGGG + Intronic
1074932948 10:118147676-118147698 GATAGAAAGGAGAACAAGGCAGG - Intergenic
1074962968 10:118464352-118464374 GAAAAAAAGAAAAAGGAGATGGG + Intergenic
1075064551 10:119280768-119280790 AAAAAAAAAGAAAAGGAGGGAGG - Intronic
1075106867 10:119544971-119544993 CAAAAAAAGGAAAAAAAGGCCGG + Intergenic
1075382664 10:122031702-122031724 TCGAAAAAGAAAAAGGAGGCTGG - Intronic
1075425939 10:122341757-122341779 GATAAGAAGGAAGCTGAGGCCGG + Intergenic
1075547507 10:123366263-123366285 AATAAAAGGGAAAAGGAGATGGG + Intergenic
1075591244 10:123693161-123693183 CATACAAAGTAAAAGGAGTCTGG - Exonic
1075755379 10:124807354-124807376 GAAAAAAACGAAAATAAGGCCGG + Intronic
1075869853 10:125763273-125763295 GTTAAAAAAGAAAAAGAGACAGG - Intronic
1076343999 10:129768190-129768212 GATAAAATGAAATAGAAGGCGGG - Intergenic
1076565783 10:131398184-131398206 GAGAAAAGGGAAAATGAGGCAGG - Intergenic
1076972474 11:144448-144470 TACAAAAAAGAAATGGAGGCCGG + Intergenic
1077313560 11:1904803-1904825 GATTAAAAGAATAAAGAGGCTGG - Intergenic
1077512996 11:2981246-2981268 GAAAAAAAAAAAAATGAGGCTGG + Intronic
1077857171 11:6139778-6139800 CATAAAAAGAAAAATGAAGCTGG + Intergenic
1077983966 11:7332109-7332131 CATAAAGAAGAAAGGGAGGCAGG + Intronic
1078048552 11:7940775-7940797 GAGAAAAAGCATAAGGAGGAAGG + Intergenic
1078106761 11:8362777-8362799 GAAAAAAAGGAGAAGGAAGCTGG - Intergenic
1078135795 11:8650450-8650472 GAGCAGAAGGAAAAGGAGGAAGG + Intronic
1078173541 11:8950137-8950159 AAGAAAAAAAAAAAGGAGGCAGG + Intronic
1078252886 11:9631696-9631718 CATAAAAAGGAAATACAGGCCGG - Intergenic
1078255626 11:9656101-9656123 AAGAAAAAGGAAAAGGTGGAGGG + Intergenic
1078404742 11:11060535-11060557 GAAAAAAAGAAAAATGAGGTGGG + Intergenic
1078468146 11:11565524-11565546 GAGCAGAAGAAAAAGGAGGCTGG + Intronic
1078607162 11:12786805-12786827 GATAAAGAGGAAAATAAAGCAGG + Intronic
1078741379 11:14069561-14069583 GATAAACAGAAAAAGGAAACTGG - Intronic
1078853594 11:15187773-15187795 GAAAAAAAGTAAAAGAAGACAGG - Intronic
1079066536 11:17298993-17299015 GCTGAAAAGGAAAGAGAGGCCGG - Intronic
1079303080 11:19296749-19296771 GACAAAGAGGAGAAGGAGGATGG + Intergenic
1079417920 11:20257367-20257389 GACAAAAATGAAGAGGAGGTGGG + Intergenic
1079594305 11:22223256-22223278 GATAAAAAGCAAAACGAGCAAGG + Intronic
1079628432 11:22644918-22644940 GATAACAAGAAATAGGCGGCCGG - Intronic
1079670769 11:23168057-23168079 GATAAAAAAGTAAAGGATACTGG - Intergenic
1079804515 11:24912228-24912250 AAAAAAAAAGAAAAGGAGACAGG - Intronic
1079822491 11:25148303-25148325 GAAAAAAAGGAAAAGAAGGAAGG + Intergenic
1080266329 11:30405757-30405779 GAAAAAAAAGAAAAAAAGGCAGG - Intronic
1080432115 11:32208953-32208975 AAAAAAAAGAAAAAGGAGGGAGG + Intergenic
1080549786 11:33363010-33363032 GAAAAAAAGGAAAGGAAGGAAGG - Intergenic
1080550366 11:33369189-33369211 GAGAAAGAGGAAGAGGAGGAGGG - Intergenic
1080657524 11:34269418-34269440 GAAACAAAGGAAAAGAAGGGAGG + Intronic
1080825318 11:35843816-35843838 AATAAAGATGAAAAGGAGGGAGG + Intergenic
1080879552 11:36306726-36306748 TATGAAAAGGAAAAGGAAACAGG - Intronic
1081135761 11:39438490-39438512 GAAAGAAAGAAAAAAGAGGCCGG - Intergenic
1081778759 11:45695307-45695329 GAGAAAAAGGAAAAAGGGGTCGG + Intergenic
1082040513 11:47681031-47681053 CAGTAAAAGGAAAATGAGGCTGG + Intronic
1082076389 11:47979412-47979434 GAGAAACAGGAATGGGAGGCTGG - Intergenic
1082198532 11:49333359-49333381 AATTAAAATGAAATGGAGGCGGG - Intergenic
1082263239 11:50093861-50093883 TACAAAAAAGAAAAGGAGGCTGG + Intergenic
1082920952 11:58493263-58493285 GAAAAAAAGAAAAAGGAGGCTGG + Intergenic
1083465844 11:62845442-62845464 GAAAAAAAAGAAAAGCAGGCTGG - Intergenic
1083480481 11:62941976-62941998 GATAGTAAGGAAAATGGGGCCGG - Intronic
1083489166 11:63002204-63002226 AATAAAAATAAAAAAGAGGCTGG - Intronic
1083537941 11:63489310-63489332 GATGAAAAGGGAAAGGAGGAAGG - Intronic
1083918710 11:65768008-65768030 AAAAAAAAGAAAAAGAAGGCCGG - Intergenic
1084023203 11:66430750-66430772 GATAAGAAAGAAGAAGAGGCCGG + Intergenic
1084111724 11:67018524-67018546 CTTAAAAAAGAAAAAGAGGCCGG + Intronic
1084190421 11:67496139-67496161 GATAAAGGGGAGAAGGAGGAGGG - Intronic
1084346295 11:68551781-68551803 TATAAAAATAAAAAGGAGGCCGG - Intronic
1084374628 11:68767916-68767938 ATTTAAAAGGAAAAGCAGGCAGG - Intronic
1084493552 11:69490991-69491013 GATAAAAAAGAAACGATGGCTGG - Intergenic
1084645528 11:70455176-70455198 GAAAGAAGGAAAAAGGAGGCTGG - Intergenic
1084870076 11:72092637-72092659 GACAGAGAGGAAAAGGAGGCAGG - Intronic
1085193108 11:74646267-74646289 TATAAAAATGAAAATCAGGCCGG - Intronic
1085410780 11:76289142-76289164 GACAAAGGGGAAGAGGAGGCAGG + Intergenic
1085584705 11:77691017-77691039 TACAAAAACAAAAAGGAGGCTGG + Intronic
1085633371 11:78138641-78138663 GAGAAAAAGAAAAAAGAGGAAGG + Intronic
1085713118 11:78848144-78848166 GAAAAAAAAAAAAAGGAGGGAGG - Intronic
1085846323 11:80069988-80070010 TTTAAAAAGGAAAACGAGGGGGG - Intergenic
1085970708 11:81587471-81587493 GATGAAAGGGAAGAGAAGGCAGG + Intergenic
1086219371 11:84423434-84423456 GATAAAAAGATAAAGTAGGTTGG - Intronic
1086386677 11:86316212-86316234 GAGGAAAAAGAAAAGAAGGCCGG + Intronic
1086506475 11:87509754-87509776 AATAAAAAAGAAAAGGAAGAAGG - Intergenic
1086528445 11:87756208-87756230 GATAAACAGGAAAATGCAGCAGG - Intergenic
1086689831 11:89776899-89776921 GATGAAAAGGAAAAAAAGGCCGG - Intergenic
1086698837 11:89876079-89876101 GATGAAAAGGAAAGAAAGGCCGG + Intergenic
1086707334 11:89968420-89968442 GATGAAAAGGAAAGAAAGGCCGG - Intergenic
1086716024 11:90063057-90063079 GATGAAAAGGAAAAAAAGGCCGG + Intergenic
1086827630 11:91519047-91519069 GAGAAAGAGGAGAAGGAGGAGGG + Intergenic
1086952596 11:92906235-92906257 GAGGAAAAGGAAGAGGAGGAGGG + Intergenic
1087079181 11:94153218-94153240 CATACAAAGAAAAAGGAAGCAGG - Intronic
1087144246 11:94796499-94796521 GATTGAAAGGAGAAGGAGCCAGG + Intronic
1087176498 11:95100790-95100812 GAAAAAAAAAAAAAGTAGGCTGG - Intronic
1087414707 11:97839309-97839331 GAAGAAAAGGAAAAGGAGGGTGG + Intergenic
1087512419 11:99114462-99114484 GAAGAAAAGGAGAAGGAGGAAGG - Intronic
1087594187 11:100233247-100233269 GAAAAAAAGGAAAAAGAGAGAGG + Intronic
1087912385 11:103768703-103768725 GGTAAAAATTAAAGGGAGGCTGG + Intergenic
1087930513 11:103972418-103972440 AATAAAAAGGAGAATGAGACAGG - Intronic
1088079125 11:105888580-105888602 TAAAAATAGAAAAAGGAGGCCGG - Intronic
1088086259 11:105984267-105984289 GAGAAAATGGACAAGGAGGCAGG - Intergenic
1088330918 11:108650541-108650563 AAAAAAAAGGAGCAGGAGGCAGG + Intergenic
1088333082 11:108673441-108673463 GAAAAAAAGAAAAAGGAATCAGG - Intronic
1088681824 11:112249977-112249999 AAAAAAAAGGAAAAGGAAGAAGG + Intronic
1089038499 11:115422370-115422392 GATTAAAAGGAAAAACAGGCAGG + Intronic
1089237257 11:117040940-117040962 AAAAAAAAAAAAAAGGAGGCAGG - Intronic
1090376534 11:126293580-126293602 GATAAAAAGATAGAAGAGGCAGG + Intronic
1090465178 11:126926924-126926946 GATAAAAAGGAAGAGCAGCTCGG - Intronic
1090840559 11:130484212-130484234 AAGAAAAACGAAAAGGAGGAAGG + Intergenic
1091195951 11:133730843-133730865 GATGTAAAGGAAAATGAGCCAGG - Intergenic
1091326324 11:134691330-134691352 GAGGAAACGGAAAAGGGGGCAGG - Intergenic
1091515780 12:1179801-1179823 GATATGAAGAAAAATGAGGCCGG - Intronic
1091740026 12:2954464-2954486 GAAAATAAAGAATAGGAGGCCGG + Intergenic
1091865883 12:3836529-3836551 GATAAAAAAGAAAAGAGCGCTGG + Intronic
1092324714 12:7517823-7517845 GAAAAAAAGAAAAAGAAGGCTGG + Intergenic
1092451280 12:8604932-8604954 AAAAAAAAGGAAAAAAAGGCGGG + Intronic
1092614392 12:10203187-10203209 GAGAGATAGGAAAAGGGGGCAGG - Intergenic
1092763593 12:11831585-11831607 AGAAAAAAGGAAAAGGAGACAGG + Intronic
1092880428 12:12883879-12883901 GATAAAAACAAGATGGAGGCAGG + Intergenic
1092897039 12:13022059-13022081 TTTAAAAAAGGAAAGGAGGCAGG - Intergenic
1092969555 12:13679043-13679065 GAAAGAGAGGAAAAGGAGGAAGG + Intronic
1093262567 12:16957310-16957332 TAAATAAAGAAAAAGGAGGCTGG - Intergenic
1093772560 12:23034506-23034528 GAAAGAAAGAAAAAGGAGGGAGG - Intergenic
1093822922 12:23643830-23643852 GAAAGAAAGGAATTGGAGGCAGG + Intronic
1094169220 12:27474436-27474458 CATAAAAAAGAAAAGGTGGCAGG - Intronic
1094212948 12:27911230-27911252 TTTAAAAAGGAAAAGATGGCCGG - Intergenic
1094266190 12:28563231-28563253 TATAAAAAGGAAAATGAAGCAGG + Intronic
1094401518 12:30066085-30066107 TATACAAAAGGAAAGGAGGCCGG + Intergenic
1094435493 12:30416448-30416470 GATATAAAGAAAAAGGGGGCAGG - Intergenic
1094864084 12:34508387-34508409 GATAAAAACTAGAAGGAGTCTGG - Intergenic
1095259672 12:40083597-40083619 GAGAAAAAGGAAAAAAAGGATGG + Intronic
1095366652 12:41414562-41414584 TATAAAAAGGAAAAGAAAGAAGG + Intronic
1095610523 12:44122338-44122360 CACAAAAAAGAAAAAGAGGCTGG - Intronic
1095673426 12:44888632-44888654 TATAAAAAGGAATAGTAAGCGGG + Intronic
1095694476 12:45129192-45129214 AAGAAAAAAGAAAAGGAGGCCGG + Intergenic
1095710969 12:45287623-45287645 GAGAATAAGGAAAAGGAGTCAGG + Intronic
1095824746 12:46519461-46519483 GAGAAGAAAGAAAAAGAGGCAGG - Intergenic
1096085113 12:48860384-48860406 AAAAAAAAAGAAAAGGAGGAGGG - Intronic
1096151901 12:49319363-49319385 CAAAAAAAGTAAAAGCAGGCTGG + Intergenic
1096300074 12:50419062-50419084 GGTAAAAAAGCAAATGAGGCTGG + Intronic
1096313583 12:50543931-50543953 AAAAAAAAAAAAAAGGAGGCTGG + Intronic
1096400129 12:51299075-51299097 GAAAAAAAAAAAAAGGGGGCGGG + Intronic
1096494980 12:52034554-52034576 GATATGAAGGAACAAGAGGCTGG + Intronic
1096701227 12:53384263-53384285 GAAAAAAAAGAAAAGAAAGCCGG - Intronic
1096772968 12:53948127-53948149 GAAAAAAAAGAAGAGGAGCCAGG + Intergenic
1096860488 12:54523803-54523825 GCTAGAAAGGAAAATGAGCCTGG - Exonic
1097032225 12:56097948-56097970 GACACAAAGGGTAAGGAGGCGGG + Intronic
1097098416 12:56568824-56568846 AATAAAAAAGAAACGGGGGCCGG - Intronic
1097191618 12:57222179-57222201 GATAAAAAGGAAGAGTTGGGGGG - Intronic
1097283171 12:57858295-57858317 GAAAGAAAGGAAAAGAGGGCAGG - Intergenic
1097285560 12:57874386-57874408 CGGAAAAAGGAAAAGGAGCCTGG - Intergenic
1097420505 12:59372804-59372826 GTTAAAAAGGAAAAGGAGGCCGG - Intergenic
1097591663 12:61582362-61582384 GATACAAAGGAAAAGGGGCAGGG + Intergenic
1097713329 12:62938400-62938422 AAAAAAAAGGAACAGGGGGCTGG + Intergenic
1097744092 12:63280576-63280598 GATAAAGAGAAGGAGGAGGCAGG + Intergenic
1097921861 12:65084375-65084397 GATAAAAAGATAAAGGAACCAGG - Intronic
1098217502 12:68235858-68235880 GAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1098450610 12:70614030-70614052 GAGGAAAAGGAGAAGGAGGAGGG + Intronic
1098519383 12:71419011-71419033 GGAAGAAAAGAAAAGGAGGCAGG - Intronic
1098594522 12:72256250-72256272 GGAAAAAAGGAAAAGTAGGTGGG - Intronic
1098795356 12:74881206-74881228 GAAAAAAAAAAAAAAGAGGCTGG + Intergenic
1098961768 12:76746290-76746312 GAAAAAAAAAAAAAGGAGGCTGG + Intergenic
1099145419 12:79037503-79037525 TTTAAAAAGGGAAAGGGGGCAGG - Intronic
1099182924 12:79488280-79488302 CTTAAAAAGTAGAAGGAGGCCGG + Intergenic
1099305411 12:80948562-80948584 CATATAAAGGAAAAGGATCCAGG + Intronic
1099351306 12:81572349-81572371 GATAAAGAGGAAAACAAAGCAGG - Intronic
1099734913 12:86555069-86555091 CCTTAAAAGGAAAAGGAGGCAGG - Intronic
1099879883 12:88455220-88455242 TATAAAAAGAAGAAAGAGGCCGG - Intergenic
1100247602 12:92778182-92778204 GAAAAAAAGGAAAAGTTGGGGGG + Intronic
1100455973 12:94752136-94752158 AAGAAAAAGGAAAGGAAGGCCGG - Intergenic
1100474293 12:94921639-94921661 AATAAAAAACAAATGGAGGCAGG - Intronic
1100599545 12:96101075-96101097 TATGAAGAAGAAAAGGAGGCCGG - Intergenic
1100744625 12:97632277-97632299 GAGAAAGAAGAAATGGAGGCAGG - Intergenic
1100778116 12:97994544-97994566 GAGAGAAAGAAAAAGGAGCCTGG - Intergenic
1100893657 12:99155182-99155204 GAAAGAAAGGAAAAGGAGAAAGG - Intronic
1101294145 12:103403384-103403406 AAAAAAAAGAAAAAGGATGCAGG + Intronic
1101771511 12:107756097-107756119 GAAAAAAAAGAAAATGAGCCAGG + Intronic
1102132623 12:110544122-110544144 AGTAAAAAGTAAAAGTAGGCGGG - Intronic
1102328258 12:112008184-112008206 GTTAAAAAGAAAAAAAAGGCTGG + Intronic
1102500308 12:113347562-113347584 TATAAAAAGGAGAAAGGGGCTGG + Intronic
1102513217 12:113429372-113429394 CATCGAAAGGAAAAGGAGACAGG - Intronic
1102591525 12:113959878-113959900 GAGAAGAAGAAAAAGGTGGCAGG - Exonic
1102679018 12:114677791-114677813 GATAATAAGGAAACTGTGGCAGG + Intronic
1102698643 12:114819543-114819565 GTTAAAAAAGTAAATGAGGCCGG + Intergenic
1102863977 12:116359898-116359920 GAAAAGAAAGAAAAGGAGGGAGG - Intergenic
1102913109 12:116733478-116733500 GTTAAAAAGTAAGATGAGGCCGG - Intronic
1102987771 12:117292390-117292412 GATAAAATCAGAAAGGAGGCAGG + Intronic
1103118939 12:118364289-118364311 AATGAAAACGAAAAGGAGACTGG + Intronic
1103341568 12:120223871-120223893 GAGAAAAAGGAACAGGGGCCAGG + Intronic
1103351350 12:120285949-120285971 GAAAGAAAGGAAAAAAAGGCTGG + Intergenic
1103475288 12:121213534-121213556 GAAAAAAAGAAAAAAGAGACAGG - Intronic
1103603454 12:122069258-122069280 AAAGAAAAGGAAAAAGAGGCTGG - Intergenic
1104024977 12:125019152-125019174 GCTAAAAAGGAGTAGAAGGCCGG - Intronic
1104085918 12:125474146-125474168 GAGAAAGAGAAAAAGAAGGCAGG - Intronic
1104426314 12:128681274-128681296 TATAAAAATGAAAAACAGGCCGG - Intronic
1104449449 12:128857272-128857294 GCTACAAAGGGGAAGGAGGCGGG + Intronic
1104458763 12:128936874-128936896 GATAAAGAGAAAAAGAAGGGGGG - Intronic
1104459895 12:128946627-128946649 AAAAAAAAAAAAAAGGAGGCCGG - Intronic
1104547153 12:129722720-129722742 GAAAAAAAGAAAAAGGAGCCAGG - Intronic
1104722293 12:131051297-131051319 GAAAAGAAGGAAAATGAAGCAGG - Intronic
1105206366 13:18228904-18228926 CATGACAAAGAAAAGGAGGCCGG + Intergenic
1105315141 13:19251925-19251947 AATAAAAATGAAAAGTAAGCAGG + Intergenic
1105325588 13:19367974-19367996 GATAAAAAAGGAAATGAGGCTGG - Intergenic
1105488228 13:20859170-20859192 TAAAAAACTGAAAAGGAGGCTGG + Intronic
1105659775 13:22481369-22481391 GATTAAAAAAAAAAAGAGGCCGG - Intergenic
1105867914 13:24477181-24477203 GATAAAAAAGGAAATGAGGCTGG + Intronic
1106199091 13:27521299-27521321 TTTAAAAAGTAAAAGCAGGCTGG + Intergenic
1106222800 13:27760773-27760795 GAAAAAAAAGAAAGGGAGGGAGG - Intergenic
1106439681 13:29754999-29755021 GATAAAAGGAACAAAGAGGCTGG + Intergenic
1106513978 13:30436805-30436827 AAGAAAGAGGAAAAGGAGGCTGG - Intergenic
1106704313 13:32264626-32264648 AGTAAAATGGAAAAAGAGGCTGG - Intronic
1106717328 13:32405211-32405233 GATAAAAAGTAAAATGAGGCCGG + Intronic
1106774719 13:32997799-32997821 GATGAGGAGGAAAAGGAGGTTGG - Intergenic
1106848928 13:33767659-33767681 AAAAAAAAAAAAAAGGAGGCAGG - Intergenic
1107131388 13:36900067-36900089 GAGTAGAAGGAAAAGAAGGCAGG - Intronic
1107167347 13:37298274-37298296 GGAAGGAAGGAAAAGGAGGCAGG + Intergenic
1107263982 13:38528749-38528771 GAAAGAAAGGAAAAGAAGGAAGG - Intergenic
1107470676 13:40688377-40688399 CAAAAAAAGAAAAAAGAGGCCGG - Intergenic
1107628537 13:42317172-42317194 AATAAAAATAAAAATGAGGCTGG - Intronic
1107722125 13:43259768-43259790 TATCAAAAGGAAAATAAGGCCGG - Intronic
1107925198 13:45253777-45253799 GATAAAAAGAAAGAAGAGGCTGG + Intronic
1108134022 13:47335459-47335481 AAGAAATAGGAAAAGGGGGCCGG - Intergenic
