ID: 1188559913

View in Genome Browser
Species Human (GRCh38)
Location X:31455918-31455940
Sequence CCAATTTGGTAGTAGAGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 102}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188559913_1188559920 -1 Left 1188559913 X:31455918-31455940 CCTGGGCTCTACTACCAAATTGG 0: 1
1: 0
2: 1
3: 4
4: 102
Right 1188559920 X:31455940-31455962 GTTAGGCTTGGCATAGGACCGGG 0: 1
1: 0
2: 0
3: 5
4: 63
1188559913_1188559918 -7 Left 1188559913 X:31455918-31455940 CCTGGGCTCTACTACCAAATTGG 0: 1
1: 0
2: 1
3: 4
4: 102
Right 1188559918 X:31455934-31455956 AAATTGGTTAGGCTTGGCATAGG 0: 1
1: 0
2: 0
3: 7
4: 145
1188559913_1188559921 0 Left 1188559913 X:31455918-31455940 CCTGGGCTCTACTACCAAATTGG 0: 1
1: 0
2: 1
3: 4
4: 102
Right 1188559921 X:31455941-31455963 TTAGGCTTGGCATAGGACCGGGG 0: 1
1: 0
2: 0
3: 2
4: 41
1188559913_1188559919 -2 Left 1188559913 X:31455918-31455940 CCTGGGCTCTACTACCAAATTGG 0: 1
1: 0
2: 1
3: 4
4: 102
Right 1188559919 X:31455939-31455961 GGTTAGGCTTGGCATAGGACCGG 0: 1
1: 0
2: 0
3: 7
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188559913 Original CRISPR CCAATTTGGTAGTAGAGCCC AGG (reversed) Intronic
901665768 1:10825259-10825281 CGAATTTGGGAATAGACCCCAGG - Intergenic
902749519 1:18497774-18497796 GCTAGTTGGTAGCAGAGCCCAGG - Intergenic
902935006 1:19758739-19758761 GCAAGTTGGCAGTAGAGCCTGGG - Intronic
902966905 1:20011838-20011860 CCATCTTGGTAGCAGAGACCAGG - Intergenic
904105533 1:28078840-28078862 CCAACCTGGTATTCGAGCCCAGG + Intronic
904769404 1:32872427-32872449 CCCGTTTGGGAGAAGAGCCCCGG + Intronic
906661672 1:47587344-47587366 CCAATTTTTTAGTAGAGACAGGG - Intergenic
909268391 1:73591758-73591780 CCAACTTGGAAGCAGAGACCAGG + Intergenic
910098656 1:83552946-83552968 GCACTTTGGTAGTGGAGCCAGGG + Intergenic
922143784 1:222917874-222917896 CCTATTTGGTAGTTGATCCAAGG + Intronic
923967138 1:239154549-239154571 ACAACTTGGAAGCAGAGCCCAGG + Intergenic
1067939060 10:50637320-50637342 GCAATTTTGTAATGGAGCCCTGG + Intergenic
1072995030 10:100236069-100236091 ACAATTTGGAACTAGAGCACTGG - Intronic
1073670699 10:105584439-105584461 CCAATCTTGAAGTAGAGCCAAGG - Intergenic
1073692532 10:105826099-105826121 ACAATTTGAGAGTAGATCCCAGG - Intergenic
1074290829 10:112137037-112137059 GCAGTGTGGGAGTAGAGCCCCGG - Intergenic
1078063017 11:8060458-8060480 GCAAGTTGGTAGCAGAGCCAGGG - Intronic
1078490423 11:11762959-11762981 CCAATTACCCAGTAGAGCCCAGG - Intergenic
1085516692 11:77115906-77115928 CCAAGATGGGAGTGGAGCCCAGG + Intronic
1086614253 11:88795860-88795882 CCTATTGTGTAGGAGAGCCCTGG + Intronic
1087564229 11:99833930-99833952 TCATTTAGGTAGTAGAGACCAGG + Intronic
1090420562 11:126572464-126572486 CCCATTTGGTTCCAGAGCCCAGG + Intronic
1096335197 12:50749938-50749960 CCATTTTGGAAGTAGAGACCAGG + Intergenic
1100004761 12:89881454-89881476 CCATTTTGGAAGCAGAGACCAGG + Intergenic
1102971111 12:117167573-117167595 CCAATTTTTTTGTAGAGACCGGG - Intronic
1103118128 12:118355378-118355400 CCAATTTGATGGAACAGCCCGGG - Intronic