1108218687 13:48211201-48211223 GAAAAAAAAAAAAAAGAGGCCGG - Intergenic
1108245634 13:48510304-48510326 GTAAAACAGGAAAAGGAGGAGGG + Intronic
1108642580 13:52396225-52396247 GATAAAGATAAAAAGCAGGCTGG + Intronic
1108730662 13:53232127-53232149 CATAAAGAGAAGAAGGAGGCGGG + Intergenic
1108770067 13:53688832-53688854 GGGAAAAAGGAGAAGGAGACAGG + Intergenic
1108862130 13:54874027-54874049 GATAAAATGCAAAAGAAGGTTGG - Intergenic
1109074191 13:57812325-57812347 GGTGAAAGGGAAAAGGAGGATGG + Intergenic
1109268272 13:60225448-60225470 GCTAAGAAGGAAAATGAAGCTGG - Intergenic
1109994582 13:70107464-70107486 GATGAAGAGGAAGAGGAGGAAGG + Exonic
1110159250 13:72355800-72355822 TATAAAACTGAAAAGGAGCCAGG - Intergenic
1110374249 13:74774657-74774679 GAAGAAAAAGAAAAGGAGGAAGG - Intergenic
1110409809 13:75191833-75191855 GTTAAAAAAGAAAAGTAGGCTGG + Intergenic
1110490332 13:76096051-76096073 AAGAAAAAGGGAAGGGAGGCAGG - Intergenic
1110552816 13:76827616-76827638 AAAAAAAAGGGAAAGGATGCTGG - Intergenic
1110647435 13:77904327-77904349 GATAAAAAGGAAAAGAGAGTAGG - Intronic
1111042232 13:82763852-82763874 GATAAAAAAGAAAAGCAAGATGG + Intergenic
1111105532 13:83641231-83641253 TTTAAAGAGGAAAAGTAGGCTGG - Intergenic
1111181012 13:84665106-84665128 GATAACAAGGAGAAGAAGACAGG + Intergenic
1111906420 13:94260976-94260998 GAAAATAAGGAAAAGGCGCCGGG + Intronic
1111997399 13:95178453-95178475 GCTAAGAAGGAGAAGGAAGCTGG + Intronic
1112046388 13:95602244-95602266 AGTAAGAAGGAAAAGGTGGCAGG - Intronic
1112221784 13:97498424-97498446 AATAGAAAGGAGAAGGAGGATGG - Intergenic
1112350984 13:98632823-98632845 AAGAAACAGAAAAAGGAGGCCGG - Intergenic
1112404611 13:99107889-99107911 GAGAAAGAGGAAAAGGAGGAAGG + Intergenic
1112440346 13:99420489-99420511 GATGAAGAGGAAAAGGAGTGTGG + Intergenic
1112513527 13:100031790-100031812 AAAAAAAAAGAAAGGGAGGCAGG - Intergenic
1112539055 13:100288812-100288834 GGGAAAAAGGAAAAGAAGGAAGG - Intronic
1112544148 13:100348858-100348880 GAAAGAAAGGAAAGGGAGGAAGG - Intronic
1112620735 13:101051498-101051520 GATAAAAAGAAAAGGGAGGTGGG + Intergenic
1112890144 13:104219658-104219680 AAAAAACAGGAAATGGAGGCTGG + Intergenic
1113030711 13:105990811-105990833 GATAAACAGGAAAGGGAAGGAGG - Intergenic
1113139112 13:107127512-107127534 GATTGAGAGGAAAAGGAGGCAGG + Intergenic
1113279438 13:108772826-108772848 GATAAAAAAGAAAAGGGAGGAGG + Intronic
1114164300 14:20203301-20203323 GAAACAAAGGAAAAAGAGGATGG - Intergenic
1114202064 14:20530839-20530861 GAAAAGAAAGAAAAGGAGGGAGG + Intergenic
1114293955 14:21312798-21312820 AATAAAAAGGAAGAAGAGTCAGG - Intronic
1114471497 14:22966084-22966106 AAAAAAAAAAAAAAGGAGGCAGG - Intronic
1114754118 14:25239817-25239839 CATAAAAAGGCCAAGGGGGCTGG + Intergenic
1115210273 14:30960571-30960593 GCTAAAAATGAAAATGAGGCTGG + Intronic
1115532453 14:34339844-34339866 GTTAAGAGGGAAAAGTAGGCCGG - Intronic
1116828131 14:49691810-49691832 GAAAGAAAGAAAAAGGAGGAAGG - Intergenic
1116884392 14:50205345-50205367 CATAAAAAGTTAAAGCAGGCTGG - Intronic
1117239495 14:53815139-53815161 TATAAATAGGAAAAGTATGCTGG + Intergenic
1117242247 14:53846105-53846127 GAAAAAAAGTAAAGGGAGGAGGG + Intergenic
1117490220 14:56239882-56239904 GATAGAAATGACAAGGAGGATGG + Intronic
1117613671 14:57510038-57510060 GAAAAAAAAGAAAAAGAAGCAGG + Intergenic
1117706738 14:58477783-58477805 GAAGAAAAGGAAAAGGGGGAAGG - Intronic
1117789507 14:59324699-59324721 GATACACAGGAATAAGAGGCAGG - Intronic
1117999280 14:61507940-61507962 GAAAAAAACACAAAGGAGGCAGG + Intronic
1118128247 14:62933827-62933849 GATTAAATGAAAAAGAAGGCAGG + Intronic
1118205599 14:63720324-63720346 GAGAAAAAGGAAAAGAAGGATGG + Intronic
1118768174 14:68923935-68923957 CATAAAAAGGAAAGGGATGGCGG + Intronic
1118778914 14:68993090-68993112 ATTAAAAAGGAAAAGGTGGCTGG + Intergenic
1118798446 14:69167066-69167088 TAAAAAAAGAAAAAAGAGGCTGG + Intergenic
1118981677 14:70722163-70722185 ATTAAAAAGTAAAAAGAGGCTGG + Intergenic
1119027003 14:71161367-71161389 GAACAAAAGGAAAAATAGGCAGG + Intergenic
1119260725 14:73236821-73236843 AAAAAAAAAGAAAAGGAGGGAGG + Intergenic
1119400354 14:74358503-74358525 GAGAAGCAGGAGAAGGAGGCTGG + Exonic
1119809220 14:77502033-77502055 TTTAAAAAGGAAAAATAGGCCGG - Intergenic
1119825568 14:77654634-77654656 AAAAAAAAAAAAAAGGAGGCAGG + Intergenic
1120097910 14:80409830-80409852 GTTTAAGAGGAAAAGGAGGAAGG - Intergenic
1120157716 14:81112414-81112436 GATATAGAGGAAAAAGAGCCAGG - Intronic
1120175704 14:81291096-81291118 GAGAAAAAAGGAAAGGAGACAGG + Intronic
1121043049 14:90765940-90765962 GAGAAAGAGAAAAATGAGGCTGG - Intronic
1121046140 14:90789424-90789446 TTAAAAAAGGAAAAGAAGGCAGG + Intronic
1121160451 14:91734425-91734447 CATAAAAAGGATAAGAAGGCTGG - Intronic
1121174239 14:91878782-91878804 TATAAAAAGGAAGAGTAGGCTGG - Intronic
1121248055 14:92477748-92477770 GAAAAAAAGGAAAGAAAGGCTGG - Intronic
1121265565 14:92600218-92600240 GATAAAAAGGAAAATGAATAAGG + Intronic
1121369147 14:93341152-93341174 TTTAAAAATGAAAAGGTGGCCGG + Intronic
1121535437 14:94687455-94687477 GAAAAAAAAGAAAAGGGGGCTGG + Intergenic
1121571410 14:94949378-94949400 TAAAAAAAGGTAAAAGAGGCTGG - Intergenic
1121571955 14:94952867-94952889 TAAAAAAAGGTAAAAGAGGCTGG - Intergenic
1121962717 14:98276013-98276035 GACAAAAAGAAAAAGGGGGGAGG - Intergenic
1122188851 14:100023756-100023778 TAAAAAAGGCAAAAGGAGGCTGG - Intronic
1122359712 14:101152000-101152022 GAAAAAAAGAAAAAAAAGGCGGG - Intergenic
1122488003 14:102094644-102094666 ATTAAAAAGAAAATGGAGGCTGG + Intronic
1122537165 14:102473509-102473531 GTGGAAAAGGAAATGGAGGCAGG + Intronic
1122539266 14:102488138-102488160 CATAAAAATGCAAAAGAGGCTGG - Intronic
1122610912 14:102982949-102982971 GATAAAAAGGAAAACAAAGGAGG + Intronic
1122621645 14:103061128-103061150 AAGAAAAAGAAAAAGAAGGCCGG + Intergenic
1122730363 14:103792772-103792794 CAAAAAAAAGAAAAAGAGGCTGG + Intronic
1122821146 14:104345805-104345827 GACAAAAAGAGAAAGGAGGGAGG + Intergenic
1122872567 14:104646882-104646904 GAAAAAAAAAAATAGGAGGCCGG - Intergenic
1122908238 14:104812784-104812806 AAAAAAAAGAAAAAAGAGGCCGG + Intergenic
1202914726 14_GL000194v1_random:157463-157485 GATAAAAAGGGAAAGAGGACGGG - Intergenic
1123695856 15:22878838-22878860 GAAAAATAGGCAAAAGAGGCCGG + Intronic
1123821133 15:24031522-24031544 CAGAAAAAGGAAAAGGACTCAGG + Intergenic
1123899147 15:24858863-24858885 GAGAAAAAGGAAAAGGGGGTGGG - Intronic
1124114227 15:26826201-26826223 GAGAAAATGTAAAAAGAGGCTGG - Intronic
1124181288 15:27477742-27477764 TATTAAAAAGAAAAGGAGGCCGG + Intronic
1124203043 15:27694763-27694785 GAGAAAAAGGAAAAGGGGCGGGG - Intergenic
1124397936 15:29321351-29321373 CATAAAAGTGAAAAAGAGGCTGG + Intronic
1124636720 15:31370030-31370052 AAAAAAAAGAAAAAGGAGACAGG - Intronic
1125389368 15:39174730-39174752 GATAAACAGGAAAAGAGGGGAGG - Intergenic
1125473209 15:40024692-40024714 TAAAAAAAAAAAAAGGAGGCTGG - Intronic
1125999682 15:44196788-44196810 GATAGAAAGAAAAAGGGGGAGGG - Intergenic
1126472808 15:49033058-49033080 CATAAAAAGCAAAAGGCCGCTGG - Exonic
1126492016 15:49247447-49247469 GAGAAAAAAGAAAAGAAGGAAGG + Intronic
1126536514 15:49771901-49771923 CATAAAAAGTAAAAAGAAGCAGG + Intergenic
1126623766 15:50666505-50666527 GAGGAAAAAGAAAAAGAGGCCGG + Intronic
1126785147 15:52172423-52172445 GATCAAGAATAAAAGGAGGCCGG - Intronic
1127029023 15:54841093-54841115 GATAGAGAGGCAAAGGTGGCTGG - Intergenic
1127087445 15:55437663-55437685 TATAAAAGGTAGAAGGAGGCAGG + Intronic
1127105438 15:55608851-55608873 AAAAAAAAAAAAAAGGAGGCAGG - Intergenic
1127149770 15:56061243-56061265 TAAAAAAAGGAAAAGAAGGCTGG + Intergenic
1127168351 15:56271592-56271614 GATAAACAGGAAAATTAGCCAGG - Intronic
1127184413 15:56463485-56463507 CATAAAAAATAAAAGCAGGCTGG + Intronic
1127436382 15:58962509-58962531 AAAAAAAAAAAAAAGGAGGCTGG - Intronic
1127446363 15:59067227-59067249 AAAAAAAAGGAAACGGAGGGAGG - Intronic
1127465337 15:59238864-59238886 CATGAAAAGGAAAAAGAGCCAGG - Intronic
1127539036 15:59919105-59919127 GATAAAAGGAAAAAGAAAGCTGG - Intergenic
1127628879 15:60806803-60806825 GACAAAAAGGAGAAAAAGGCAGG + Intronic
1128064183 15:64754313-64754335 GAAAAAAAGAAAAAAAAGGCTGG + Intronic
1128142943 15:65315140-65315162 GAAAAAAAAAAAAAAGAGGCCGG - Intergenic
1128573866 15:68756202-68756224 GATAAAAAGGAAAAGAAGCTTGG + Intergenic
1128610643 15:69070431-69070453 GAGAGAAAGAAAAGGGAGGCAGG + Intergenic
1128755249 15:70179310-70179332 GAAAAAAAGGAAAAGGAAAAAGG - Intergenic
1128882338 15:71255198-71255220 AATCAGAAGGAAAAGGAGCCTGG - Intronic
1129172326 15:73815826-73815848 GATAAAAAGGCCAGTGAGGCTGG - Intergenic
1129698466 15:77754129-77754151 GGGAAAAGGGAAAAGGAGGAAGG + Intronic
1129748348 15:78040902-78040924 GAAAGAAAGAAAAGGGAGGCAGG + Intronic
1129808770 15:78488921-78488943 GTTAAAAAGAAAATGGCGGCTGG + Intronic
1130022231 15:80241304-80241326 GAAAAGAAGGAACAGGAGGCAGG - Intergenic
1130079496 15:80720094-80720116 CAACAAAAAGAAAAGGAGGCTGG - Intronic
1130197378 15:81793207-81793229 GGAAAAAAGGAAAAGAAGGGAGG + Intergenic
1130537298 15:84796436-84796458 GATAAAAAGGAAGAGCAGAGAGG + Intronic
1130551449 15:84892215-84892237 TAAAAAAAGAAAAAGGAGGATGG + Intronic
1130557251 15:84931251-84931273 AATAAAAATAAAAAGGAGGAGGG - Intronic
1130620712 15:85459493-85459515 AAAAAAAAGAAAAAGCAGGCTGG - Intronic
1130686532 15:86042460-86042482 GAGAAAAAGGACAAGGTGTCTGG - Intergenic
1130839709 15:87686721-87686743 TATAAAAAAGAAAACGAGGTTGG + Intergenic
1131224403 15:90611985-90612007 GATAAGAAGGAGAAGGAAGATGG - Intronic
1131281552 15:91025336-91025358 GATAAAAATAAAAATAAGGCTGG - Intergenic
1131408911 15:92189563-92189585 CATTACAATGAAAAGGAGGCAGG + Intergenic
1131582078 15:93653921-93653943 GATATAAAGGAATATGAGACTGG + Intergenic
1131608464 15:93935221-93935243 GATCAAAAGAAGGAGGAGGCCGG + Intergenic
1131726580 15:95232594-95232616 GATAAGGAGGAAGAGGAGGAGGG + Intergenic
1131943551 15:97594021-97594043 GTTAAAAAGGAAAAGGAGCATGG + Intergenic
1132015236 15:98309470-98309492 AAAAAAAAAGAAGAGGAGGCCGG - Intergenic
1132053681 15:98633288-98633310 AATAACAAGGAAGATGAGGCAGG + Intergenic
1132298983 15:100764918-100764940 GAGAAGGAGGAAAAGGAGGCCGG - Intergenic
1132681183 16:1142518-1142540 TAAAAAAAGAAAAAGGCGGCCGG + Intergenic
1132797351 16:1731700-1731722 TACAAAAACGAAAAGGAGGTTGG - Intronic
1133084715 16:3353193-3353215 GATGAAAAGAATAAGTAGGCCGG + Intergenic
1133323298 16:4928139-4928161 CAAAAAATGAAAAAGGAGGCTGG - Intronic
1133547877 16:6825704-6825726 GATGAAGAGGAAAGGGAGGGAGG + Intronic
1133634107 16:7649988-7650010 GGGAGAAAGGAAAAGGAGGAGGG + Intronic
1134063138 16:11211024-11211046 AATAAAGAGGAAAAGGACCCAGG - Intergenic
1134189287 16:12108832-12108854 ATTAATAAAGAAAAGGAGGCTGG + Intronic
1134267635 16:12705459-12705481 CATAAAAAAGAAAATTAGGCTGG + Intronic
1135023535 16:18982207-18982229 AAAAAAAAAAAAAAGGAGGCTGG - Intergenic
1135177802 16:20246386-20246408 GGTAAAAAGGAAATGGATGATGG + Intergenic
1135263986 16:21005673-21005695 GAAAAAAAAAAAAATGAGGCTGG - Intronic
1135470591 16:22726268-22726290 AAGAAAAAGAAAAAGGAAGCGGG - Intergenic
1135633348 16:24053566-24053588 GAAAAAACGGAAAAAGAGGATGG + Intronic
1135731303 16:24897248-24897270 CTTAAAAAGGCAAAGGAGGCTGG - Intronic
1135879953 16:26245530-26245552 CATAGAGAGGAGAAGGAGGCTGG + Intergenic
1136006848 16:27336689-27336711 AAAAAAAAGGAAAGGGAGGAAGG + Intronic
1136021175 16:27441074-27441096 GAGAAAAAAGAAAGGGAGGGAGG + Intronic
1136102220 16:28004476-28004498 AAAAAAAAAAAAAAGGAGGCCGG + Intronic
1136158514 16:28402254-28402276 AATAAAAAGGGAAAAGAGGCAGG - Intronic
1136204573 16:28713029-28713051 AATAAAAAGGGAAAAGAGGCAGG + Intronic
1136615178 16:31394151-31394173 GAAAAAAAAGAAAAAGAGGCTGG + Intronic
1136677204 16:31921424-31921446 TATTAAAAGGAAAAATAGGCCGG - Intergenic
1136688790 16:32012826-32012848 TATAAAAAGTAAAGGGGGGCTGG + Intergenic
1136698205 16:32105609-32105631 GAAAAAGAGGAAAGGGAGGGAGG + Intergenic
1136789240 16:32954975-32954997 AAAAAAAAGGAAAAGAAAGCGGG - Intergenic
1136789385 16:32956341-32956363 TATAAAAAGTAAAGGGGGGCTGG + Intergenic
1136880428 16:33897595-33897617 TATAAAAAGTAAAGGGGGGCTGG - Intergenic
1136880573 16:33898963-33898985 AAAAAAAAGGAAAAGAAAGCGGG + Intergenic
1137314823 16:47306796-47306818 AATAAAACGGAGAAAGAGGCCGG + Intronic
1137322208 16:47396665-47396687 GATAGGAGGGAAATGGAGGCTGG + Intronic
1137350703 16:47711914-47711936 GATAAAAAGGTAGAGGTGGAGGG - Intergenic
1137529714 16:49271054-49271076 AAAAAAAAAAAAAAGGAGGCAGG + Intergenic
1137550865 16:49436698-49436720 GAGAGAAAGAAACAGGAGGCAGG - Intergenic
1137783374 16:51116312-51116334 GGGAAAAAGGAGAAGGGGGCTGG - Intergenic
1137820391 16:51439125-51439147 GAGAAAAAGAAAAAAGAGGGAGG + Intergenic
1137984351 16:53094933-53094955 AGTAAAAAGGAAAACAAGGCCGG - Intronic
1138129518 16:54467760-54467782 TTTAAAAAAGAAAAGGAGGAAGG - Intergenic
1138153984 16:54685935-54685957 GAAAAAAAGGAAGAGGAAGAGGG - Intergenic
1138241856 16:55433882-55433904 GAGGAGAAGGAAAATGAGGCAGG + Intronic
1138408033 16:56814484-56814506 GAAAAAAACGAAATGCAGGCAGG - Intronic
1138669230 16:58599552-58599574 ATTAAAAGGAAAAAGGAGGCTGG + Intronic
1138822246 16:60275299-60275321 GTTTAAAAGTAAAAGTAGGCTGG - Intergenic
1138958099 16:61995671-61995693 CATAAAAAGTAAAAGTAGGCCGG - Intronic
1139058199 16:63213961-63213983 GTTAAAAATGAAAAGGTGCCAGG + Intergenic
1139084633 16:63569726-63569748 GGGAATAAAGAAAAGGAGGCAGG + Intergenic
1139167142 16:64580674-64580696 GGTGACAAGGAAAAGAAGGCGGG - Intergenic
1139276659 16:65733980-65734002 GATTAAAAAAAAAAGGATGCTGG - Intergenic
1139449578 16:67018736-67018758 AAGAAAAAAGAAAAGGAGGCAGG + Intergenic
1139455552 16:67072760-67072782 AAAAAAAAGAAAAAAGAGGCCGG - Intronic
1139608636 16:68038751-68038773 AATAAAAAATAAAAAGAGGCTGG + Intronic
1139649012 16:68352432-68352454 GAGAAAAAAGCAGAGGAGGCGGG + Intronic
1139657038 16:68395091-68395113 GAAAAAAAAAAAAAAGAGGCAGG + Intronic
1139690195 16:68636332-68636354 GATAAATAGGAAGAGCTGGCCGG + Intronic
1139718591 16:68834376-68834398 CAAAAAAATAAAAAGGAGGCTGG - Exonic
1139763421 16:69206294-69206316 GCTAAAAGGTAGAAGGAGGCAGG - Intronic
1139773391 16:69297321-69297343 AAAAAAAAAAAAAAGGAGGCCGG + Intronic
1139828089 16:69773473-69773495 GAAAAAAAAGAAAAGGTGGCTGG - Intronic
1139918230 16:70441164-70441186 TATAAAAAAGAAAAGAAGGCTGG + Intergenic
1139933966 16:70553876-70553898 GATAACCAGGAAATGGAGGGTGG - Intronic
1140086096 16:71798584-71798606 GATTAAAAGATAAATGAGGCCGG + Intronic
1140159747 16:72476430-72476452 GATAAAAGGGAAAAGAAAACCGG + Intergenic
1140168366 16:72577967-72577989 TTTAAAAAGGAAAAAAAGGCTGG + Intergenic
1140193400 16:72837168-72837190 GAGAAAATGGAAAAGGATGAAGG - Intronic
1140265570 16:73417668-73417690 TTTAAAAAGGAAAAAGAGGCTGG + Intergenic
1140305436 16:73798437-73798459 GGAAAAAAGGAAAAGGAGAGAGG + Intergenic
1140347175 16:74225216-74225238 GATAAGAAGGAAAAGAAGACAGG + Intergenic
1140519886 16:75571972-75571994 GATAAAAAGAACAACTAGGCCGG - Intronic
1140540092 16:75749098-75749120 GAAAAAAAGGAAAGGGAAGGAGG + Intronic
1140563543 16:76012227-76012249 AACAAAAAGGTAAAGGAGACTGG - Intergenic
1140570908 16:76104968-76104990 GATACAAAGCAAAAGGGGGCAGG - Intergenic
1141090272 16:81125453-81125475 GAAAAAGAAGAAAAGGAGGCTGG + Intergenic
1141209632 16:81965342-81965364 AATAATAATGAAAATGAGGCTGG + Intergenic
1141366428 16:83447675-83447697 GACAAAAGGGTAATGGAGGCTGG + Intronic
1141480840 16:84305704-84305726 GATTAAAAATAAAAGGAGCCAGG + Intronic
1141508164 16:84494421-84494443 GAAAAAAAGGAATAGAAGGAAGG - Intronic
1141549614 16:84796766-84796788 AAAAAAAAGAAAAAGGAGGCTGG - Intergenic
1142021619 16:87786455-87786477 AAAAAAAAAAAAAAGGAGGCTGG + Intergenic
1142366024 16:89650166-89650188 GAAAAAAAAGAAAAGAAGGTAGG - Intronic
1142447778 16:90153074-90153096 TACAAAAAAGAAATGGAGGCCGG - Intergenic
1203091583 16_KI270728v1_random:1217829-1217851 TATAAAAAGTAAAGGGGGGCTGG + Intergenic
1142459712 17:82250-82272 TACAAAAAAGAAATGGAGGCCGG + Intergenic
1142576665 17:913567-913589 GGAAAAGAGGATAAGGAGGCAGG + Intronic
1142663518 17:1447911-1447933 GAAAAAAGGGAAAAGAGGGCCGG - Intronic
1142729802 17:1845768-1845790 GAAAAAAAGGAAAAGTTAGCTGG + Intronic
1142746564 17:1961983-1962005 GAAAGAAAAGAAAAGCAGGCCGG + Intronic
1142872726 17:2831371-2831393 AAGAAAAAGAAATAGGAGGCTGG - Intronic
1143035221 17:3991298-3991320 GAGAAAGAGGAGGAGGAGGCCGG - Intergenic
1143189158 17:5029092-5029114 AATAAAAGGGAAAAGGTGACTGG - Intergenic
1143360899 17:6370192-6370214 AATAAAATGAACAAGGAGGCCGG + Intergenic
1143361204 17:6372771-6372793 GAGAAAAAAAAGAAGGAGGCAGG + Intergenic
1143877267 17:10001498-10001520 GAAAAAAGGGAAGTGGAGGCAGG + Intronic
1143965819 17:10755946-10755968 GGAAGAAAGGAAAAGGAGGGGGG - Intergenic
1144336151 17:14270613-14270635 GAAAGACAGGGAAAGGAGGCAGG + Intergenic
1144351991 17:14405479-14405501 GATAAATAGGAAAGGGAGTTGGG + Intergenic
1144457432 17:15430607-15430629 GAGAAGAAGGGAAAGGAGGGAGG + Intergenic
1144694458 17:17292606-17292628 AATAAAAAGGAACAGGCGGCCGG - Intergenic
1145036123 17:19541828-19541850 GAAAAACAGGAAAGGCAGGCTGG + Intronic
1145256903 17:21330412-21330434 GATAAGAAGAAAAAGGAAACAGG + Intergenic
1145319708 17:21757539-21757561 GATAAGAAGAAAAAGGAAACAGG - Intergenic
1145375969 17:22349055-22349077 CATATAAAGGAATAGAAGGCTGG - Intergenic
1145847192 17:28050806-28050828 GATAAAAAGTCAAAGAAGGCCGG + Intronic
1146108123 17:30061862-30061884 AATAAAAGGGGAAATGAGGCTGG - Intronic
1146826846 17:36030519-36030541 GACAAAAAGGAAAAAGGGGTGGG - Intergenic
1147115550 17:38296803-38296825 TTAAAAAAGGAAAAGGAGGCCGG - Intergenic
1147123499 17:38350603-38350625 GATGCAAGGGAAAAGGAGGAAGG - Intergenic
1147151642 17:38518997-38519019 TATAAAAAGTAAAGGGGGGCTGG + Intergenic
1147180927 17:38685267-38685289 GAAAAAAAAACAAAGGAGGCAGG + Intergenic
1147292345 17:39454043-39454065 GAAAGAAAGGAAAAGAAGGAAGG + Intergenic
1147366085 17:39960219-39960241 GAAAAGAAAGAAAAAGAGGCAGG + Intergenic
1147866111 17:43553560-43553582 GATAAAAACAAAAACAAGGCTGG - Intronic
1148044723 17:44736278-44736300 ATTAAAAAGTAAATGGAGGCCGG - Intronic
1148097824 17:45066006-45066028 GAAAAAAAGGGGCAGGAGGCTGG - Intronic
1148118443 17:45192425-45192447 AAGAAAAAAGAAAAGGAGGAAGG - Intergenic
1148121295 17:45213587-45213609 CAAAAAAATGAAAAGGTGGCTGG - Intergenic
1148121980 17:45218555-45218577 AAAAAAAAGGAAAAAGGGGCCGG - Intergenic
1148244013 17:46018722-46018744 AATAAAAAGGTAAAGGGGGTAGG + Exonic
1148283284 17:46365685-46365707 TTTAAAATGGAAAAGCAGGCTGG + Intergenic
1148305502 17:46583606-46583628 TTTAAAATGGAAAAGCAGGCTGG + Intergenic
1148414128 17:47492817-47492839 TTAAAAAAGGAAAAGGAGGCCGG + Intergenic
1148574475 17:48699824-48699846 GAAAAAGAAGAAAAGGAGGCTGG + Intergenic
1148609621 17:48955987-48956009 AATAAGAAGAAAAAAGAGGCCGG - Intergenic
1148664719 17:49365792-49365814 GAGAAAGAGGTAAAGGAGGGCGG - Intergenic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148791747 17:50177092-50177114 GAGGAAAAGGAGAAGGAGGCTGG - Intergenic
1149007549 17:51821257-51821279 GTTAAAAAGGAAATAGAGACAGG + Intronic
1149114165 17:53071729-53071751 GAGAAGAAGAAAAAGGAGGGAGG + Intergenic
1149185378 17:53991329-53991351 AAAAAAGAGGAAAATGAGGCAGG - Intergenic
1149309487 17:55380133-55380155 AAGAAAAAGGAAAAGAAGGTAGG + Intergenic
1149364687 17:55931223-55931245 GATAATAATGAAAAAGAGACAGG - Intergenic
1149400601 17:56292125-56292147 CATGAAAAGGAAAACGAGGGAGG - Intronic
1149505854 17:57193402-57193424 AATAAAAATAAAAAGGAGCCAGG + Intergenic
1149509371 17:57226125-57226147 AAAAAAAAAGAAAAGAAGGCTGG - Intergenic
1149700232 17:58649071-58649093 GAAAAAAAAAAAAAAGAGGCCGG - Intronic
1149726056 17:58895807-58895829 CTCAAAAAAGAAAAGGAGGCCGG + Intronic
1149830311 17:59866126-59866148 AAAAAAAAAGGAAAGGAGGCAGG + Intronic
1149833438 17:59891671-59891693 GATAAAAGAAAAAAAGAGGCTGG + Intronic
1149834895 17:59903701-59903723 GATAAAGAGGAAAAGTAAGTTGG - Intronic
1150181452 17:63125389-63125411 GAAAAAAAGGAAAAGTACACAGG - Intronic
1150216287 17:63472314-63472336 AATAAAAAGAAAGAAGAGGCTGG + Intergenic
1150423616 17:65058984-65059006 GAAAGAAAGAAAAAGAAGGCCGG + Intergenic
1150559756 17:66284361-66284383 CATGAAAAGTAAAAGGGGGCCGG + Intergenic
1150647551 17:66988760-66988782 GTTGAAAAGGCAAAGGAGGCAGG + Intronic
1150716578 17:67577294-67577316 AATAAAAATAAAAAGAAGGCCGG + Intronic
1150755584 17:67909271-67909293 GATAAAAAAAAAAAGGGGGGGGG - Intronic
1150768925 17:68024991-68025013 GAAAGAAAAGAAAAGAAGGCTGG - Intergenic
1150828244 17:68495393-68495415 AATAAATAAGAAAAGGAGGCTGG - Intergenic
1151122745 17:71810597-71810619 ATCAAAAAGGATAAGGAGGCTGG + Intergenic
1151383570 17:73741756-73741778 GAGAAAAAGAAAAAGGAGGCAGG - Intergenic
1151429317 17:74051726-74051748 GAGGAACAGGAAAATGAGGCTGG + Intergenic
1151606202 17:75137943-75137965 AAAAAAAAGGAAAACTAGGCCGG - Intronic
1151633602 17:75328341-75328363 AATAAAATAAAAAAGGAGGCTGG + Intronic
1151721214 17:75857209-75857231 TTTAAAAAAGAAAAGCAGGCCGG + Intergenic
1151909164 17:77070155-77070177 TATAAAAAGTAAAATTAGGCCGG - Intergenic
1151915495 17:77114845-77114867 AAAAAAAAAAAAAAGGAGGCAGG + Intronic
1151938148 17:77276327-77276349 AATAAAATGGAAAAGGAGAGAGG - Intergenic
1152076037 17:78160576-78160598 GAAAAAAAGAAAAAGGATGCTGG - Intronic
1152083490 17:78203354-78203376 AAAAAAAAAAAAAAGGAGGCTGG - Intronic
1152266247 17:79296689-79296711 GGAAAAAAGGAAGAGGAGGAAGG - Intronic
1152426534 17:80221176-80221198 GAAAAAAAGGCAAAGGAAGTCGG + Intronic
1152448020 17:80357209-80357231 GATAAGAATTAAAAGGTGGCTGG - Intronic
1152547954 17:81012232-81012254 GAGAAAAAGGAAAAAGGGGTGGG + Intergenic
1152621651 17:81367890-81367912 AAAAAAAAAAAAAAGGAGGCTGG - Intergenic
1153018399 18:605329-605351 GTCAAAAATGAAAATGAGGCAGG + Intronic
1153034132 18:742710-742732 GTTTAAAAGGAAAAGTAGGCAGG - Intronic
1153051117 18:904502-904524 GATAAATAGGAGCAGAAGGCCGG + Intergenic
1153159240 18:2184287-2184309 GATAAAAAGGAAAAAGAGAAAGG + Intergenic
1153224023 18:2884250-2884272 CAAAAAAAAGAAAAAGAGGCTGG - Intronic
1153273342 18:3344587-3344609 GAGGAAAAGGAAAACTAGGCAGG + Intergenic
1153299824 18:3582887-3582909 GGGAAAAAGGAAAAGCAGGGAGG - Intronic
1153331696 18:3880644-3880666 GAAAACTAGAAAAAGGAGGCCGG + Intronic
1153557351 18:6329447-6329469 TATAAAAAGAAACAGAAGGCTGG - Intronic
1153682644 18:7515051-7515073 GAAAAAAAGGAAAAGGGGTGGGG - Intergenic
1153865246 18:9261748-9261770 GGAAGAAAGGAAAAGGAGGGAGG - Intronic
1154365898 18:13708766-13708788 GAAAAGAAGGGAATGGAGGCTGG - Intronic
1154967925 18:21378164-21378186 GATTTAGAGGAAACGGAGGCTGG + Intronic
1155789847 18:29951809-29951831 GATAAAAAGGTAAAAGAGTTTGG + Intergenic
1156005420 18:32435189-32435211 TTTAAAAAGCCAAAGGAGGCAGG + Intronic
1156154292 18:34283226-34283248 AATAGAAAGGAAAAGGAGATAGG + Intergenic
1156381878 18:36569257-36569279 GTTTAAAAGCAAAAGGATGCAGG + Intronic
1157048529 18:44132568-44132590 CATAAAAAGTAAAAATAGGCTGG + Intergenic
1157120722 18:44908350-44908372 GAGAAAGAAGAAAAGGAGGAGGG - Intronic
1157154215 18:45249277-45249299 GATAAAAAAAAAAAAAAGGCTGG - Intronic
1157310950 18:46552805-46552827 GGAAAAACGGAAAGGGAGGCTGG - Intronic
1157355529 18:46930517-46930539 TAGAAAAAAGAAAAGCAGGCCGG + Intronic
1157775350 18:50390682-50390704 GAAAAAAAGGAGGAGGAGGAAGG - Intronic
1157829741 18:50846273-50846295 GAGAAAAAGAAAAAGAAGGAAGG - Intergenic
1157849485 18:51034545-51034567 AAGAAAAAGGAAAAAAAGGCTGG - Intronic
1157891031 18:51418216-51418238 GATGACAAGGAAAAGAGGGCGGG - Intergenic
1158178510 18:54685465-54685487 GATAAAAGGGAAAGGGGGCCGGG + Intergenic
1158323836 18:56293237-56293259 GTACAAAAGGAAAAGGGGGCAGG + Intergenic
1158706398 18:59796143-59796165 GATAGAAAGATAAAGAAGGCCGG + Intergenic
1158920031 18:62181706-62181728 AATAAAAAGGAGAAGGCGACTGG - Intronic
1158962518 18:62598125-62598147 CCTCAAAAGGAAAAGGAAGCGGG - Intergenic
1159037790 18:63294370-63294392 TTTAAAAAGAAAAAGTAGGCTGG + Intronic
1159044762 18:63358880-63358902 AATTAAAAAGAAAAAGAGGCAGG + Intronic
1159149575 18:64504257-64504279 AAAAAGAAGGAAAAGCAGGCAGG - Intergenic
1159529921 18:69642577-69642599 AATAAAAATGAAAAAAAGGCAGG - Intronic
1159907333 18:74107382-74107404 GATAAAAAGTAAAATGTGACTGG + Intronic
1159956064 18:74519333-74519355 GAAAAAAAGGAAATGGAGAGAGG - Intronic
1160604755 18:80041713-80041735 GAAAAAAAAAAAAAAGAGGCAGG - Intronic
1160649428 19:214758-214780 TACAAAAAAGAAATGGAGGCCGG + Intergenic
1160936952 19:1600870-1600892 ATTAAAAAAGAAAAAGAGGCTGG + Intronic
1161047390 19:2143058-2143080 GAAAAAAAAGAAAAAGAGGCTGG - Intronic
1161086109 19:2335544-2335566 GATGCAGTGGAAAAGGAGGCAGG - Intronic
1161612138 19:5249013-5249035 TATAAAAAGGAAATGGAGGCAGG + Intronic
1161625509 19:5324256-5324278 GAAAAAAAGGGAAAGCAAGCTGG + Intronic
1161693625 19:5752729-5752751 CATGGAAAGGAAAAGGGGGCCGG + Intronic
1161740488 19:6018264-6018286 CATAAAAAGGAGATGAAGGCCGG - Intronic
1161806032 19:6443522-6443544 TATAAAGGGGAGAAGGAGGCCGG - Intronic
1161822259 19:6537066-6537088 CATAAAAAGGAAGAAGAGGCCGG - Intergenic
1162059630 19:8086762-8086784 AATAAAAATGAAAATAAGGCTGG - Intronic
1162364824 19:10242209-10242231 GAAAAAAAGCAAAAAGAGGCCGG + Intergenic
1162410081 19:10500378-10500400 GATCAAAGGGAAGAGGTGGCAGG - Intronic
1162434532 19:10649413-10649435 AATAAAAACAAAAAGAAGGCTGG - Intergenic
1162436903 19:10666239-10666261 TTTAAAAAGAAAAAAGAGGCTGG - Intronic
1162458429 19:10799828-10799850 TAAAAAAAGAAAAAGCAGGCTGG - Intronic
1162553141 19:11369543-11369565 GAGACAGAAGAAAAGGAGGCTGG + Intergenic
1162745927 19:12798339-12798361 AATAAAAAAAAAAAAGAGGCCGG - Intronic
1162776308 19:12981774-12981796 AAAAAAAAAAAAAAGGAGGCCGG - Intergenic
1162835327 19:13313203-13313225 GTTAAAAAGGAAGAGCTGGCTGG + Intronic
1162844998 19:13385522-13385544 TCTAAAAAAGAAAAGAAGGCCGG - Intronic
1162914582 19:13867235-13867257 AATAAAAAGGAAACTGTGGCCGG - Intronic
1163082021 19:14950947-14950969 AAAAAAAAAGAAAATGAGGCAGG + Intronic
1163139824 19:15339838-15339860 AAAAAAAGGGAAAAAGAGGCCGG + Intergenic
1163187687 19:15650650-15650672 GAAAGAAAGAAAAAGAAGGCAGG - Intronic
1163311697 19:16518899-16518921 GCTATAAAGGAAAACGAGCCTGG + Exonic
1163358831 19:16832492-16832514 AAAAAAAAAAAAAAGGAGGCTGG - Intronic
1163453992 19:17395238-17395260 GAGAAACAGGAAGAGGAGGGAGG - Intergenic
1163462828 19:17448885-17448907 TAAAACAAGAAAAAGGAGGCCGG + Intronic
1163504251 19:17695484-17695506 GAAACAAAGAAAAAGGAGGGAGG + Intergenic
1163511387 19:17737395-17737417 GTTAAAAGGCAAAAGGTGGCTGG + Intergenic
1163925030 19:20332708-20332730 GATAAAATAGAGAATGAGGCTGG - Intergenic
1163995287 19:21039760-21039782 AATTAAAAGCAAAAGTAGGCCGG - Intronic
1163998570 19:21076136-21076158 AAGAAAAAAGAAAAAGAGGCCGG - Intergenic
1164001538 19:21104909-21104931 TATAAAAATAAAAATGAGGCCGG - Intronic
1164234935 19:23323582-23323604 GAAAAGAAGGAAAAGGAGGATGG - Intronic
1164250190 19:23469049-23469071 GAGAAGAAGGAAAAAGAGGATGG - Intergenic
1164292311 19:23879573-23879595 GAGAAAAAGGAGAGGGAGGTGGG + Intergenic
1164292383 19:23879995-23880017 GAGAAGAAGGGAAAGGAGGAGGG + Intergenic
1164423164 19:28115545-28115567 TATAAAAAGGATGAGGAGGAAGG - Intergenic
1164493913 19:28740130-28740152 GATAAGAAGAAAAAGAAGGAGGG + Intergenic
1164658367 19:29941059-29941081 CATAAAAAGGAAAAAAAGGGTGG + Intronic
1164734036 19:30527211-30527233 AAAAAAAAAAAAAAGGAGGCTGG - Intronic
1164775473 19:30850222-30850244 TATAAAAAGGAAAAGAAGGAGGG + Intergenic
1164848473 19:31457535-31457557 TATAAAAAGATAATGGAGGCAGG - Intergenic
1164868667 19:31625731-31625753 GAGGAAGAGGAAAAGGAGGAGGG - Intergenic
1165047878 19:33120560-33120582 AAAAAAAAGGTAAAAGAGGCTGG + Intronic
1165066308 19:33230845-33230867 GAGAACAGGGAAAATGAGGCAGG - Intergenic
1165117135 19:33535280-33535302 GACAAAGAGGAAAAGGGAGCAGG - Intergenic
1165171337 19:33894118-33894140 TAAAAAAAGAAAAAAGAGGCTGG - Intergenic
1165379001 19:35464556-35464578 GAGCAAAAGGAAAAGGGGGTGGG + Intergenic
1165558469 19:36657114-36657136 ATTAAAAAAAAAAAGGAGGCTGG - Intronic
1165936670 19:39393390-39393412 AAAAAAAAAGAAAAGGAGGCTGG - Intronic
1166059073 19:40313619-40313641 CTTAAAAAGGAAAAGCGGGCTGG - Intergenic
1166079682 19:40435793-40435815 AATAAAAAGAAAAATAAGGCCGG - Intergenic
1166103784 19:40587602-40587624 GATAAAAATGCAAATCAGGCTGG + Intronic
1166164372 19:40976990-40977012 GAGAGAAAGGAAAAGGAAGGAGG - Intergenic
1166192366 19:41183434-41183456 GATAAATAGGGAAGGGAGGAGGG + Intergenic
1166197137 19:41214480-41214502 AAGAAAAAGGAAAAGAAAGCAGG - Intergenic
1166282058 19:41800789-41800811 GATACAAAGCAAAAGGGGGAGGG - Intronic
1166347962 19:42178041-42178063 GACAAAGAGGAAAAGGAGAAGGG + Intronic
1166398882 19:42463162-42463184 GATAATAGGGAAGAGGAGGCAGG + Intergenic
1166536774 19:43579600-43579622 GAGTAAAATGAAAGGGAGGCCGG + Intronic
1166688646 19:44810219-44810241 GATCAGAGGGAAGAGGAGGCTGG - Intronic
1166860334 19:45806695-45806717 AAAAAAAAAAAAAAGGAGGCCGG + Intronic
1167069921 19:47215374-47215396 AAAAAAAAAAAAAAGGAGGCCGG + Intergenic
1167164350 19:47788298-47788320 TAAAAAAAAGAAAAGCAGGCCGG - Intergenic
1167293461 19:48636570-48636592 GACCAAAAGGAAGAGGAGGCTGG + Intronic
1167360848 19:49029669-49029691 GGAAACAGGGAAAAGGAGGCTGG - Intronic
1167409645 19:49337331-49337353 GATAAAGAGAAATAAGAGGCTGG + Intronic
1167429124 19:49444158-49444180 GAAAAAAAGAAAAAGGAAGGAGG - Intergenic
1167614279 19:50523379-50523401 GAAAAAAGAGAAAAAGAGGCCGG + Intronic
1167637591 19:50664099-50664121 AAAGAAAAGAAAAAGGAGGCTGG - Intronic
1167726094 19:51213830-51213852 AAGAAAAAGAAAAATGAGGCTGG - Intergenic
1168048076 19:53808428-53808450 GATAAAAGGGATATAGAGGCTGG + Intronic
1168236745 19:55068537-55068559 CAAAAAAAGAAAGAGGAGGCCGG + Intronic
1168495518 19:56844889-56844911 TATAAAAAGCAATAGCAGGCCGG - Intergenic
1168495540 19:56845113-56845135 TATAAAAAGCAATAGCAGGCCGG - Intergenic
1168566862 19:57432277-57432299 ATTAAAAAAAAAAAGGAGGCGGG + Intronic
1168673051 19:58255959-58255981 GAGAAAAAGGAAAAGGACTAAGG + Intronic
1202697439 1_KI270712v1_random:135299-135321 AAAAATAAGGAAAGGGAGGCTGG - Intergenic
925179118 2:1805453-1805475 GATATGAAAGAAAAGAAGGCCGG + Intronic
925315865 2:2922592-2922614 GGTAAAAATGAAGATGAGGCCGG + Intergenic
925466537 2:4111108-4111130 GAGAGAAAGGAAACGGAGGGAGG - Intergenic
925757149 2:7144521-7144543 GATTAAATGGAAAAGGAGTGAGG + Intergenic
926140375 2:10364578-10364600 AAAAAAAAAAAAAAGGAGGCGGG - Intronic
926831032 2:16962070-16962092 GATAAAAGGGGAAAGGATGAGGG + Intergenic
926934315 2:18072066-18072088 GAGAGAAAGGAAAAGGAACCAGG - Intronic
927415282 2:22872882-22872904 GATAAGTAGGAGAAGGATGCTGG - Intergenic
927493858 2:23539424-23539446 AAAAAAAAAAAAAAGGAGGCAGG - Intronic
927555584 2:24028930-24028952 GGTATAAAGAAAGAGGAGGCCGG + Intronic
927611968 2:24549864-24549886 TTTAAAAAGGAAATAGAGGCTGG - Intronic
927724341 2:25409750-25409772 AAAAAGAAGAAAAAGGAGGCAGG - Intronic
927789407 2:25998717-25998739 AAAAAAAAAAAAAAGGAGGCTGG - Intergenic
928174988 2:29027466-29027488 GATATAAAGAAAAAATAGGCCGG + Intronic
928546902 2:32336847-32336869 AATAAAAATAAAAAGTAGGCTGG + Intergenic
928962022 2:36937045-36937067 GTTAAAAAGAAAAAGAGGGCCGG + Intronic
928976679 2:37094643-37094665 AATCAAAAGAAAATGGAGGCCGG + Intronic
929199898 2:39223892-39223914 ATTAAAAAAGAGAAGGAGGCTGG - Intronic
929546641 2:42859585-42859607 TTTAAAAAGGAAAAAGAGACAGG - Intergenic
929592165 2:43154428-43154450 GATCAAAAGGCAGAGGAGGATGG + Intergenic
929951509 2:46413453-46413475 GGTAATAAGGAAAAGGAGGCTGG + Intergenic
930306407 2:49680091-49680113 GATTAAAAACAACAGGAGGCCGG + Intergenic
930333792 2:50019648-50019670 AAAAAAAAAAAAAAGGAGGCTGG + Intronic
930403983 2:50930383-50930405 GAGAAAAAGAGAAAGGGGGCAGG + Intronic
930475126 2:51871911-51871933 GATAAAGAGGAAAAAGATTCTGG + Intergenic
930508722 2:52317607-52317629 GAAAAGAAAGAAAAGGAGGGAGG + Intergenic
931007204 2:57865278-57865300 GAGAAAGAAGGAAAGGAGGCAGG + Intergenic
931102733 2:59020563-59020585 AATAAAGAGAAAAAGGAGGCTGG - Intergenic
931258334 2:60594798-60594820 TATAAAAAGGCAACGGAGGGTGG + Intergenic
931406739 2:61986863-61986885 AACAAAAAAGAAAAAGAGGCTGG - Intronic
931764414 2:65442210-65442232 TAGAAAAAGGAATAGAAGGCCGG + Intergenic
932038466 2:68272686-68272708 GCAAAATAGGAAAAGAAGGCAGG + Intergenic
932056339 2:68447801-68447823 TTCAAAAAGGAAAAGGTGGCCGG - Intergenic
932078432 2:68688835-68688857 AATAAAAAGCAAAAGGGGGTTGG - Intronic
932253453 2:70264259-70264281 GATAAAAAAAAAAACAAGGCTGG - Intronic
932538408 2:72624252-72624274 AATAAAAAAGAAAATTAGGCAGG - Intronic
932600081 2:73117879-73117901 AAGAAAAAGAAAAAGAAGGCCGG + Intronic
932615907 2:73231413-73231435 CAAAAAAAAGAAAAAGAGGCCGG - Intronic
932672321 2:73748962-73748984 AAGAAAAAGAAAAAGGACGCTGG - Intergenic
932686380 2:73874011-73874033 AAAAAAAAAAAAAAGGAGGCTGG - Intergenic
932747566 2:74346515-74346537 AATAAATAGGAAAAAGAAGCTGG - Intronic
932910558 2:75801739-75801761 GATAAAAATTAAAAAGAAGCCGG + Intergenic
933020145 2:77180358-77180380 TATAGATAGGAAAGGGAGGCTGG - Intronic
933067648 2:77818354-77818376 GAAAGAAAAGAAAAGGAGGGAGG - Intergenic
933263488 2:80155687-80155709 GATACAAAGGAACAAGAGGAAGG - Intronic
933436633 2:82257647-82257669 GAGAATAAGGAAAAGCAGGGTGG - Intergenic
933494152 2:83027345-83027367 GTTAAAAAGCAAAAACAGGCTGG + Intergenic
933746670 2:85576865-85576887 GGTAAGAAGCAAAAAGAGGCCGG - Intronic
933883162 2:86692219-86692241 TATAAAAAGGATAATGTGGCTGG + Intronic
934278608 2:91592324-91592346 AAAAATAAGGAAAGGGAGGCTGG - Intergenic
934858457 2:97743630-97743652 CATAAACAAGAACAGGAGGCCGG - Intergenic
934962339 2:98687688-98687710 GAAACAAAGAAAAAGGAGACAGG - Intronic
935030824 2:99320301-99320323 GATAAAAAGGAAAATAGGTCTGG - Intronic
935165374 2:100564590-100564612 CATCAAAAGAAAAATGAGGCCGG - Intronic
935403400 2:102683696-102683718 GATAATAGGGAAGAGGAGGAAGG - Intronic
935563251 2:104579753-104579775 GATAAAAAAATCAAGGAGGCTGG + Intergenic
935756251 2:106278291-106278313 GGGAAAAAGGAAAAGGGGGAGGG - Intergenic
935977858 2:108596828-108596850 AATAAAAATAAAAAGGAGGGGGG + Intronic
936070913 2:109370627-109370649 GAGAAAGAGGAAAAGGACGGAGG - Intronic
936071635 2:109375265-109375287 GGCGAAAAGGACAAGGAGGCAGG - Intronic
936113228 2:109682186-109682208 GGGAAAAAGGAAAAGGGGGAGGG + Intergenic
936388482 2:112052521-112052543 AAAAAAAAGGAAAATGAGGAAGG - Intergenic
936456081 2:112675311-112675333 GTTAAAAAGGATATGGGGGCTGG + Intergenic
936559130 2:113521127-113521149 GATAGAAAGGAGAGGGAGGAGGG + Intergenic
936704804 2:115059181-115059203 GATAAAAAGAAAGAAGAGGGAGG + Intronic
937078729 2:119125468-119125490 GCAAAGAAGGAAAGGGAGGCCGG - Intergenic
937153334 2:119701115-119701137 GAATAAAGGGAAAAGGAGGTGGG - Intergenic
937301420 2:120844974-120844996 GAAAAAAAGGAGAAAGAAGCTGG + Intronic
937327142 2:120996801-120996823 GAGGAAAAGGAGAAGGAGGAGGG - Intergenic
937657337 2:124391657-124391679 GCAAAAAAAGAAAGGGAGGCCGG + Intronic
937657444 2:124392703-124392725 AAAAAAAAGGAAAAGAAGGAGGG + Intronic
937702443 2:124879225-124879247 GATAAAACCGTAAATGAGGCTGG - Intronic
937713989 2:125011001-125011023 GGAAAAAAGGAAAAGAAGGATGG + Intergenic
937734087 2:125268622-125268644 GTGATAAAGGAAAAGGAGACAGG - Intergenic
937854607 2:126663330-126663352 GATAAAAACATGAAGGAGGCTGG - Intronic
938145587 2:128832499-128832521 AAGAAAAAAGAAAAGGAGGGAGG - Intergenic
938266541 2:129932388-129932410 GATAAAGAAGAAAAGGAGTTTGG - Intergenic
938295915 2:130179415-130179437 CAAAAAAAGAAAAAAGAGGCTGG - Intronic
938295994 2:130179947-130179969 GAGAAAAAAGAAAAAGCGGCCGG - Intronic
938303386 2:130231458-130231480 GATAAAGAGGACAAGGAGGAGGG + Intergenic
938419949 2:131137241-131137263 CAAAAAAAGTAAAAAGAGGCCGG - Intronic
938453287 2:131442774-131442796 GATAAAGAGGACGAGGAGGAGGG - Intergenic
938709140 2:133960404-133960426 AAGAAAAAGAAAAAAGAGGCTGG - Intergenic
938732322 2:134156296-134156318 GCCAAAAAGGAAATGAAGGCTGG + Intronic
938741661 2:134238043-134238065 GAAAAAGAAAAAAAGGAGGCCGG - Intronic
939054822 2:137352126-137352148 AATAAAAAAGAGAAGGGGGCAGG + Intronic
939136065 2:138295781-138295803 AAGAAAAAGGAAGAGGAGGAGGG - Intergenic
939267491 2:139892380-139892402 GTTAAAAATGAAAAAGAGGCCGG + Intergenic
939375239 2:141356931-141356953 GACAGAAATGAAAGGGAGGCTGG - Intronic
939949108 2:148447227-148447249 GAAAGAAAGGGAAAGGAGGGAGG + Intronic
940199485 2:151134665-151134687 TATTAAAAGGAAAAATAGGCTGG + Intergenic
940247388 2:151634345-151634367 GATAAACAGTAAAATGAGGCTGG + Intronic
940714893 2:157210547-157210569 GACAAAAAGGAAAAGAACACAGG - Intergenic
940719170 2:157262662-157262684 AATAAAAAGGTAGAGGAGACAGG + Intronic
941037108 2:160580608-160580630 GCAAAAAAGGAATAAGAGGCAGG - Intergenic
941341933 2:164317010-164317032 AATAAAAAGAAAATGAAGGCAGG + Intergenic
941357759 2:164514185-164514207 GAAGTAAAGGAACAGGAGGCAGG + Intronic
941561679 2:167054385-167054407 GGTCAAAAGGAAAGAGAGGCTGG + Intronic
941561724 2:167054691-167054713 AAAAAAAAGGAAAAGGAAACAGG + Intronic
942008812 2:171737712-171737734 AATAAAAAGAAAAACAAGGCTGG - Intronic
942170753 2:173287312-173287334 GATAAAAAGTTAAAGAGGGCCGG - Intergenic
942178973 2:173361746-173361768 GCTAAAAAGCAAAAGAAGGCTGG - Intronic
942253619 2:174069467-174069489 GAAAAAAAAGAAAAAGAGTCAGG - Intergenic
942300167 2:174553526-174553548 AATAAAAATGAAATGGATGCAGG + Intergenic
942582194 2:177430642-177430664 GAGAACAAAGAAAAGGAGGGTGG - Intronic
942596251 2:177594138-177594160 GATAGAAAGCAAAAGGGGGCAGG + Intergenic
942724291 2:178989841-178989863 AAAAAAAAAAAAAAGGAGGCCGG + Intronic
942909523 2:181226383-181226405 GAGAAGGTGGAAAAGGAGGCAGG - Intergenic
943026331 2:182633785-182633807 GATTAAAAGGATAACCAGGCTGG + Intergenic
943043071 2:182825814-182825836 AAAAAAAAAAAAAAGGAGGCGGG + Intergenic
943308127 2:186292529-186292551 CAAAAAAAGAAAAAGGATGCAGG + Intergenic
943577136 2:189643072-189643094 AAAAAAAAGGAGAAGGAGGGAGG - Intergenic
944113403 2:196160235-196160257 AATAAAATGTGAAAGGAGGCGGG + Intronic
944125149 2:196284044-196284066 CATAAAAAGGAAAAGATGGTAGG - Intronic
944238734 2:197465281-197465303 GAAAAAAAAAAAAAGGCGGCAGG - Intronic
944458934 2:199924109-199924131 TACAAAAGGGCAAAGGAGGCTGG + Intronic
944664625 2:201949659-201949681 GACAAATTGGAAAAAGAGGCGGG - Intergenic
944807107 2:203293501-203293523 GAAAAAAAAAAAAAAGAGGCCGG - Intronic
945113121 2:206383122-206383144 AAATAAAAAGAAAAGGAGGCCGG - Intergenic
945358915 2:208871856-208871878 GATAAAAGGGAAAAGGAAGACGG + Intergenic
945423818 2:209673823-209673845 TATAAAAAGGAATAGAAGGTAGG + Intronic
945622348 2:212156263-212156285 GAAAAAAAGGAAAGGAAAGCAGG + Intronic
946185246 2:217977228-217977250 GATAAACAGAACAAGGAGGGAGG + Intronic
946222147 2:218237185-218237207 GAAAAAAAGAAAAAGGAGCAGGG - Intronic
946243267 2:218369780-218369802 AAGAAAAAGGAAATTGAGGCTGG - Intergenic
946281735 2:218670874-218670896 GTTATTAATGAAAAGGAGGCCGG + Intronic
946648316 2:221864391-221864413 GATAAGAAGGAAAAAAAGGATGG - Intergenic
946795030 2:223341397-223341419 TATAAAATGGCATAGGAGGCTGG + Intergenic
946867077 2:224051371-224051393 GAGAAAAAGGAAAAAAAGGTAGG - Intergenic
947009790 2:225552983-225553005 GATAAAAACAAAAAGTTGGCTGG - Intronic
947148016 2:227086376-227086398 GAAAAGAAGGGAAAGGAGGAAGG - Intronic
947361008 2:229345415-229345437 GAGAATAGGGAAAATGAGGCAGG - Intergenic
947373637 2:229473769-229473791 GGAGAAATGGAAAAGGAGGCAGG + Intronic
947419471 2:229929228-229929250 TATTAAAAAGAAAAAGAGGCCGG - Intronic
947652875 2:231802069-231802091 AATATAAAGAAAAATGAGGCCGG - Intronic
947756125 2:232566638-232566660 GAAAAAAAGAAAAACAAGGCTGG - Intronic
947844752 2:233235029-233235051 GATAAAAAGTTAAACCAGGCCGG - Intronic
947930578 2:233961598-233961620 GAAAAGAAGAAAAAAGAGGCCGG - Intronic
947995933 2:234527743-234527765 GACATAAATGAAAAGGAAGCAGG - Intergenic
948049102 2:234966080-234966102 GAGAAAGAGGAGAAAGAGGCTGG + Intronic
948276027 2:236709505-236709527 GAGAAATAGGACAAGGTGGCTGG + Intergenic
948568443 2:238901270-238901292 GAGCAAAAGGCAAAGGAGGCCGG - Intronic
948857651 2:240737540-240737562 AATAACAAGGAAAGGGAGGGAGG + Intronic
948978237 2:241477422-241477444 CACAAAAAGGAACATGAGGCCGG - Intronic
1169163121 20:3399502-3399524 ACTAAGAAAGAAAAGGAGGCCGG - Intronic
1169164396 20:3409275-3409297 GAGAAAAAGAAAAAAAAGGCCGG - Intergenic
1169419802 20:5450842-5450864 ATTAAAAAGAAAAAGAAGGCCGG + Intergenic
1169692528 20:8347980-8348002 GAAAAAAAAGAAAAAGAGCCTGG + Intronic
1169755945 20:9043380-9043402 TATAAAAGGGAAAAGTGGGCTGG + Intergenic
1169765771 20:9146413-9146435 GATAAAATGGATAAGGAATCAGG + Intronic
1169812386 20:9621288-9621310 AATAAAAAGGAACAGATGGCGGG + Intronic
1169842879 20:9959567-9959589 AATAAATGGGAAAAGAAGGCTGG + Intergenic
1169974305 20:11306220-11306242 GATGAAAAGGAAGAGGATGATGG - Intergenic
1170147075 20:13187451-13187473 TATAAAAAGACAAAGAAGGCCGG + Intergenic
1170283089 20:14673620-14673642 TATAAAATGGAAAAGGTGGCTGG + Intronic
1170370240 20:15640278-15640300 GAAATAAAGGAAAAGGAGAGAGG + Intronic
1170716171 20:18832935-18832957 GAGAGAAAGGAGAGGGAGGCTGG + Intergenic
1170875766 20:20248563-20248585 GAGGAGAAGGAACAGGAGGCAGG + Intronic
1171094619 20:22319493-22319515 GAGAAAGAGGAAAAGGAGGAGGG + Intergenic
1171134761 20:22686332-22686354 GAGAAACAGGAAGAAGAGGCTGG - Intergenic
1171161081 20:22924413-22924435 GATAAAAGGGAGCAGGAGGTAGG + Intergenic
1171161187 20:22925202-22925224 GACACAAAGGAAAAGGAGAGGGG - Intergenic
1171283896 20:23922368-23922390 GAGACAAAGGAAAAAGAGGAGGG - Intergenic
1171463368 20:25311289-25311311 GAGAAAAAGGGAGAGGAGTCAGG + Intronic
1171511408 20:25687860-25687882 TTTAAAAAGGAAAAGTAGGCTGG - Intronic
1171723129 20:28585860-28585882 GGGAAAGAGGAAAAGGAGGTGGG + Intergenic
1172030976 20:31981891-31981913 GTTAACCAGGTAAAGGAGGCAGG - Intronic
1172233839 20:33356039-33356061 TATAAAAAGGTAAAACAGGCCGG - Intergenic
1172332867 20:34087849-34087871 TATGAAAAGGAAAAGGAGGGGGG - Intronic
1172494729 20:35372013-35372035 TAAAAAAAAGAAAAAGAGGCCGG + Intronic
1172643113 20:36453634-36453656 AAAAAAAAGAAAAAAGAGGCTGG + Intronic
1172695139 20:36817290-36817312 GAAAAAAAGGAAAATGAGCAAGG + Intronic
1172695306 20:36818274-36818296 GATAAAATGAATATGGAGGCTGG + Intronic
1172760921 20:37321009-37321031 CAAAAAAAAAAAAAGGAGGCCGG - Intergenic
1173135617 20:40436393-40436415 AATAAAAAGAAAAATGAGGCCGG + Intergenic
1173275448 20:41576758-41576780 GATAAAATGGAAAAAGATGAGGG - Intronic
1173425476 20:42939446-42939468 GAAGGAAAGGAAAAGGAGGGGGG - Intronic
1173601864 20:44301021-44301043 GATGTAGAGAAAAAGGAGGCAGG + Intergenic
1173782442 20:45767729-45767751 AATAAAAAGGAGAAGGAGGAAGG + Intronic
1174079655 20:47961978-47962000 GATAAACAGGCAAGGGGGGCAGG - Intergenic
1174485194 20:50856575-50856597 CACAAAAGGGACAAGGAGGCTGG - Intronic
1174817214 20:53697298-53697320 AAAAAAAAAAAAAAGGAGGCCGG + Intergenic
1174838011 20:53876465-53876487 TATAAAATGGAAATGGGGGCCGG - Intergenic
1176175442 20:63721053-63721075 GGCAAAAAGGATAAAGAGGCCGG + Intronic
1176379751 21:6106326-6106348 GATGACAGGGAAAGGGAGGCAGG - Intergenic
1176634079 21:9172108-9172130 GATAAAAAGGGAAAGAGGACGGG - Intergenic
1176721412 21:10396801-10396823 AAAAAAAAGGAGAAGAAGGCTGG + Intergenic
1176932646 21:14831454-14831476 GATATAAAGGAAATAAAGGCAGG - Intergenic
1177108380 21:16991182-16991204 GATAAAGAGGAAAAGCATGAGGG + Intergenic
1177159296 21:17530259-17530281 GAAAAAAGGGTGAAGGAGGCCGG - Intronic
1177171138 21:17657325-17657347 GGAAAAAAGAAAAAGAAGGCCGG - Intergenic
1177525337 21:22283350-22283372 GATAAAAAAGAAAAAAAGGCTGG - Intergenic
1177538420 21:22460080-22460102 AGGAAAAAGGAAAAGGAAGCAGG + Intergenic
1177955109 21:27588554-27588576 GAAAGAAAGAAAAAGGAGGAAGG + Intergenic
1178395080 21:32235830-32235852 GATAAAATGGGAAAAGAGGAAGG + Intergenic
1178424927 21:32471620-32471642 AAAAAAAAGGAAATGGAGGCTGG - Intronic
1178548483 21:33514590-33514612 GATGAATGGGGAAAGGAGGCAGG - Intronic
1178551372 21:33542512-33542534 GCTAAAAAAAAAAATGAGGCTGG + Intronic
1178897469 21:36571134-36571156 GGTAAAAAGGAGATGCAGGCTGG - Intronic
1178937895 21:36880294-36880316 GAAAGAAGGGAAGAGGAGGCAGG + Intronic
1178947122 21:36957929-36957951 GAAAAAAAAAAAAAAGAGGCCGG + Intronic
1179171678 21:38977697-38977719 GACAAAAAGGTAAATGAGACTGG - Intergenic
1179258626 21:39739224-39739246 GAAAAAAAGAAAAAGAGGGCGGG - Intergenic
1179282052 21:39942090-39942112 GATAGAGAGGAAAAGAAGCCTGG - Intergenic
1179418517 21:41217432-41217454 GGTAAAGAGGGAAAGGAGGGGGG - Intronic
1179440814 21:41392806-41392828 TTTAAAAAGGAAATTGAGGCCGG + Intronic
1179477243 21:41654965-41654987 TATAAAAATGAAATGTAGGCCGG + Intergenic
1179743723 21:43431911-43431933 GATGACAGGGAAAGGGAGGCAGG + Intergenic
1180296687 22:10944532-10944554 GGGAAAGAGGAAAAGGAGGTGGG + Intergenic
1180647797 22:17353933-17353955 GTGAAAAAGGAAAAGGATGGGGG - Intergenic
1180663796 22:17493266-17493288 TATTTAAAGGAAAAAGAGGCCGG - Intronic
1180674196 22:17576055-17576077 GAAAAGAAGGTAGAGGAGGCCGG + Intronic
1180680519 22:17623052-17623074 GAAAAAAAAGAAAAGTAGGGTGG - Intronic
1181143246 22:20823208-20823230 TATAAAATGGAAAAAGTGGCTGG - Intronic
1181225900 22:21390592-21390614 AAAAAAACGGAAAAGAAGGCCGG - Intergenic
1181252733 22:21544221-21544243 AAAAAAACGGAAAAGAAGGCCGG + Intergenic
1181294387 22:21823803-21823825 TGTAAAAAGGAAAAAGTGGCTGG + Intronic
1181387259 22:22555532-22555554 TCTAAAAAAGAAAAAGAGGCTGG - Intronic
1181469662 22:23130157-23130179 AAGAAAAAGAAAAAGAAGGCCGG + Intronic
1181529575 22:23509545-23509567 GTTCAAAGGGAAAAGCAGGCTGG + Intergenic
1181569667 22:23761442-23761464 GGAAAAAAGGGAAAGGAGGGAGG + Intergenic
1181662333 22:24361404-24361426 AATAAAAAATAAAAAGAGGCTGG + Intronic
1181704482 22:24641112-24641134 AAAAAAAAAAAAAAGGAGGCTGG - Intergenic
1181879731 22:25968604-25968626 CAAAGAAAGGAAATGGAGGCCGG + Intronic
1181969490 22:26679514-26679536 GAAAAAAAAGAAAAGAAGGAAGG - Intergenic
1182143325 22:27981170-27981192 AATAAAAGGGAACAGGAGCCTGG + Exonic
1182185833 22:28401171-28401193 GAGGAGAAGGAAAAGGAGGGGGG + Intronic
1182545408 22:31072756-31072778 TAAAAAAAAGAAAAAGAGGCTGG - Intronic
1182672772 22:32011139-32011161 ACTAAAAAGAAAAAGAAGGCTGG + Intergenic
1182745352 22:32601571-32601593 TAAAAAATGGCAAAGGAGGCTGG - Intronic
1182924667 22:34110990-34111012 AAAAAAAAGGAAATGGAGGAGGG + Intergenic
1182961217 22:34477045-34477067 GATAAGGAGGAAGAGGAGGTGGG - Intergenic
1183164881 22:36140077-36140099 GAAGAAAAATAAAAGGAGGCTGG - Intergenic
1183257335 22:36770968-36770990 AAGAAAAAGGAGAAGCAGGCGGG - Intronic
1183312203 22:37116442-37116464 CATAAAAAGGATAAGGAGTCTGG + Intergenic
1183312607 22:37118967-37118989 GGGAAAAAGGAAAAGGAGAAAGG - Intergenic
1183389003 22:37533135-37533157 AAGAAAAAAGAAAAGAAGGCGGG + Intergenic
1183538078 22:38414649-38414671 GATAAAAAACAAAGGCAGGCCGG - Intergenic
1183567626 22:38627269-38627291 TATAAAATGGAAAGGGAGGCCGG + Intronic
1183615021 22:38938765-38938787 GATGAAAGTGAACAGGAGGCAGG + Intergenic
1183691707 22:39393563-39393585 TAAAGAAAAGAAAAGGAGGCTGG - Intergenic
1183853408 22:40611233-40611255 AATAAAAAGTAAAAATAGGCTGG - Intronic
1183887552 22:40897322-40897344 GATGAAAAGATGAAGGAGGCCGG - Intronic
1184125208 22:42481910-42481932 GAAAAAAAGAAAAAAGAGACAGG + Intergenic
1184137885 22:42560109-42560131 GATAAAAAGGAGAGGAGGGCCGG - Intronic
1184234679 22:43176746-43176768 AAAAAAAAGGAAAAGAAGGAGGG + Intronic
1184376369 22:44116386-44116408 GATAGAAAGGAAAATAAAGCTGG - Intronic
1184794679 22:46725025-46725047 AAAAAAAAGAAAAAGAAGGCTGG + Intronic
1184883682 22:47328828-47328850 GAGAAAAAGGAAAAGGAAAGAGG - Intergenic
1185191475 22:49439416-49439438 GATACAAAGGAAACATAGGCCGG - Intronic
1185304942 22:50109852-50109874 AAGAGAAAGGAAAAGGAGGCTGG + Intronic
1185311813 22:50160227-50160249 GAAAAAAAGAAACAGGAGGTGGG - Intronic
1185371129 22:50461433-50461455 GAGAAAAGGGAGAGGGAGGCAGG + Intronic
950071779 3:10158444-10158466 AAAAAAAAAGAAAAGGAGGCCGG - Intergenic
950082064 3:10229802-10229824 TAAAAAAATGAAAAAGAGGCCGG + Intronic
950175948 3:10874485-10874507 ATTAAAAAGGAAAAGGAAGCAGG - Intronic
950231105 3:11276616-11276638 GATAAGAAGGAAAAGTGGTCAGG - Intronic
950283318 3:11725246-11725268 GAAGAAAAGGAGAAGGAGGAGGG - Intergenic
950315156 3:11995562-11995584 TAAAAAAAAGAAAAGGAGGAAGG - Intergenic
950403923 3:12792763-12792785 AAGAAAAAAGAAAAAGAGGCTGG - Intergenic
950769506 3:15300488-15300510 TATAAAAAGGAAGCGGGGGCGGG + Intronic
951073925 3:18366293-18366315 AATACAAAGGAAAAGGAAGCAGG - Intronic
951395068 3:22154699-22154721 GTTAAAAATTAAAAGGAGGTGGG - Intronic
951409318 3:22343115-22343137 TTTAAAAAGTAAAAAGAGGCAGG - Intronic
951703197 3:25516921-25516943 AATAAAAGGGACAAGGAAGCTGG - Intronic
951897862 3:27627539-27627561 TATTAAAAGAAAAAGGAGGCCGG + Intergenic
951925770 3:27907547-27907569 GACAAAAATAAAAATGAGGCTGG + Intergenic
952146351 3:30536925-30536947 AATAAAAAGGGAAAAGAGGAGGG + Intergenic
952198133 3:31097461-31097483 GGGAAAAAGGAAAAGTAGGAAGG + Intergenic
952303047 3:32121245-32121267 GAAAAGAAGGAAGAGGAGACAGG - Intronic
952395248 3:32915334-32915356 AATAAAAATGAGAAAGAGGCCGG - Intergenic
952413765 3:33072297-33072319 CTTAAAAAGGAAAAGGATGGGGG - Intronic
952426750 3:33183088-33183110 GATAAAAAGTAAAGGGAGCTGGG - Intronic
952432611 3:33238611-33238633 GATAAAAAGAAGAAGGTGGCCGG + Intergenic
952948472 3:38497525-38497547 GATTATAAGGAAAAGGAGAGCGG - Intronic
953303073 3:41798641-41798663 GCTAAAAGGGAAAAGTGGGCCGG + Intronic
953335699 3:42092089-42092111 GACAAAAAAGAAAGGGAGGGTGG - Intronic
953573354 3:44091859-44091881 GCAATAAAGAAAAAGGAGGCAGG - Intergenic
953708701 3:45251239-45251261 TTTAAAAAGCAAAAGGAAGCAGG + Intergenic
953833220 3:46320949-46320971 TAAAAAATGGCAAAGGAGGCCGG + Intergenic
954101361 3:48375141-48375163 GATAAAAAGGAAAAGCAAGTTGG + Intronic
954165685 3:48755766-48755788 AAAAAAAAGGAAATGGGGGCTGG - Intronic
954170586 3:48798955-48798977 GTTCAAAAGAAAAGGGAGGCTGG - Intronic
954342792 3:49968962-49968984 GAAAAAAAAAAAAAGCAGGCCGG - Intronic
954349757 3:50033302-50033324 GAAAAAAAAGAAAAAGAGACGGG + Intronic
954651475 3:52166674-52166696 TTTTAAAAAGAAAAGGAGGCCGG + Intergenic
954694658 3:52415533-52415555 GATTGACTGGAAAAGGAGGCAGG - Intronic
954695374 3:52421863-52421885 GATAAGAAGGAAGGGGAGGAGGG + Intronic
954778061 3:53037675-53037697 GATAAAAATGAAAACCAGGCTGG + Intronic
954788836 3:53115537-53115559 GAGAGAAAGGAAAAGGTGGCGGG - Intronic
954805745 3:53219242-53219264 AATAAAAAATAAAAGCAGGCGGG + Intergenic
954816077 3:53281734-53281756 GATAAGATGGAAAAGGTGGCTGG - Intergenic
954823242 3:53349196-53349218 GTTAAAAAGGTCATGGAGGCTGG + Intergenic
955035754 3:55265702-55265724 GATGCCCAGGAAAAGGAGGCTGG + Intergenic
955090259 3:55743498-55743520 GATAAAAAGGCAATGAAGGATGG + Intronic
955307450 3:57848549-57848571 AAGAAAAAGGAGAAGGAGGGAGG - Intronic
955323948 3:57995337-57995359 GGTAAAAAGTAAAAGTTGGCCGG + Intergenic
955378945 3:58421581-58421603 GAAAAAAAGGAACTGGAGGGAGG + Intronic
955609460 3:60741676-60741698 GATAAGAAGGAGAAGGAGAAAGG - Intronic
955756299 3:62228224-62228246 AAAACAAAGAAAAAGGAGGCTGG + Intronic
955905930 3:63807558-63807580 GAGAAAAAGCAAAAGTTGGCTGG + Intergenic
956058224 3:65323000-65323022 TAGAAAAAGAAAAAGGAGGCCGG - Intergenic
956426208 3:69138383-69138405 GATAACAAAGTAAATGAGGCAGG - Intergenic
956628343 3:71289333-71289355 GATAAAAAACAAAATTAGGCTGG - Intronic
956720429 3:72112829-72112851 GAACAAAAAGAAAAGGAGTCTGG - Intergenic
956855901 3:73274413-73274435 TATAAAAAGAAACAGCAGGCTGG - Intergenic
956927303 3:74003183-74003205 GATAAAAAGAAAAAGTGGGCCGG - Intergenic
957328501 3:78728208-78728230 GAGGAGAAGGAAAAGGAGGAAGG + Intronic
957701325 3:83718008-83718030 GAGAAAAAAGAAAGGGAGGGAGG + Intergenic
957720206 3:83985546-83985568 AATAAAAAGTGAAAAGAGGCTGG - Intergenic
957775613 3:84754593-84754615 CTTAAAAAGGAAGAAGAGGCGGG - Intergenic
958041472 3:88231153-88231175 ATTAAAAAAGAAAGGGAGGCTGG + Intergenic
959069431 3:101688587-101688609 AAAAAAAAAAAAAAGGAGGCCGG + Intergenic
959498989 3:107083920-107083942 GATAAGTGGGAAAAGGAGGAAGG + Intergenic
959932087 3:111996172-111996194 CATAGAAAGAAAAATGAGGCTGG - Intergenic
960125184 3:113990803-113990825 AAAAAAAAGGAAATGCAGGCTGG + Intronic
960164286 3:114384292-114384314 GGGAAAAAGGAAAAGGGGGCTGG + Intronic
960338337 3:116445530-116445552 GAGAAACAGGAAAGGGAGGAGGG - Exonic
960496369 3:118380345-118380367 TAGAAAAAGGAAAAGGAAGGGGG + Intergenic
960833313 3:121875225-121875247 GATAAATAATAAAAGGAGACTGG + Intronic
961112349 3:124295835-124295857 GACAAGAAGGAAAAGAAGACAGG - Intronic
961299063 3:125910333-125910355 AAAAAAAAGGAAAAGAAGGGAGG + Intergenic
961339276 3:126206316-126206338 GATAAAATGGCAAAGTAGGATGG - Intergenic
961951364 3:130752708-130752730 TTTAAAAAGTAAAAAGAGGCCGG - Intergenic
961984036 3:131113614-131113636 GAAAAAAAGAAAAAGCAGGCCGG + Intronic
962039035 3:131685485-131685507 ATTAAGAAGTAAAAGGAGGCTGG + Intronic
962127783 3:132640382-132640404 TATTAAAATGAAAAGTAGGCTGG - Intronic
962231047 3:133665646-133665668 TATAGAATGGAAAAGGAGGCCGG + Intergenic
962375660 3:134856909-134856931 GTAAAAAAGGAAAAGAAGGAAGG + Intronic
962487381 3:135857788-135857810 GAAAAAGAGGGAAAGGAGGCAGG - Intergenic
962659799 3:137589826-137589848 GATAAAAACAGACAGGAGGCTGG - Intergenic
962694059 3:137930245-137930267 GAAAGAAAGAAAAAGGAGGGAGG + Intergenic
962800408 3:138885437-138885459 GAAAAAAAAGAAAAACAGGCTGG - Intergenic
962952186 3:140229486-140229508 GAGAAAAAGGAAAAGGAGGGTGG - Intronic
963235213 3:142948813-142948835 GCTTAAAAGGAAAAGCTGGCCGG - Intergenic
964046897 3:152339465-152339487 GAAAAAAAAGAAAAGGAAGGGGG - Intronic
964052421 3:152411790-152411812 GAAAAAAAGGAAACAGAAGCAGG - Intronic
964236002 3:154528592-154528614 AAGAAAAAGGAAAAGGAGGAAGG - Intergenic
964351932 3:155811713-155811735 TAAGAAAAGGAAAAGAAGGCCGG + Intergenic
964367812 3:155968439-155968461 GAACAAAAGGAGAAGGAGGTTGG + Intergenic
964374545 3:156036088-156036110 GATAAGAAGGAAAACAAGGCTGG - Intergenic
964496157 3:157292685-157292707 TAAAAAAAGAAAAAAGAGGCCGG + Intronic
964592725 3:158383458-158383480 GATCTTAAAGAAAAGGAGGCAGG + Intronic
964717886 3:159741932-159741954 GTCAAAAAGAAAAAGGAGGCTGG + Intronic
964791505 3:160457332-160457354 TATAGAAAAAAAAAGGAGGCCGG + Intronic
964878403 3:161395789-161395811 GAAAACAAGGAGAAGGAGCCAGG + Intergenic
965073498 3:163946662-163946684 TATTAAAAGGAAAAATAGGCTGG + Intergenic
965147508 3:164925455-164925477 GATAAAAACAAAAATGTGGCTGG - Intergenic
965397868 3:168182254-168182276 GAAAAGAAGTAAAGGGAGGCAGG - Intergenic
965553313 3:169992809-169992831 GAGAAAAAGGAAGATGAGGAGGG + Exonic
965645273 3:170873638-170873660 GAAAAACAGCAAAAGGAGACCGG + Intergenic
965850738 3:173019997-173020019 AAAAAAAAGGAACTGGAGGCTGG + Intronic
965888099 3:173474129-173474151 AAGGAAAAGGAAAAGGAGGAGGG - Intronic
965953185 3:174335506-174335528 AATAAACAGGGAAAGGAGGGAGG - Intergenic
966238973 3:177733913-177733935 GATACAAAGTGAAAGGAGGTTGG - Intergenic
966241714 3:177761631-177761653 GATAAAAAGATAAATAAGGCTGG + Intergenic
966242918 3:177774738-177774760 GAAAAAAAGGAAAGGAAGGAAGG - Intergenic
966346010 3:178980911-178980933 GATAAAAACCAAAAGCAAGCAGG - Intergenic
966351714 3:179038415-179038437 TAAAAAAAGAAAAATGAGGCAGG + Intronic
966428064 3:179802236-179802258 AAGAAAAAAGAAAAGCAGGCTGG + Intronic
967122626 3:186396828-186396850 TCTAAAAAGGAAATAGAGGCCGG + Intergenic
967180832 3:186902463-186902485 TAAAAAAAAAAAAAGGAGGCTGG + Intergenic
967216310 3:187213387-187213409 GATAATAAGGAAAAAGAACCAGG - Intergenic
967373108 3:188771250-188771272 TTTAAAAAGAAAAAAGAGGCCGG + Intronic
967401673 3:189069808-189069830 AATACAAAGGAAAAACAGGCTGG + Intronic
967599200 3:191364361-191364383 GAAAAAAAAAAAAAGGAGGCCGG - Intronic
967654261 3:192027478-192027500 GACAGAAAGGCAAAGGGGGCTGG - Intergenic
967664799 3:192158294-192158316 GAGAAAAGGGAAAAGCAGGCAGG - Intronic
968041419 3:195592257-195592279 GAGAGAAAGGAGAAGGAGGGAGG + Intergenic
968193926 3:196691387-196691409 GATAAAAAGAATAAGGAGGTGGG - Intronic
968198866 3:196734754-196734776 GATAAAATGTAAAAGGAGAATGG - Intronic
968248326 3:197178669-197178691 ACTATAAAGGAAAATGAGGCTGG + Intronic
968368418 3:198205373-198205395 TACAAAAAAGAAATGGAGGCCGG - Intergenic
968692096 4:1996951-1996973 AAAAAAAAAGAAAAGTAGGCAGG + Intronic
968738764 4:2316152-2316174 GAAAAAAAGGAAAGGAAGGAAGG - Intronic
968791649 4:2668757-2668779 GAAAAGAAAGAAAAGAAGGCAGG - Intronic
969028125 4:4190819-4190841 GATGAAATGGCAAAGGAGACTGG - Intronic
969240397 4:5893177-5893199 GCTACAAAGGACCAGGAGGCGGG + Intergenic
969243039 4:5914149-5914171 GATAAAAAAGAATATGAGCCAGG + Intronic
970166840 4:13247537-13247559 GAGAAAAAGGGAAAGGAGAATGG - Intergenic
970260132 4:14215864-14215886 GATGATAAGGAAAATGAGGAAGG + Intergenic
970322188 4:14885862-14885884 GATCAAAGGGAGAAAGAGGCAGG + Intergenic
970417360 4:15872742-15872764 GATAGAAAGAAAAAGGGGGCCGG + Intergenic
970630173 4:17933529-17933551 GATAAAAAGGAAAATGGGAATGG - Intronic
970661572 4:18291566-18291588 GAGAAGAAGGAAAAGCAGCCAGG + Intergenic
970681376 4:18512349-18512371 GAGTAAAAGGAAAAAGAGGAGGG - Intergenic
970702903 4:18764061-18764083 TATAAAAAAGAAAACCAGGCTGG + Intergenic
971017775 4:22506254-22506276 GATGAAAAGCAAAATAAGGCCGG + Intronic
971063582 4:23001236-23001258 GAAAGAAAGGGAAAGGAGGAAGG + Intergenic
971145998 4:23976959-23976981 GAGGAAAAGGAAAAGGAAGAAGG + Intergenic
971187194 4:24390661-24390683 TATAAAAATGAAAAGCAAGCAGG - Intergenic
971218962 4:24687522-24687544 GGGAAAACGGAAAAGCAGGCGGG + Intergenic
971335787 4:25722933-25722955 GAGAAAAAGGAATAGGAGAAGGG + Intergenic
971527852 4:27643957-27643979 CATAAAAAGACACAGGAGGCCGG - Intergenic
971818016 4:31514955-31514977 GATAAAAATGACAAGGAGTTGGG + Intergenic
971894429 4:32573517-32573539 GAAAAAAGAGAAAAGGAGCCAGG - Intergenic
971962760 4:33510090-33510112 GATGAAAAAGAAAAGAAGACAGG - Intergenic
972182630 4:36487908-36487930 GGTAAATAAGAAAACGAGGCCGG + Intergenic
972469342 4:39388805-39388827 TATATAAAGAAAAAAGAGGCCGG + Intergenic
972526848 4:39922119-39922141 GATAAATAGAAAAAGGAAACAGG + Intronic
972610593 4:40652172-40652194 CACAAAAAGAAAAAAGAGGCCGG + Intergenic
972652191 4:41028908-41028930 TAGAAAAGGGAAAAGGAGGAGGG - Intronic
972720447 4:41691448-41691470 TATAAAATGGAACAGCAGGCTGG + Intronic
972887114 4:43506040-43506062 ATTAAAAAGTAAAACGAGGCCGG - Intergenic
972927071 4:44022812-44022834 GAGAAAAAGGAAGAGGATGAAGG - Intergenic
973230473 4:47835235-47835257 GACCAAATGGAAAATGAGGCTGG - Intronic
973276084 4:48310920-48310942 AATAATAGGGAAAAAGAGGCAGG + Intergenic
973715400 4:53670831-53670853 GAAAAAAGGGAAAGGGAGGAAGG - Intronic
973750069 4:54006800-54006822 GATAAAAAGAAAGAGGGTGCAGG + Intronic
973820735 4:54659298-54659320 GAAAAAAGGGAACGGGAGGCAGG - Intronic
973874291 4:55200494-55200516 GTTAACAAGGAAATGGAGGCAGG + Intergenic
973989109 4:56386495-56386517 CTTAAAAAGGAAAAAAAGGCCGG + Intronic
974087766 4:57279399-57279421 GATATAAAAGAACAGGAGGCAGG - Intergenic
974506669 4:62783058-62783080 CATTAAAAGGAAGATGAGGCAGG + Intergenic
974543030 4:63263731-63263753 GATTAAAAGAAAAAGGAGGAGGG + Intergenic
974921161 4:68240773-68240795 GAAACAAAGGAAAAGAAGCCAGG + Intronic
975408893 4:74024689-74024711 GATAACAATAAAAAGGGGGCTGG - Intergenic
975735549 4:77377431-77377453 GAAAAGAAGGACAAGGACGCTGG - Intronic
975773865 4:77761336-77761358 GAAAAAAAGAAAAAGGTGGGAGG + Intronic
975857572 4:78640970-78640992 GACAAAAAGGAAAGGGAGAGAGG - Intergenic
975992595 4:80273702-80273724 TTTAAAAAGGAAAAGAAGGAAGG - Intronic
976143258 4:82015283-82015305 GAAGAAAAGGAGAAGGAGGAGGG + Intronic
976199598 4:82564986-82565008 TATAAAAAGGAGTAAGAGGCCGG - Intergenic
976352065 4:84070867-84070889 GAGAGAAAAGAAAAGGATGCTGG + Intergenic
976386908 4:84470539-84470561 AATCTAAAGGCAAAGGAGGCTGG + Intergenic
976471757 4:85436910-85436932 GTTAAAAAAGAAAAAGAGGGTGG + Intergenic
976536065 4:86218910-86218932 GAGATAAGTGAAAAGGAGGCTGG + Intronic
977040190 4:92006599-92006621 GAAAAAAAAGAAAAGAAGGAAGG - Intergenic
977066932 4:92329965-92329987 GAGAAAAAGGAAGAGGAGTATGG + Intronic
977122353 4:93118703-93118725 GATAGAAAGGCAAATGAAGCTGG + Intronic
977148949 4:93484237-93484259 GAGGAAAAGGAAATGGGGGCTGG - Intronic
977530198 4:98192181-98192203 TATAAAAAGAAACAGGTGGCCGG - Intergenic
977551732 4:98450048-98450070 GAAAAAAAGGAAAAGGTGAAGGG - Intergenic
977705145 4:100062326-100062348 GAAAAAAAAGAAAGGGAGGTAGG - Intergenic
977728651 4:100325865-100325887 GAGAAAAGGAGAAAGGAGGCAGG + Intergenic
978310268 4:107379607-107379629 GAGAAAAAGAAAAATGAGGTGGG - Intergenic
978311403 4:107388126-107388148 GAGAAAAAGGAAAATGGGGTTGG - Intergenic
978527792 4:109683084-109683106 TCTAAAAAGGAAAGGGAGGTAGG - Intronic
978533617 4:109738406-109738428 GATAAAAAGAGAAAAGTGGCTGG - Intergenic
978614052 4:110575961-110575983 ACAAAAAAAGAAAAGGAGGCTGG + Intergenic
978637917 4:110832905-110832927 GAGAAGAAGAAAGAGGAGGCAGG + Intergenic
978844638 4:113258194-113258216 GAGAAAAAGGAAAGGGAGGAAGG - Intronic
978858321 4:113418646-113418668 GAGAAAAAGAAGAAGGAGGAGGG - Intergenic
979256843 4:118615096-118615118 TACAAAAAAGAAATGGAGGCCGG - Intergenic
979286329 4:118929115-118929137 GAGATAAAGGAAAAGTAGGAAGG + Intronic
979320820 4:119323401-119323423 ATTAAAAAAGAAAAAGAGGCCGG + Intergenic
979331506 4:119425449-119425471 TACAAAAAAGAAATGGAGGCCGG + Intergenic
979366047 4:119824782-119824804 TATAAAAATGAAAAAAAGGCTGG - Intergenic
979474646 4:121140766-121140788 AAAAAAAAGGAAAAGGGGGAGGG + Intronic
979746208 4:124216494-124216516 TTTAAATAGGAAAAGCAGGCTGG - Intergenic
980781132 4:137493810-137493832 GGTAAAAAGCAAAAGTTGGCGGG - Intergenic
980841061 4:138261916-138261938 GATAAGAAGAAACAGGAGGAGGG - Intergenic
980932183 4:139192524-139192546 GCTAAAAAGGGAGAGTAGGCCGG - Intergenic
981021181 4:140030527-140030549 GACAAAAAGGAAAAGGTGGGAGG - Intronic
981872439 4:149502928-149502950 GATTAAAAAAAAAAGTAGGCCGG + Intergenic
982055559 4:151545671-151545693 ACTAAGAAGGATAAGGAGGCTGG - Intronic
982217695 4:153096282-153096304 AATAAAAATAAAAAGGAGGAGGG + Intergenic
982890718 4:160846054-160846076 TATAACAAGCAAAAGGAGGTTGG - Intergenic
983019134 4:162653529-162653551 AAGAAAAAGGACAAGGAGGTTGG - Intergenic
983091521 4:163508611-163508633 GATCAAAAGAAAATGGAGGAAGG + Intronic
983302294 4:165942267-165942289 GAAAAAAAAAAAAAGGAGGGTGG - Intronic
983392609 4:167151771-167151793 GATAAAGAGAAAAAGAAGGGAGG + Intronic
983827823 4:172286412-172286434 GATAAATAGGATGAGGAGGGAGG + Intronic
984001429 4:174251457-174251479 GAGAAAAGGGAAAAGGAGGGTGG + Intronic
984283946 4:177706135-177706157 AAAAAAAAAGAAAAAGAGGCTGG + Intergenic
984587747 4:181582272-181582294 GAGAAAAAGAAAAAGGAGCAGGG + Intergenic
984730037 4:183059503-183059525 GTTAAAAAAGAAAAGCAGACCGG - Intergenic
984766857 4:183406476-183406498 TAAAAAAATAAAAAGGAGGCCGG + Intergenic
984829296 4:183956814-183956836 CATAAAATGCAAAAGGAGGTTGG - Intronic
984908780 4:184652849-184652871 AAGAAAAAAGAAAAGGAGGGAGG + Intronic
984949400 4:184995572-184995594 TATTAAAAGGAAAAAAAGGCCGG - Intergenic
985034370 4:185823175-185823197 CATAAAGGGGAAAAGGAGGCCGG - Intronic
985113813 4:186572021-186572043 GATAACAGTGAAAAAGAGGCTGG - Intergenic
985179336 4:187239571-187239593 AAAAAAAAGGAAAGGAAGGCAGG - Intergenic
985627643 5:998184-998206 GAGAAAGAGGAAAAGGGGGACGG + Intergenic
985958433 5:3281748-3281770 GGGAAGAAGGAAAAGGAAGCAGG + Intergenic
985993661 5:3584466-3584488 GAACAAAGGGAAAAGGAGGAAGG + Intergenic
986056644 5:4143821-4143843 CATAAAATGAAAAAGAAGGCCGG + Intergenic
986095124 5:4547134-4547156 GAAAAAAAAGAAAAGGAGAAAGG + Intergenic
986104919 5:4650623-4650645 TCTAAAAAGGAATAGGATGCTGG + Intergenic
986211595 5:5678730-5678752 GAGAGAAAGGAAAAGGATGAGGG + Intergenic
986248050 5:6029019-6029041 AACAAAAAGCAAAAGGAGGCTGG - Intergenic
986278658 5:6304545-6304567 GAGGAAAAGAAAAAGGAGACGGG + Intergenic
986566759 5:9123416-9123438 AAGAAGAAGGAAAAGGAGGAGGG + Intronic
987022442 5:13888501-13888523 GAGAAAAATGAAAAGGATGATGG - Intronic
987047919 5:14124828-14124850 AAAAAAATGGAGAAGGAGGCCGG + Intergenic
987133586 5:14881302-14881324 ATTAAAAAGGTAAAGCAGGCCGG + Intergenic
987552504 5:19402322-19402344 GAGAAAAATGAAAAGGATACTGG + Intergenic
987801369 5:22701034-22701056 TATAAACAGGAAAAGGAAGTGGG - Intronic
987815742 5:22899624-22899646 GATGAGAGAGAAAAGGAGGCAGG + Intergenic
988092940 5:26566806-26566828 AATAAAAAGGAAAAAGTGGAAGG + Intergenic
988961479 5:36375653-36375675 GTTAAAAAGAATTAGGAGGCCGG + Intergenic
989063642 5:37436160-37436182 GGTAAAGAGGAAAAGAAGCCTGG + Intronic
989077978 5:37585284-37585306 TAAAAAATGGACAAGGAGGCTGG - Intronic
989165598 5:38430951-38430973 AACAAAAAGGAAGAGGAGGGGGG - Intronic
989333504 5:40287744-40287766 GGTGAAAAGGGAAGGGAGGCAGG - Intergenic
989380328 5:40804056-40804078 AATAAAAAAGTAAAGAAGGCCGG + Intergenic
989607127 5:43255452-43255474 GATAAGAAAGAAAAGAGGGCCGG + Intronic
989705994 5:44331424-44331446 GAGAAAGAGGAAAAGGAAACTGG + Intronic
989791111 5:45402885-45402907 GAAAGAAAAGAAAAGGAGGGAGG - Intronic
989972325 5:50539921-50539943 GAAACAAAGGAAGAGAAGGCAGG + Intergenic
990066728 5:51725619-51725641 CATAGAAAGGAAAAGGACACTGG + Intergenic
990247200 5:53874698-53874720 GGTAACAAGGGCAAGGAGGCTGG + Intergenic
990428322 5:55710994-55711016 ATTAAAAAGAAAAAAGAGGCTGG + Intronic
990499898 5:56385711-56385733 GAGAAAGAGGAAAGGGAAGCAGG - Intergenic
991032665 5:62098991-62099013 GTAAAAGAGGAAAAGGAGGTTGG - Intergenic
991195756 5:63930236-63930258 GAGAAAAAGGAAAAGTTGGGGGG + Intergenic
991669965 5:69037800-69037822 GAGAAAAAGGAAAATGAGGCTGG + Intergenic
991704834 5:69348231-69348253 AAAAAAAAGAAAAAAGAGGCTGG - Intergenic
991845434 5:70858092-70858114 AATAAAAAAAAAAAGGAGCCAGG + Intergenic
992051623 5:72946493-72946515 TATAAAAATGTCAAGGAGGCCGG - Intergenic
992306743 5:75447768-75447790 AACAAAAAAAAAAAGGAGGCCGG - Intronic
992530027 5:77644841-77644863 GAGAAAAAGAGAAAGGAGGAAGG - Intergenic
992822344 5:80510071-80510093 GATAAAAAGCAATAGGTAGCTGG - Intronic
992948319 5:81831727-81831749 TATAAAAAAGAAAACAAGGCAGG + Intergenic
993337296 5:86676688-86676710 GTAAAAAATGAAGAGGAGGCTGG + Intergenic
993389245 5:87298111-87298133 GTAAAGAAGGAACAGGAGGCTGG + Intronic
993407458 5:87529297-87529319 AATCAAAAGGAAAAAAAGGCTGG + Intergenic
994678009 5:102849258-102849280 AGTAAAAAGAAAAAGGTGGCCGG + Intronic
994841784 5:104932946-104932968 GATAAAGATGAAAAGAAGACTGG - Intergenic
995313503 5:110739490-110739512 GATGAGAAGGAATAGGAGGCGGG - Intronic
995437488 5:112153227-112153249 AAAAAAAAAGAAAAAGAGGCCGG + Intronic
995442057 5:112203068-112203090 TTAAAAAAGGAAAAAGAGGCCGG + Intronic
995497035 5:112757435-112757457 CAAAAAAGGCAAAAGGAGGCTGG + Intronic
995506741 5:112868694-112868716 AATAAAAATGTAAAGAAGGCCGG - Exonic
995823162 5:116261615-116261637 GATAAAAAGAAAGAAGAGGCAGG - Intronic
995824922 5:116285371-116285393 GATAAAAAGGAAAGGGTGGCAGG - Intronic
995866744 5:116699809-116699831 CATAAAAATGAAAAGAAGCCAGG + Intergenic
995942685 5:117602901-117602923 TATAAAGATGAAAGGGAGGCTGG + Intergenic
996010942 5:118480795-118480817 GATAAAAAGCAAAAGTACACAGG + Intergenic
996058078 5:119002043-119002065 GATGTAATGGAAAAAGAGGCAGG - Intergenic
996113338 5:119591389-119591411 GTTAAAAAGCCAAATGAGGCCGG + Intronic
996229010 5:121038367-121038389 GGTAATAATGAAAAGGAGGAGGG + Intergenic
996406478 5:123110546-123110568 GAAAAAAAAAAAAAGTAGGCCGG - Intronic
996486141 5:124037149-124037171 GAAAAATAGGAAAAGGAAACTGG - Intergenic
996950714 5:129121833-129121855 AATAATGAGGAAAAGGAGGAGGG + Intergenic
996992013 5:129646182-129646204 TAAAAATTGGAAAAGGAGGCCGG - Intronic
997084266 5:130778491-130778513 TTTAAAAAGAAAAAGGAGGAAGG + Intergenic
997333410 5:133084764-133084786 AATAAAAAAGAATAGTAGGCTGG - Intronic
997533805 5:134600027-134600049 AAAAAAAAGAAAAAGAAGGCTGG + Intergenic
997553113 5:134770976-134770998 GATGAAAAAGAAAAAGATGCTGG + Exonic
997567132 5:134896937-134896959 AAAAAAAAGGAAAAAAAGGCTGG - Intronic
997571480 5:134931196-134931218 AAAAAAAAGAAAAAGAAGGCCGG - Intronic
997619530 5:135276564-135276586 GAAAAAAAGGAGGAGGAGGAAGG - Intronic
997703898 5:135929708-135929730 GAAAGAAAAGAAAATGAGGCCGG + Intronic
997787903 5:136730160-136730182 GATTAATAGGAAAAAGAGGTAGG + Intergenic
997816768 5:137026804-137026826 AACAAAAAGGAACAGCAGGCTGG + Intronic
997841048 5:137240350-137240372 GATAGAAAGCAAAGGGAAGCAGG + Intronic
997926525 5:138035305-138035327 TATAAAAACGCAAGGGAGGCCGG - Intronic
997977895 5:138450938-138450960 ATTAAAAAGGAAAAAAAGGCCGG - Intergenic
998304044 5:141055095-141055117 GAAAAAACGGAAATGGAGGGTGG + Intergenic
998562679 5:143186029-143186051 GCTCAGAAGGAAAAGGAGGGAGG + Intronic
998707966 5:144786019-144786041 CATAAAGAGGAAAAGGAGTAAGG - Intergenic
998755387 5:145372670-145372692 AATGAAAAGCAAAAGGAAGCAGG - Intergenic
998858597 5:146420782-146420804 AATAAAAAAGAGACGGAGGCTGG + Intergenic
998885335 5:146688087-146688109 GATCAAAAAGAAAAGGAAGCTGG + Intronic
999089308 5:148921372-148921394 GAGAAGGAGGAAAAGGAGGATGG + Intergenic
999592046 5:153158838-153158860 CAGGAAAAGGAAAAGCAGGCGGG - Intergenic
999928236 5:156403138-156403160 GACAGACAGGAAAAGGCGGCAGG - Intronic
1000073002 5:157758400-157758422 GATAATAAAGAAAAGGGGACCGG - Exonic
1000138006 5:158371740-158371762 GAGAAAGAGGAATGGGAGGCAGG + Intergenic
1000308695 5:160020179-160020201 GAAATGAAAGAAAAGGAGGCTGG - Intronic
1000482496 5:161796630-161796652 GAAAAAAAGGAAAATGAGTGTGG + Intergenic
1000636339 5:163647926-163647948 AAAAAAATGGAAAAGGAGGAAGG - Intergenic
1000640961 5:163700962-163700984 GACAAAGAAGAAAAGGAGGAAGG - Intergenic
1000731644 5:164842288-164842310 GAAAAAAAGAAAAAGGAGAAGGG - Intergenic
1000765530 5:165284753-165284775 AATGAAAAGAAAAATGAGGCTGG + Intergenic
1000835904 5:166153854-166153876 TAGAAAAAGGAAAATGAGGCTGG - Intergenic
1000899069 5:166891220-166891242 AATAAAAAGGAAAACGAGGCCGG + Intergenic
1001013212 5:168117263-168117285 GAAAAAAAAGAAAAGGGAGCAGG - Intronic
1001018469 5:168162736-168162758 GATAACAAGGATAATGAGGGAGG + Exonic
1001079410 5:168656112-168656134 AATAAAAAGGAGGAGGAGGGAGG - Intergenic
1001468664 5:171992131-171992153 AAAAAAAAAAAAAAGGAGGCCGG + Intronic
1002041168 5:176515376-176515398 AAAAAAAAGAAAAAGCAGGCCGG - Intergenic
1002155541 5:177275727-177275749 AATAATAAGAAAAGGGAGGCCGG - Intronic
1002414985 5:179115648-179115670 GGAAAAAAGGAAAGGGAGGGAGG + Intronic
1002606081 5:180383534-180383556 GATAGAAAGAGGAAGGAGGCCGG + Intergenic
1002727639 5:181310600-181310622 TACAAAAAAGAAATGGAGGCCGG - Intergenic
1003487836 6:6595178-6595200 GAAAAAGAGGAAAAGGAAGAGGG + Intronic
1003777885 6:9389882-9389904 GAGAAGATGAAAAAGGAGGCAGG + Intergenic
1004001514 6:11601045-11601067 TATAAAAAGGAAAGGTAGACGGG - Intergenic
1004251889 6:14029596-14029618 AAAAATAAGGAAAATGAGGCTGG + Intergenic
1004255235 6:14057729-14057751 GATAAAAAATAAATAGAGGCAGG + Intergenic
1004345256 6:14843378-14843400 GAAAGAAAGGAAAAGAAGGAAGG + Intergenic
1004402757 6:15304236-15304258 GAAAAGGAGCAAAAGGAGGCTGG - Intronic
1004404098 6:15316004-15316026 GATGAAAAAAAAAAGGAAGCAGG - Intronic
1004530206 6:16447518-16447540 GATAAAAAATAAAAATAGGCAGG - Intronic
1004547612 6:16613666-16613688 GTTAAAAAAGAAAAAGAGCCAGG + Intronic
1004569932 6:16835237-16835259 AAAAAAAAAGAAAAGGAGGCTGG - Intergenic
1004898993 6:20176918-20176940 AATAAAAATGAATAGTAGGCTGG - Intronic
1005045781 6:21640954-21640976 CAAAAAAAGGAAAAGATGGCCGG - Intergenic
1005061840 6:21783797-21783819 GCAAAAAAGGAGAAGGAGGAAGG - Intergenic
1005492601 6:26360512-26360534 GATAAAAAGTCCAAGGAGGCCGG - Intergenic
1005500463 6:26424813-26424835 GATAAAAATTAAAATGAGCCTGG + Intergenic
1005609602 6:27510977-27510999 AAAAAAAAGGAAAAGAAGCCTGG + Intergenic
1005716943 6:28558411-28558433 GAAAAAAGGTAAAAAGAGGCTGG - Intergenic
1006179149 6:32143559-32143581 AAGAAAAAAGAAAAAGAGGCTGG + Intergenic
1006590772 6:35154884-35154906 GTTAAAATGTAAAAGGAGGATGG - Intergenic
1006645059 6:35510050-35510072 AAAAAAAAGAAAAAGAAGGCAGG - Intronic
1007014872 6:38455464-38455486 TATAAAAGGCAAAATGAGGCTGG - Intronic
1007278171 6:40690859-40690881 GATTAAATGGAAAAGGAATCTGG + Intergenic
1007295852 6:40819971-40819993 GAAAAAAAGGGAAAGGAGTAGGG + Intergenic
1007671443 6:43557796-43557818 AAAAAAAAAAAAAAGGAGGCTGG + Intronic
1007770955 6:44192033-44192055 GATAAAGAGCAAGAAGAGGCCGG - Intergenic
1007993868 6:46285637-46285659 GAAATAAAGGAAAAGTAGGTAGG - Intronic
1008113059 6:47514753-47514775 GATTAAAAGTAAAACTAGGCTGG + Intronic
1008373795 6:50768307-50768329 GAGAAAAAAGAAAAGGAGAGAGG - Intronic
1008453291 6:51678406-51678428 CATAAAAGGCAAAAGGAGACTGG - Intronic
1008608903 6:53167715-53167737 AATAAAAAGTCAAAGGGGGCTGG + Intergenic
1008625170 6:53308714-53308736 GATAAAAATTAAAGGGTGGCAGG - Intronic
1008972708 6:57388278-57388300 GATAAAAAAGGAATGGAAGCGGG + Intronic
1010041671 6:71391907-71391929 GAGGAAGAGGAAAATGAGGCTGG - Intergenic
1010295037 6:74185640-74185662 AAGTAGAAGGAAAAGGAGGCAGG + Intergenic
1010386962 6:75291231-75291253 AATAACAGGGAAAAGGAGACAGG + Intergenic
1010679002 6:78777242-78777264 GAAAAATAGGAAGAGGAGGCTGG - Intergenic
1010907823 6:81514739-81514761 TTTAAAAAAGAAAAGTAGGCCGG + Intronic
1010927000 6:81755035-81755057 GAAGAAAAGGAAATGGAGGAAGG + Intergenic
1011085624 6:83537432-83537454 GAGAAAAAGAAAAGGGAGGGAGG - Intergenic
1011428201 6:87253636-87253658 ACTAAAAAGGAAAAGGAGCCTGG - Intronic
1011659032 6:89578278-89578300 AAAAAAAAAAAAAAGGAGGCGGG - Intronic
1011675742 6:89731805-89731827 GAGAAAAAGGAAAAGGTGGGGGG - Intronic
1011682884 6:89800129-89800151 AAAAAAAAGGAAAAACAGGCCGG + Intronic
1011964583 6:93138547-93138569 GATAGAAAGAAAAAGAAGCCAGG - Intergenic
1012246395 6:96930820-96930842 GGTCACAAGGAAAAGGAGGGAGG + Intronic
1012257976 6:97056072-97056094 AAAAAAAAGAAAAGGGAGGCTGG - Intronic
1012479760 6:99653497-99653519 GAGAAAAGAGAAAAGGAAGCAGG + Intergenic
1012809717 6:103941866-103941888 ACTAAAATGGGAAAGGAGGCAGG + Intergenic
1012912272 6:105131938-105131960 AATGACAAGGAAAAAGAGGCTGG - Intronic
1013005940 6:106073409-106073431 AATCAAAAGGAAATTGAGGCCGG - Intergenic
1013199706 6:107881504-107881526 AATAAAAAGCACAAGGAGGGAGG - Intronic
1013304685 6:108837511-108837533 GAGAAACAGAAAAAGGAGACAGG + Intergenic
1013325235 6:109039081-109039103 GAGGAAAAGGAGAAGGAGGGAGG + Intronic
1013477460 6:110522034-110522056 TTTAAAAGGGAACAGGAGGCCGG - Intergenic
1013793669 6:113860376-113860398 GAGAAAAAGGCCGAGGAGGCCGG + Exonic
1014026708 6:116656378-116656400 AACAAAAGTGAAAAGGAGGCTGG - Intronic
1014072015 6:117193232-117193254 GAGAAAAAGCAAAATGAGGTGGG - Intergenic
1014368016 6:120569182-120569204 GATATAAAGGAAAATGAAGATGG - Intergenic
1014423771 6:121276688-121276710 AATTAAAAGGAAAAGGATGGAGG + Intronic
1014740236 6:125140719-125140741 GAGAAAAAGGAGAGGGAGACAGG + Intronic
1014904706 6:127012023-127012045 AAGAAAAAGGGAAATGAGGCAGG - Intergenic
1014911245 6:127096155-127096177 GAGAAATAGGAAACTGAGGCAGG + Intergenic
1015006994 6:128295421-128295443 GCTAAGGAGGAAAAGGAGGATGG + Intronic
1015095642 6:129411934-129411956 AATAAAATGGAAAATGGGGCAGG + Intronic
1015141067 6:129932385-129932407 GAGAAAAAGAAAGAGGAGGGAGG + Intergenic
1015411209 6:132895754-132895776 GATTAAAAGGAGAAACAGGCTGG + Intergenic
1015435586 6:133182751-133182773 CAAAAGAAGGAAAAGAAGGCAGG - Intergenic
1015485420 6:133764546-133764568 GATAAAAAAGAAAGGAAGGAAGG + Intergenic
1015528568 6:134197527-134197549 CATAAAAAGCAAAAGTAGGCCGG + Intronic
1015567431 6:134588011-134588033 GAAAGAAAAGAAAAGGAGGGAGG + Intergenic
1015691504 6:135929584-135929606 TATAAAAAGGAAAAGAAAACAGG - Intronic
1015835756 6:137418499-137418521 GATAAGATTGAAAGGGAGGCAGG - Intergenic
1016180767 6:141145489-141145511 GAGAAAGTGGAAAGGGAGGCAGG - Intergenic
1016305293 6:142677823-142677845 CATAAAAAGGAGAGGCAGGCAGG - Intergenic
1016358367 6:143242097-143242119 GATAAAGAGGAAAAGCAGTAGGG + Intronic
1016385550 6:143527444-143527466 GATAAAAAAGAGGAAGAGGCAGG - Intergenic
1016958981 6:149653547-149653569 GAGAACAAGGAAAAGAAGGCTGG + Intergenic
1017041060 6:150309022-150309044 GAGAAAGAGGGAAGGGAGGCAGG + Intergenic
1017041836 6:150314319-150314341 GAGGAAGAGGAAAAGGAGGAGGG + Intergenic
1017529392 6:155273686-155273708 GGTAAAAGGGGAAAGGATGCGGG + Intronic
1017554034 6:155543849-155543871 AATAAAAAGGGAAAGGGGGAAGG + Intergenic
1017674021 6:156795329-156795351 GAGAATAAGGGAAGGGAGGCCGG + Intronic
1017726480 6:157279598-157279620 GAGAAAAAAGAAAAGAAGGAGGG + Intergenic
1017757920 6:157545378-157545400 AAAAAAAAGGAGGAGGAGGCCGG + Intronic
1017837165 6:158189063-158189085 GCAAAAAAGGAAAAGGTGGGTGG - Intronic
1018222347 6:161593600-161593622 CAGACAAAGGAAAAGGAGGCAGG + Intronic
1018772909 6:166987640-166987662 GTCAAAAGGGAAAAGAAGGCTGG + Intergenic
1018869341 6:167769284-167769306 GATAAAACAGAGAGGGAGGCTGG - Intergenic
1018897069 6:168027154-168027176 TAGAAAAAGGGAAAGGTGGCCGG + Intronic
1018999403 6:168736268-168736290 GATAAAAGGAAAAGGAAGGCAGG - Intergenic
1019339738 7:503381-503403 GCTAGAAAGGAAACGGAGGCCGG + Intronic
1019683508 7:2366711-2366733 GTTAAAAAGGCACAGGAGACAGG - Intronic
1019737882 7:2659480-2659502 GAAGAAAAAGAAAAGGAGGCAGG - Intronic
1019878291 7:3835492-3835514 GATAGAAAGTATACGGAGGCAGG - Intronic
1019945372 7:4324541-4324563 GAAGAAAAGGAGAAGGAGGATGG - Intergenic
1020043999 7:5026700-5026722 GAAAAAAAGGAAAAAAAGGGGGG - Intronic
1020108063 7:5431593-5431615 GATAAAAAGGAAAAAAAGGTGGG - Intronic
1020140534 7:5609142-5609164 AAAAAAAAGGAAAAAGAGGCCGG + Intergenic
1020205031 7:6107703-6107725 GAAAAAAAGAAAGAAGAGGCCGG - Intronic
1020423229 7:8034723-8034745 AAAAAGAAGGAAAAAGAGGCTGG + Intronic
1020572135 7:9877163-9877185 GATAAAATGGGCATGGAGGCGGG + Intergenic
1020598352 7:10241020-10241042 GATTAACAGGGAAAGGAGGAGGG - Intergenic
1020706674 7:11552619-11552641 GTTAAAAAGGAAAATGATGTGGG - Intronic
1020799646 7:12718038-12718060 GAGAAAAAGAAAAAAGCGGCTGG - Intergenic
1020820208 7:12957883-12957905 AAAAAAAAAAAAAAGGAGGCGGG - Intergenic
1020954893 7:14728694-14728716 AAAAAAAAAAAAAAGGAGGCTGG - Intronic
1021000792 7:15328092-15328114 AATAAAAAAGAAAAGAAGGAAGG - Intronic
1021204312 7:17761061-17761083 AATAAAAAGGAAAGAGAAGCAGG + Intergenic
1021337242 7:19419028-19419050 AATAAAAAGGCAGAGGAGGAAGG + Intergenic
1021352055 7:19605880-19605902 GAGAAAAATGAAAAGAAGGAGGG - Intergenic
1021547041 7:21825608-21825630 GGGAAAAAAAAAAAGGAGGCAGG - Intronic
1021768025 7:23968741-23968763 TTTAAAAGGGAAAAGCAGGCTGG - Intergenic
1021786175 7:24155033-24155055 AGAAAAAAGGAAAAGGATGCTGG - Intergenic
1021852967 7:24826537-24826559 GAGTAAGGGGAAAAGGAGGCAGG + Intronic
1022052175 7:26687013-26687035 GAAAAAAAGGAAGAGCAGCCTGG - Intronic
1022143223 7:27511722-27511744 TATAAAATGGAGAAGCAGGCTGG - Intergenic
1022344265 7:29499054-29499076 GATAAAAAGGCACAGTTGGCCGG - Intronic
1022381197 7:29861484-29861506 GAAAACAAAGGAAAGGAGGCAGG - Intronic
1022381344 7:29862826-29862848 GATAAAAAAAATAAGGAGGAAGG - Intronic
1022688684 7:32623119-32623141 GATAAAAATGGAAAGGAGGAAGG + Intergenic
1022845786 7:34208450-34208472 GAGAAGAAGGAAAAGAAGGTAGG - Intergenic
1022993678 7:35732479-35732501 TATCAAAAGGACAAGGAAGCAGG + Intergenic
1023013751 7:35945118-35945140 AAAAAAAAAAAAAAGGAGGCTGG + Intergenic
1023187543 7:37547871-37547893 AAAAAAAAGGAAGAGGAGGCAGG + Intergenic
1023552184 7:41382271-41382293 GAGAAAATGGAAAAGGAAGGAGG - Intergenic
1023597270 7:41844416-41844438 TTTAAAAGTGAAAAGGAGGCCGG - Intergenic
1023914735 7:44580648-44580670 GATAAAAAAGCAAAACAGGCAGG + Intronic
1024033375 7:45484112-45484134 AGGAAAGAGGAAAAGGAGGCAGG + Intergenic
1024077379 7:45828719-45828741 AAAAAAAAAAAAAAGGAGGCTGG - Intergenic
1024183429 7:46921839-46921861 GAAGAAAAGGAAAAGGAGGAAGG + Intergenic
1024637428 7:51301890-51301912 GATAAAATGTAAAATGTGGCTGG - Intronic
1024750476 7:52459542-52459564 GATAAAATGAAAAAGGAAGAGGG + Intergenic
1024771074 7:52723938-52723960 GTTAAAAGGAAAAAGAAGGCCGG - Intergenic
1024787668 7:52926931-52926953 GAAATAAAGGAAATGAAGGCAGG - Intergenic
1024841165 7:53589301-53589323 CATAAAAAGGCAAAGTAGACAGG - Intergenic
1025010871 7:55397163-55397185 TTTAAAAAGCAAAATGAGGCTGG + Intronic
1025064624 7:55842614-55842636 AAAAAAAAGAAAAAGAAGGCTGG + Intronic
1025127030 7:56352684-56352706 AAAAAAAAAAAAAAGGAGGCTGG + Intergenic
1025185424 7:56854342-56854364 TACAAAAAAGAAATGGAGGCCGG + Intergenic
1025602346 7:63012599-63012621 CAAAAAAAAAAAAAGGAGGCTGG + Intergenic
1025635596 7:63317261-63317283 AAAAAAAAAAAAAAGGAGGCGGG + Intergenic
1025638435 7:63345898-63345920 GATACAGAAGAAAAGGAGGAAGG - Intergenic
1025644261 7:63402191-63402213 GATACAGAAGAAAAGGAGGAAGG + Intergenic
1025647100 7:63430919-63430941 AAAAAAAAAAAAAAGGAGGCGGG - Intergenic
1025686508 7:63722618-63722640 TACAAAAAAGAAATGGAGGCCGG - Intergenic
1025713856 7:63935251-63935273 GATACAGAAGAAAAGGAGGAAGG + Intergenic
1025833528 7:65075293-65075315 TATAAAAGGGAAAGAGAGGCCGG + Intergenic
1025860622 7:65323727-65323749 TAAAAATAGGTAAAGGAGGCCGG - Intergenic
1025903288 7:65764802-65764824 TATAAAAGGGAAAGAGAGGCCGG + Intergenic
1025910197 7:65822232-65822254 TACAAAAAAGAAATGGAGGCTGG - Intergenic
1026211906 7:68313312-68313334 CATAAAATGGAAACTGAGGCAGG - Intergenic
1026217663 7:68364018-68364040 GAGAAAAAGAAGAAGGAGGAGGG - Intergenic
1026328998 7:69335886-69335908 GCTGAAAAGGAAAGTGAGGCTGG - Intergenic
1026716652 7:72795114-72795136 GATAAACAGAAGTAGGAGGCCGG - Intronic
1026809972 7:73455271-73455293 GAAAAAAAAGGAAAGAAGGCAGG + Intronic
1027167890 7:75848629-75848651 AATAAAAAATAAAAGAAGGCCGG - Intronic
1027186543 7:75974821-75974843 TAAAAAAAGAAAAAAGAGGCTGG - Intronic
1027470286 7:78565086-78565108 GAAAAGAAGGTCAAGGAGGCCGG - Intronic
1027512549 7:79101426-79101448 TAGAAAAAGGAAAATGGGGCCGG + Intronic
1027604615 7:80285351-80285373 GAGAAAAAGTAAGGGGAGGCAGG - Intergenic
1027664414 7:81026651-81026673 GATTATAAAGATAAGGAGGCAGG + Intergenic
1027738840 7:81973565-81973587 GAGGAGAAGGAAAAGGAGGGAGG + Intronic
1028052843 7:86206995-86207017 GAAAAAAAAGAAAAGAAGGAAGG + Intergenic
1028248028 7:88505995-88506017 GAAAAAAAGAAAATGGAGGTGGG - Intergenic
1028474362 7:91237473-91237495 GGCAAAAAGGAAAAGGCGGGAGG - Intergenic
1028625262 7:92870473-92870495 AAAAAAAAAAAAAAGGAGGCCGG + Intergenic
1028639344 7:93025939-93025961 GAAAAAAAGGAGAAGAAGGGTGG + Intergenic
1028837794 7:95394268-95394290 GACAATAAGGAAAGGGAGGGAGG + Intronic
1028848593 7:95511324-95511346 GAAAACAAAGAAAAGGGGGCTGG - Intronic
1028877425 7:95839325-95839347 AAGAAAAAGAGAAAGGAGGCTGG - Intronic
1028888468 7:95960522-95960544 GAAAACAAGAAAAAGAAGGCTGG - Intronic
1029065430 7:97843559-97843581 AAGACAAAGGAAAAGCAGGCAGG + Intergenic
1029180759 7:98700053-98700075 AAGAAAAAGAAAAAGGAGGGAGG + Intergenic
1029556273 7:101271852-101271874 GATAAAATGAAAAAGGATGAAGG - Intergenic
1029623564 7:101705641-101705663 GAGAAAGAGGAAGAGGAGGTGGG + Intergenic
1029747914 7:102526755-102526777 TATAAAGAGCAAAAGCAGGCAGG - Intergenic
1029765863 7:102625845-102625867 TATAAAGAGCAAAAGCAGGCAGG - Intronic
1029996160 7:105010528-105010550 AAAAACAAGGAAAAGGAGGTTGG + Intergenic
1030034652 7:105398373-105398395 AAAAAAAAAAAAAAGGAGGCTGG - Intronic
1030047176 7:105507976-105507998 GATCAAAAGGAATAGGATGAAGG - Intronic
1030074479 7:105724590-105724612 AAAAAAAAAAAAAAGGAGGCCGG + Intronic
1030085165 7:105809765-105809787 GAAAAAAAAAAAAAGGAGTCTGG - Intronic
1030096586 7:105906234-105906256 TATAAAAAGGAGACTGAGGCAGG + Intronic
1030344340 7:108415583-108415605 CATAAAAAGGAGAAGAAGGCCGG + Intronic
1030354960 7:108531611-108531633 AATAAAAAAGTAAAAGAGGCCGG - Intronic
1030540240 7:110821614-110821636 TAGAAAAAGGAAAGGTAGGCTGG + Intronic
1030815268 7:114028430-114028452 GTTAAAAATGAAAAGAATGCAGG + Intronic
1031059656 7:117036620-117036642 GTTAAAAAGAGAAAGGAAGCAGG + Intronic
1031562733 7:123257684-123257706 GATAAAACAGAAGAGGAGACAGG - Intergenic
1031729780 7:125285060-125285082 GAAAGGAAGGAAAAGAAGGCAGG + Intergenic
1031749394 7:125552639-125552661 AATAAAAAGTAACAGGAAGCTGG - Intergenic
1031793142 7:126135522-126135544 AATAAAATGGAAAAGAAGCCCGG + Intergenic
1032079411 7:128851204-128851226 GATACAGAGAAAAAGGGGGCTGG - Intronic
1032118903 7:129142191-129142213 TTTAAAAAGCAAAATGAGGCCGG - Intergenic
1032157606 7:129481869-129481891 GTTAAAAAACAAAAGTAGGCTGG + Intronic
1032235409 7:130117866-130117888 AAAAAAAAAGAAAAAGAGGCCGG + Intronic
1032337092 7:131035292-131035314 GAAAAGAAGGAAAAGAAGGAAGG + Intergenic
1032736903 7:134700961-134700983 GAAAGAAAGGAACATGAGGCCGG - Intergenic
1032845771 7:135750270-135750292 AAAAAAAAGTAAAAAGAGGCTGG + Intergenic
1032876071 7:136039613-136039635 TATAAAATGGAGAAGGAGGAAGG - Intergenic
1033005138 7:137552919-137552941 AAAAAAAAGGAAAAGAAAGCTGG + Intronic
1033060806 7:138105161-138105183 GAAAAAAAGTAAAAGAAGGATGG - Intronic
1033068526 7:138179994-138180016 GACAAGTAGGAGAAGGAGGCTGG - Intergenic
1033190938 7:139278473-139278495 AAAAAAAGGGAGAAGGAGGCTGG - Intronic
1033334196 7:140438371-140438393 AAAAAAAAAAAAAAGGAGGCCGG + Intergenic
1033798117 7:144871447-144871469 TATAAAAAGAGAAAGAAGGCTGG - Intergenic
1033938935 7:146626941-146626963 GAAATAAAGAAAAATGAGGCTGG - Intronic
1034077988 7:148250785-148250807 TATAATAAGTAAAATGAGGCCGG - Intronic
1034123572 7:148650899-148650921 GATCTTAAGAAAAAGGAGGCTGG + Intergenic
1034630666 7:152528181-152528203 GAAAGAATGGAAAGGGAGGCTGG + Intergenic
1034672082 7:152866666-152866688 GAGAAAAAGGGAAGGGAGGCCGG - Intergenic
1034687933 7:152989984-152990006 GAGAAAAAGGAAAAAGGGGTGGG - Intergenic
1035445692 7:158941583-158941605 GAAAAAAACAAAAAAGAGGCTGG + Intronic
1035761091 8:2069399-2069421 CAGAAAAGAGAAAAGGAGGCGGG - Intronic
1035862015 8:3039313-3039335 GAAAGAAAGGAAAAGAAGGAAGG - Intronic
1036158981 8:6368963-6368985 GGAAAAAAGGAAAAGGCTGCTGG - Intergenic
1036408534 8:8477494-8477516 TCTAAAAAGGAGAAGAAGGCAGG + Intergenic
1036441321 8:8783489-8783511 AATAAAAAGGAAAAGGGGTTTGG - Exonic
1036511328 8:9403089-9403111 CACAAAAAAGAAAAGCAGGCAGG + Intergenic
1036933056 8:12974737-12974759 CATGAAAAGGGACAGGAGGCGGG + Intronic
1037143403 8:15544669-15544691 GATAAAAGGGGAGAGGAGGGAGG + Intronic
1037483142 8:19323675-19323697 TAAAAAAATCAAAAGGAGGCCGG - Intronic
1037499481 8:19471353-19471375 GAAAAAAAAGAAAAGGAGGGAGG - Intronic
1037542461 8:19885586-19885608 GAAAAGAAGGAAAGGGAGGAGGG - Intergenic
1037548163 8:19943891-19943913 TATAAAAATAAAAAGTAGGCTGG + Intronic
1037844508 8:22271124-22271146 GTTAAAAAAAAAAAGGAGGCCGG - Intergenic
1038038962 8:23707890-23707912 GAAAGAAAGAAAAAGGAGGGAGG - Intergenic
1038364653 8:26918916-26918938 CAAAAAAAGGAAAGGCAGGCCGG + Intergenic
1038420816 8:27433121-27433143 GAGAAAATGGAAGAGGGGGCTGG - Intronic
1038452388 8:27648308-27648330 ATTAAAAACAAAAAGGAGGCAGG + Intronic
1038739920 8:30208151-30208173 GATAAGAAGGAAAGGAAGGAAGG + Intergenic
1039262585 8:35787987-35788009 AAGAAAAAAGAAAAGGAGGAAGG + Intronic
1039288584 8:36069345-36069367 GATGAATAGGAAAAGCAGGCTGG + Intergenic
1039436022 8:37559701-37559723 GAGGAGAAGGAAAAGGAGGAGGG + Intergenic
1039457194 8:37715381-37715403 GAAAAGAAGGAAAAGAAGGAAGG + Intergenic
1039532128 8:38272199-38272221 GCTAAAAAAGTAATGGAGGCAGG - Exonic
1040279398 8:46030991-46031013 GAGAAAAAGGAAAAAGAAGGGGG + Intergenic
1040365274 8:46709008-46709030 AAGACAAAGGAAAAGCAGGCAGG - Intergenic
1040491058 8:47922604-47922626 CTTAAAAATGAAAAGCAGGCTGG - Intronic
1040506815 8:48056561-48056583 CAAAAAAAGGAAAAGGAGACAGG + Intronic
1040513360 8:48114920-48114942 AAAAAAAAAAAAAAGGAGGCGGG - Intergenic
1040747269 8:50660441-50660463 GAGAAAAAAGAAAGGGAGGAAGG + Intronic
1040773174 8:51004327-51004349 GATAAAAAAGATAAAGAGGCAGG + Intergenic
1040837134 8:51744369-51744391 GAGAAAAAAGAAAGGAAGGCTGG + Intronic
1041102756 8:54413032-54413054 GAAAAAAAGGAAAACCAGGTAGG + Intergenic
1041311173 8:56518108-56518130 CAGAAAAAGAAAATGGAGGCCGG - Intergenic
1041411749 8:57563854-57563876 GATGAGAAGGAAGAGGAGGCAGG - Intergenic
1041537223 8:58940370-58940392 GATAAAATAGAAAGGGAGGGAGG + Intronic
1041720526 8:60971373-60971395 ATTAAAAAGGAAAAGTAGGCCGG - Intergenic
1042104976 8:65316440-65316462 GATGAGAAGGAAAGGAAGGCAGG + Intergenic
1042130474 8:65582718-65582740 GAGGAGAAGGAGAAGGAGGCAGG + Intergenic
1042215111 8:66423424-66423446 GAAAGAAAGAAAAAGGAGGGGGG - Intergenic
1042510351 8:69604720-69604742 GGTAAAAAAAAAAAGGGGGCAGG + Intronic
1042605149 8:70538267-70538289 GAAAAAAAGAAAAAGAAGGAAGG - Intergenic
1042688253 8:71465324-71465346 GGTTAAAAGGAAGAAGAGGCCGG + Intronic
1043048168 8:75353208-75353230 TACAAAAAGCAAAGGGAGGCCGG + Intergenic
1043225706 8:77727671-77727693 GGTAAAAAGAGAAAGGAGGAAGG - Intergenic
1043287844 8:78557552-78557574 GAAAAAAAGGAAAAAGAGAAAGG + Intronic
1043336957 8:79187830-79187852 GAGAAAAAGGAAATGAAGGAAGG + Intergenic
1043544490 8:81300230-81300252 TATAATAAGGAAGGGGAGGCTGG + Intergenic
1043597814 8:81904442-81904464 GATGTAAAGCAAAAGGAAGCAGG - Intergenic
1043609498 8:82044982-82045004 GCTAAAAGGGAGAAGGAGGGAGG + Intergenic
1044395891 8:91711392-91711414 GAGGAAGAGGAAAAGGAGGAAGG + Intergenic
1044585386 8:93864919-93864941 AAAAAAAAAAAAAAGGAGGCTGG - Intronic
1044662688 8:94606799-94606821 ATTAAAAAGAAAAAAGAGGCCGG + Intergenic
1045105975 8:98893089-98893111 GATAAAAAGAAAATAGCGGCTGG + Intronic
1045321671 8:101086478-101086500 GATAGAAAGGAAAAGCATGTAGG + Intergenic
1045415483 8:101962486-101962508 GAGAAAAGGGTAAAGGAAGCAGG - Intronic
1045743448 8:105388317-105388339 GAGAAAAGGGAAAAGGAGATGGG + Intronic
1045865468 8:106860517-106860539 AATAAAAAAGAGAAGGAGGCCGG + Intergenic
1046015552 8:108600335-108600357 GTTAAAAAGGAAAAGCAAACAGG + Intergenic
1046157098 8:110306214-110306236 GAGACAAAGGAAAAGGAAGAAGG - Intergenic
1046168256 8:110469128-110469150 GATTAAAAGGAAAATGAGACAGG - Intergenic
1046695596 8:117335940-117335962 GCTAGAAAGGAAAAGGAAGAAGG - Intergenic
1046766824 8:118078492-118078514 TTTAAAAAGGAAAAGTTGGCTGG - Intronic
1046906843 8:119582608-119582630 GAAAATTAAGAAAAGGAGGCAGG + Intronic
1046945308 8:119968860-119968882 GAGAAAAAGTAAGATGAGGCTGG + Intronic
1047106045 8:121731387-121731409 GATAGAAAGTGAAAGGATGCTGG + Intergenic
1047335828 8:123935188-123935210 AATAAAAAGGGAAAGGGGGTTGG - Intronic
1047427876 8:124763236-124763258 GAGAAAAAGGAAAAAAAGGTGGG - Intergenic
1047445771 8:124918026-124918048 GAAGAACAGGAAAAGGAGGTGGG + Intergenic
1047458784 8:125041640-125041662 AAAAAAAAAGAAAAGGAGGGTGG + Intronic
1047492731 8:125387816-125387838 AAAAAAAAGGAAATGTAGGCTGG + Intergenic
1047739801 8:127797322-127797344 AATAAAAAGCAAAACAAGGCCGG - Intergenic
1047770397 8:128025943-128025965 GAAAAAAAAAAAAAGGAGGCTGG - Intergenic
1047806067 8:128361175-128361197 GAAAGAAAAGAAAAGGAGGGAGG - Intergenic
1047818836 8:128495688-128495710 GATGAAAAAGAAATGGTGGCCGG - Intergenic
1047925419 8:129678175-129678197 GATAAAAAGATAAGGGGGGCAGG + Intergenic
1047964277 8:130034171-130034193 CATGAAAAGGAAAAACAGGCCGG + Intergenic
1048085819 8:131178332-131178354 TAAAAAAAGTAGAAGGAGGCTGG + Intergenic
1048363029 8:133714612-133714634 GAAAAAGAGGAAATGGATGCAGG - Intergenic
1048402304 8:134083361-134083383 AAAAAAAAGGAAGAGGAGGATGG - Intergenic
1048408078 8:134143112-134143134 GGAAGAAAGGAAAAGGAGGAAGG - Intergenic
1048413802 8:134203866-134203888 AATAAAAAGTGGAAGGAGGCTGG - Intergenic
1048439976 8:134452722-134452744 GGCAAAAAGGGAAAGGAAGCAGG + Intergenic
1048503917 8:135003765-135003787 GGTAAAAGGGAAACTGAGGCAGG + Intergenic
1048584931 8:135767060-135767082 GATAAAAATGCAGATGAGGCTGG - Intergenic
1048778939 8:137979993-137980015 GAAAAAAGAGAAAAAGAGGCCGG + Intergenic
1049491723 8:142907455-142907477 GGGAAAAAGGAAGAGGAGGGAGG - Intronic
1049623150 8:143608130-143608152 GAAAGAAAGGAAAAGGAAGAGGG + Intronic
1049893724 9:95068-95090 GATAGAAAGGAGAGGGAGGAGGG - Intergenic
1049981261 9:905736-905758 GATGAAATGGAATAGGAGACAGG - Intronic
1050083785 9:1942671-1942693 GATTGAAAGAAAAATGAGGCTGG + Intergenic
1050263551 9:3866462-3866484 AACAAAAAGTAAAGGGAGGCGGG + Intronic
1050481089 9:6087417-6087439 GAGAAAAAGGAAAAAGGGGTGGG - Intergenic
1050545309 9:6704374-6704396 GGTAGAAAGGCAAAGGGGGCCGG - Intergenic
1050814753 9:9796204-9796226 GAAGAAGAAGAAAAGGAGGCTGG + Intronic
1051133093 9:13884510-13884532 GAGAAAAAGAAAAATGAAGCAGG - Intergenic
1051306070 9:15710891-15710913 GATAAAAAGAGACAGAAGGCCGG - Intronic
1051312148 9:15787511-15787533 GAAAAAAAGGAAGAAGAGGAGGG - Intronic
1051427089 9:16943144-16943166 GATAAAAAGGTAAATAAGGGAGG - Intergenic
1051474493 9:17490093-17490115 TAGAAATAGGAAAAGTAGGCTGG + Intronic
1051534193 9:18138698-18138720 GATCAAAAGGAAAAAAAGGAGGG + Intergenic
1051638747 9:19204856-19204878 AATAAAAAAAATAAGGAGGCTGG - Intergenic
1051654326 9:19364020-19364042 GAAAAAAAGGATAATGTGGCTGG + Intronic
1052813544 9:33082625-33082647 GATAAAATGGGGAACGAGGCTGG - Intergenic
1052869946 9:33494973-33494995 TTTAGAAAGGTAAAGGAGGCTGG + Intergenic
1052869973 9:33495150-33495172 AAAAAAAAGGAAAAGAAGGGAGG + Intergenic
1053096552 9:35333545-35333567 GATGAAAGGGAGAAGGAGGAAGG - Intronic
1053148220 9:35726392-35726414 GGCAAAAATGAAAAGAAGGCAGG - Intronic
1053247388 9:36545782-36545804 TATAAAAAAGAATAGGCGGCCGG + Intergenic
1053734945 9:41095138-41095160 GATAGAAAGGAGAGGGAGGAGGG - Intergenic
1054693436 9:68336259-68336281 GATAGAAAGGAGAGGGAGGAGGG + Intronic
1054752672 9:68924116-68924138 AAAAAAAAAAAAAAGGAGGCCGG + Intronic
1055096111 9:72415796-72415818 AATAAAAAGGAAAGGAAGACAGG - Intergenic
1055327086 9:75142042-75142064 AATAAAGAACAAAAGGAGGCTGG - Intronic
1055431844 9:76251969-76251991 TATAAAAAGATAAAAGAGGCCGG + Intronic
1055687337 9:78790853-78790875 GTTGAAATGGAAAAGCAGGCTGG + Intergenic
1056031815 9:82561112-82561134 TGAAAAAAGCAAAAGGAGGCCGG + Intergenic
1056070063 9:82977015-82977037 AATAAAGTGTAAAAGGAGGCTGG + Intergenic
1056126491 9:83539715-83539737 GATCAACAGGGAGAGGAGGCAGG - Intergenic
1056645642 9:88409289-88409311 AAGAAAAAAGAAAAGCAGGCCGG - Intronic
1056648106 9:88432477-88432499 GAAAAAAAAAAAAAGGAGCCAGG - Intronic
1056739976 9:89246082-89246104 CATAAGAAGGCAAATGAGGCTGG + Intergenic
1056811626 9:89769475-89769497 AAAAAAAAAGAATAGGAGGCCGG - Intergenic
1056881100 9:90394640-90394662 GTTAAAAAATAAAAGCAGGCCGG - Intergenic
1057190100 9:93082610-93082632 AATAAAAAGGAAAGGGGGTCAGG - Intronic
1057364776 9:94409121-94409143 AAAAAAAAAAAAAAGGAGGCCGG - Intronic
1057658556 9:96978948-96978970 CTTAAAAAACAAAAGGAGGCCGG + Intronic
1057862292 9:98650560-98650582 GAAAAAAAAGAAAAGGAGGAGGG + Intronic
1058328516 9:103728191-103728213 GATAAAAAGGAAGAGTGGGAAGG - Intergenic
1058379009 9:104358464-104358486 TTTAGAAAGCAAAAGGAGGCCGG + Intergenic
1058411221 9:104734274-104734296 TATAAAAATAAAAAGGAGGCTGG - Intergenic
1058457206 9:105148668-105148690 GAAAGAAAGGAGGAGGAGGCAGG + Intergenic
1058541049 9:106013073-106013095 TTTAAAAAGGAAAAGCAGGCAGG - Intergenic
1058608231 9:106746473-106746495 GAAAAGAAGGAAAATGAAGCAGG + Intergenic
1058623788 9:106913125-106913147 GATGATGAGGAAAAGGAGGATGG + Intronic
1058738178 9:107915805-107915827 GAACAAAAGGCATAGGAGGCCGG - Intergenic
1058739146 9:107925063-107925085 AATAAAAAAGAAAACTAGGCTGG + Intergenic
1058754485 9:108071937-108071959 GCTGAAAAGGTAAAGGAAGCAGG + Intergenic
1058965165 9:110030712-110030734 AATAAAAAGGGCAAGGGGGCAGG - Intronic
1059003461 9:110375477-110375499 AAAAAAAAAAAAAAGGAGGCAGG + Intronic
1059014820 9:110504415-110504437 GAAGAAAAGGAGAAGGAAGCAGG - Intronic
1059067157 9:111097408-111097430 GTGAAGAAGGGAAAGGAGGCTGG - Intergenic
1059193999 9:112353539-112353561 GAAAAAAAGGAAAAGAGGCCAGG - Intergenic
1059350461 9:113660643-113660665 GATGAGATGGAAAAGGAGGTAGG + Intergenic
1060049108 9:120364537-120364559 GAGAAAAAGGAAAAGAAATCAGG + Intergenic
1060431689 9:123556270-123556292 GATAAAAAGGAGTAGGAGGGTGG + Intronic
1060499509 9:124142326-124142348 GCAAAAAAGGCAAAGTAGGCCGG + Intergenic
1060620613 9:125062452-125062474 AAAAAAAAAGAAAAGCAGGCTGG + Intronic
1060677107 9:125525375-125525397 TAGAAAAAGTAACAGGAGGCCGG + Intronic
1060698620 9:125731396-125731418 GAGAGAGAGGAAAAGGAAGCAGG - Intergenic
1060724214 9:125996609-125996631 CAAAAAAAGTAAAAAGAGGCTGG - Intergenic
1060751337 9:126171395-126171417 AAAAAAAAGAAAAAAGAGGCTGG - Intergenic
1060779866 9:126403432-126403454 GAGAAGAAGGAAAACGACGCAGG - Intronic
1060890818 9:127186979-127187001 GACAGACAGGAAAAGGAGTCAGG + Intronic
1061007953 9:127938803-127938825 AATTAAAAGGCACAGGAGGCTGG - Intergenic
1061166626 9:128926534-128926556 AAGAAAAAGAAAAAGGAAGCTGG - Intronic
1061192810 9:129091924-129091946 GTTAAAAAGGAAAAGCAAACTGG + Intergenic
1061259750 9:129473420-129473442 GAAAGAAAGAAAAAGGAGGAAGG + Intergenic
1061330827 9:129891161-129891183 AAAAAAAAGGAAACGGAGGTTGG + Intronic
1061728931 9:132598194-132598216 GGAACAAAGGAAAAGGAGACAGG - Intronic
1061841954 9:133363909-133363931 GATAAAAGCCAAAGGGAGGCAGG + Intronic
1062006574 9:134241353-134241375 GAAAAAAAAAAAAAAGAGGCAGG + Intergenic
1062655112 9:137600142-137600164 AATAAAAAAAAAAAGAAGGCCGG + Intergenic
1062752759 9:138268078-138268100 TACAAAAAAGAAATGGAGGCCGG - Intergenic
1203575277 Un_KI270745v1:2853-2875 TACAAAAAAGAAATGGAGGCCGG - Intergenic
1185499096 X:584157-584179 GAGAAAGAGAAAAAGGAGGAGGG + Intergenic
1185499122 X:584257-584279 GAGAAAGAGAAAAAGGAGGAGGG + Intergenic
1185499150 X:584357-584379 GAGAAAGAGAAAAAGGAGGAGGG + Intergenic
1185575471 X:1168957-1168979 GAGAAAGAGGAAGAGGAGGAGGG + Intergenic
1185611093 X:1394136-1394158 AAGAAAAAAGAAAAGGAGGCGGG - Intergenic
1185611105 X:1394206-1394228 AAGAAAAAGGAAAAGGAGGGAGG - Intergenic
1185834947 X:3336806-3336828 AATCAAAAGGAAAATAAGGCAGG + Intronic
1186178422 X:6949371-6949393 GAGGAAAAGGATAAGGAGGAGGG - Intergenic
1186205930 X:7200570-7200592 GATGAAACGGAAAGGGAGGAGGG + Intergenic
1186318529 X:8398005-8398027 AATAAAAATGAAAAGTAGGAGGG - Intergenic
1186788035 X:12971585-12971607 GAGAAGAAGGAAGAGGAGGGAGG - Intergenic
1186843124 X:13505225-13505247 GAAAGAAAAGAAAAGGAGGGTGG + Intergenic
1187107744 X:16261501-16261523 TCTAAAAAGGGAAAGGAGACAGG + Intergenic
1187122710 X:16424594-16424616 GGTGAAAATGAAAAGGAAGCAGG + Intergenic
1187244724 X:17543808-17543830 TATCAAAAGGAAAAAGAGGAGGG - Intronic
1187248892 X:17579474-17579496 GATAAAAAGGAGAGGGAGAGGGG - Intronic
1187272671 X:17792934-17792956 AATAAAAAGGCAAAGAAGGAAGG + Intergenic
1187308589 X:18119548-18119570 AAAAAAAAGGAAAAGACGGCAGG + Intergenic
1187344660 X:18451834-18451856 GATAAAATATAAAAGGGGGCCGG - Intronic
1187447672 X:19373147-19373169 GAGAGGAAGGAAAAGGAGGAAGG + Intronic
1187500911 X:19837735-19837757 ATAAAAAAGGAAAAGGTGGCTGG - Intronic
1187592064 X:20727804-20727826 TATAAAGAGGAAAAGAAAGCAGG + Intergenic
1187644916 X:21336541-21336563 TAAAAAAAGAAAAAGGAGACAGG + Intergenic
1187743231 X:22379315-22379337 TATAATATGGAAAGGGAGGCGGG - Intergenic
1187879804 X:23836293-23836315 GAAAAAAAGGAAATTAAGGCCGG - Intronic
1187984675 X:24797380-24797402 GAATAACAGGAAAAGGAGGATGG - Intronic
1188011497 X:25060934-25060956 TAAAAAAAGGAAAAGGAGCTGGG - Intergenic
1188036461 X:25322941-25322963 GAGAAAAAGGAGAAAGAGGAAGG - Intergenic
1188083584 X:25875834-25875856 GATTGACAGGAAAAGGAAGCTGG + Intergenic
1188269297 X:28118878-28118900 GGGAAGAAGGAAAAGGAGGAGGG - Intergenic
1188503466 X:30854857-30854879 GATAAACAGGTAAAGGACGCTGG + Exonic
1188559173 X:31448273-31448295 GATAAAAAGGAAAAGGAGGCAGG + Intronic
1188754965 X:33951295-33951317 GATAAAAAAGTAACGGAGGCTGG + Intergenic
1188937842 X:36199205-36199227 AATAAAAAGGAAAAGGAGAGAGG - Intergenic
1188955095 X:36424831-36424853 CATAAGAAGGAAAATGAGGTTGG + Intergenic
1189008383 X:37018950-37018972 GACAAGGAGGAAGAGGAGGCAGG - Intergenic
1189033631 X:37474466-37474488 GCAAACAAGGATAAGGAGGCTGG + Intronic
1189040344 X:37536060-37536082 GACAAGGAGGAAGAGGAGGCAGG + Intronic
1189306764 X:39992722-39992744 AATAAAAAACAAAAAGAGGCCGG + Intergenic
1189345086 X:40234740-40234762 AAAAAAAAGAAAAATGAGGCAGG - Intergenic
1189347468 X:40252887-40252909 CATAAACAGTGAAAGGAGGCCGG + Intergenic
1189593708 X:42542536-42542558 GAAAAAGAGGCAAAAGAGGCTGG + Intergenic
1189679399 X:43499633-43499655 GAAAAATGGGCAAAGGAGGCTGG - Intergenic
1189789349 X:44588639-44588661 AAAAAAAAGGAAAAGGAATCTGG - Intergenic
1189986103 X:46554653-46554675 TAGAAAATGGAAAAGGAGTCTGG + Intergenic
1190227547 X:48557811-48557833 AAAAAAAAGAAAAAAGAGGCTGG + Intronic
1190306460 X:49085576-49085598 CATAAAAAGAAGCAGGAGGCTGG + Intronic
1190490540 X:50978500-50978522 GACAAAAAGGAAAAAGGGGTGGG + Intergenic
1190743114 X:53303502-53303524 TGTAAAAAGTAAAAGTAGGCCGG + Intronic
1190813721 X:53909457-53909479 GAAAAAAAGAAAAAGAAGGAAGG + Intergenic
1190834975 X:54092245-54092267 GAAAAAAATGAAAAGAAGGCTGG + Intronic
1190841284 X:54147017-54147039 ATTAAAAAAGAAAAGCAGGCCGG + Intronic
1190884927 X:54522979-54523001 GATTAAAAAGAAAATAAGGCTGG - Intergenic
1191034297 X:56008374-56008396 GAGAATAAGGAAAAGCAGGGTGG + Intergenic
1191740284 X:64429746-64429768 TAAAACAAGGAAAAGGAAGCAGG + Intergenic
1191955437 X:66638663-66638685 GATAAAGAAGAGAAGGAGGCTGG - Intronic
1192160578 X:68783574-68783596 GAGAAAAAGAAAAAAGAAGCCGG + Intergenic
1192436443 X:71146103-71146125 AAGAAAAAGGAAGAGGAGGGAGG - Intronic
1193101293 X:77615810-77615832 GATCAAAAAAAAAAGGAGGATGG - Intronic
1193138524 X:78000278-78000300 ATTAAAAAAGAAAAGGAGGGAGG + Intronic
1193182930 X:78480045-78480067 GCTAATAAGGGAAAGGAGTCAGG - Intergenic
1193239584 X:79151669-79151691 GGTGAAAAGGAAAAGGAGGCGGG + Intergenic
1193254557 X:79331852-79331874 GAGAATAGGGAAAATGAGGCAGG - Intergenic
1193584828 X:83308028-83308050 GATAAAAAGGAGAAGTTGTCTGG + Intergenic
1193876728 X:86870279-86870301 GTTAAAAAGGAAAGGAAGGCTGG - Intergenic
1194268729 X:91783343-91783365 GACAAAAAGGCCAAGGAGCCAGG - Intronic
1194376911 X:93148194-93148216 GAAAAAAAGAAAATTGAGGCTGG + Intergenic
1194456843 X:94115249-94115271 TATAAAAAGAATAAGGCGGCTGG - Intergenic
1194661721 X:96635147-96635169 GTTAAAAATGAGAAGCAGGCAGG - Intergenic
1194857922 X:98956805-98956827 GATAAAAAGGAAGAGTGGGGAGG - Intergenic
1194940824 X:100008216-100008238 GATCAAAAGGAAATGGGGGTTGG - Intergenic
1194990668 X:100543596-100543618 GAAAAGAGGGAAAAGTAGGCCGG + Intergenic
1195043016 X:101031409-101031431 GAAAAAAAGCAAATAGAGGCTGG + Intronic
1195695563 X:107664363-107664385 CATCAAAAGGAAATGCAGGCGGG - Intergenic
1195700251 X:107699925-107699947 GATAGTAAGGAAACTGAGGCTGG - Intergenic
1195763259 X:108269934-108269956 GATAAAAAGAAAAAAGGAGCAGG + Intronic
1196085986 X:111682437-111682459 GATAAAAAGCTAATGGATGCTGG - Intronic
1196158246 X:112454389-112454411 TATTACAAGGAAAAGGAGGGAGG + Intergenic
1196206128 X:112942081-112942103 AACAAAAAGGAAAAGGAGGAAGG - Intergenic
1196281596 X:113829022-113829044 GAGAAAAAGGAAAAGAAAGAAGG + Intergenic
1196295648 X:113993895-113993917 GAAAAGAACGAAAAGGAGGGAGG - Intergenic
1196397987 X:115286554-115286576 GAAATAAAGAAAAGGGAGGCCGG - Intergenic
1196650641 X:118165137-118165159 AATTTAAAAGAAAAGGAGGCTGG + Intergenic
1196713271 X:118785864-118785886 AATTAAAAGTAAAAGAAGGCTGG - Intronic
1197198135 X:123724386-123724408 AATAAAAAGGCAATGGAAGCCGG + Intronic
1197257861 X:124283384-124283406 AAAAAAAGGGCAAAGGAGGCCGG - Intronic
1197385675 X:125798293-125798315 GTTAAAAAGTAAAAACAGGCTGG + Intergenic
1197793855 X:130280775-130280797 GAAAACAAGGAAAAGGACTCAGG - Intergenic
1197806911 X:130406149-130406171 GAAATAAAGGCAAAGCAGGCCGG - Intronic
1198147739 X:133874454-133874476 CTTAAAAAGGAAAAGTAGGATGG - Intronic
1198161995 X:134017224-134017246 GAGAGAAAAGAAAAAGAGGCTGG - Intergenic
1198182738 X:134225340-134225362 AATTAAAACCAAAAGGAGGCTGG + Intergenic
1198244188 X:134813630-134813652 AATAAAAAGGAAAAGATGCCGGG + Intronic
1198302771 X:135347582-135347604 GAGAAAAAGGAAGAGGACTCTGG - Intronic
1198463925 X:136888015-136888037 AAAAAAAAGGAAGAAGAGGCTGG - Intergenic
1198466087 X:136906017-136906039 AATAAAAATGAAAAAGTGGCCGG - Intergenic
1198645623 X:138802756-138802778 GATAGAGAGGAAAGGGAGTCAGG - Intronic
1198714479 X:139542277-139542299 TAAAAAAAGGAAAAGGTGACAGG + Intronic
1198756515 X:139987869-139987891 GCTGAAAAGGAAAAGGAAGTTGG - Intergenic
1199134530 X:144234810-144234832 AAAAAAAAGGAAATGTAGGCTGG + Intergenic
1199147885 X:144392798-144392820 GATAATGAGGAAAAGAAGACAGG - Intergenic
1199286007 X:146054898-146054920 AATAAAAAGGAAGAGGAAGGAGG + Intergenic
1199299138 X:146192767-146192789 GGAAAACAGGAAAAGGAGACTGG - Intergenic
1199324982 X:146488723-146488745 GATAAAGAGAAAGAGGAAGCCGG - Intergenic
1199372879 X:147072320-147072342 TATAAAAAGAAAAAGAAAGCAGG - Intergenic
1199406083 X:147462421-147462443 AAAAAAAAAGATAAGGAGGCTGG + Intergenic
1199526745 X:148801301-148801323 AATAGAAGGGATAAGGAGGCGGG - Intronic
1200055682 X:153459052-153459074 ATCAAAAAAGAAAAGGAGGCCGG - Intronic
1200202948 X:154295221-154295243 TTTAAAAAAGGAAAGGAGGCTGG + Intronic
1200375483 X:155775281-155775303 GAGAAAAAGTAAAAGCAGACAGG - Exonic
1200415621 Y:2906915-2906937 AAAAATAAGGAGAAGGAGGCTGG - Intronic
1200585931 Y:5004259-5004281 GACAAAAAGGCCAAGGAGCCAGG - Intronic
1201316757 Y:12654964-12654986 GTTAAAAAGCAATAGGAGGCAGG - Intergenic
1201361944 Y:13161549-13161571 GATAAACAGGTAAAGGATGCTGG + Intergenic
1201602057 Y:15741958-15741980 ATTAAAAAGAAAAAAGAGGCTGG + Intergenic
1201630435 Y:16065690-16065712 GAAAAAAAGGAAAAGGGAGCAGG + Intergenic