1103766473 12:123283772-123283794 TAAATTTGGGAGTAGACCCCTGG - Intergenic
1108007179 13:45961056-45961078 CAAATCTGGTGATAGAGCCCAGG - Intronic
1108715135 13:53071392-53071414 CCAGTATGGTAATAGAGCCTGGG + Intergenic
1110198905 13:72825152-72825174 CCATTATGGTAATAGAGCCTTGG + Intronic
1119967381 14:78931972-78931994 CTAATTTTGTAGTAGAGACAGGG - Intronic
1122954523 14:105064357-105064379 CCAATTTGATAGTGTTGCCCAGG + Intronic
1135148633 16:19985776-19985798 CTAATTTTGTAGTAGAGACAGGG + Intergenic
1136370091 16:29830819-29830841 CCTCTTTGGTAGTGGAGACCTGG + Intronic
1137009106 16:35306144-35306166 CCATTTTGAGAGAAGAGCCCTGG + Intergenic
1137022978 16:35448969-35448991 CCATTTTGAGAGAAGAGCCCTGG + Intergenic
1140899623 16:79355770-79355792 CCACTTTGCTAGTGGAGGCCGGG - Intergenic
1143597525 17:7924144-7924166 CCAATCTTGTGGTAGAGCTCTGG + Exonic
1145908049 17:28527061-28527083 GCAATTTAGTGGTAGAGCCGGGG - Intronic
1156740521 18:40321907-40321929 CCAATGTGGTAGGAGACGCCTGG + Intergenic
1157279382 18:46335627-46335649 CCGACTTGGTAGAGGAGCCCTGG - Intronic
1157487039 18:48095358-48095380 CCTATTTGAGAGGAGAGCCCTGG + Intronic
1160669270 19:349284-349306 CCATTTTGGGAGCAGAGACCAGG - Intergenic
1167189583 19:47975324-47975346 CCAATTTGATTATAGAGGCCAGG - Intronic
1168524567 19:57078685-57078707 CCACCTTGGTAGCAGACCCCAGG + Intergenic
925218877 2:2121828-2121850 CCACTTTGCTACTGGAGCCCAGG + Intronic
927933267 2:27059352-27059374 CCTTTTGGGTACTAGAGCCCAGG - Exonic
932075508 2:68659220-68659242 ACACTGTGGTAGAAGAGCCCTGG - Intergenic
936652902 2:114450034-114450056 CCATTTTGGTAGCACAGCACTGG - Intronic
945675841 2:212854807-212854829 GCAATTTACTAGTAGAACCCTGG - Intergenic
945956726 2:216093256-216093278 CCACTTTGGTAGAAGAGCCCTGG + Intronic
947459590 2:230292293-230292315 CAAATTTGGAAGTAGAGGCCAGG - Intronic
1168985586 20:2045812-2045834 CAAATTGGGTAGTAGAGGCTAGG + Intergenic
1172941398 20:38656984-38657006 CCAAGGTAGTAGTGGAGCCCAGG + Intergenic
1173238995 20:41276492-41276514 CCAATGTGGTAGTAGCTCTCTGG + Intronic
1174702198 20:52620365-52620387 CCTATTTGGAAATAGAGCCTTGG - Intergenic
949621020 3:5811659-5811681 CCCACTTGGTACTAGATCCCTGG + Intergenic
950621281 3:14207524-14207546 AAACTTTGGAAGTAGAGCCCAGG + Intergenic
952580671 3:34830011-34830033 CCCAATATGTAGTAGAGCCCTGG - Intergenic
953772130 3:45785841-45785863 CCATGTTGGTACCAGAGCCCAGG + Intronic
956048872 3:65225780-65225802 CCAGTTTGGAAGCAGAACCCTGG - Intergenic
958114415 3:89196865-89196887 CCATTTGGGTGGTAGAGCCACGG - Intronic
963533667 3:146501734-146501756 CCATCTTGGAAGTAGAGACCAGG - Intergenic
964422196 3:156515199-156515221 CCTATTTTGTGGTAGAGCTCTGG - Exonic
965892498 3:173531932-173531954 CCACTTTGGCTGAAGAGCCCGGG - Intronic
966047948 3:175575866-175575888 CCTAATGGGTGGTAGAGCCCAGG - Intronic
970159097 4:13171302-13171324 CAGATGTGGTAGTAGAGCCCCGG + Intergenic
972591131 4:40488147-40488169 CTAATTTTGTAGTAGAGGCTGGG - Intronic
981407467 4:144387689-144387711 CCATTTTGGAAGCAGAGACCAGG - Intergenic
981709544 4:147695566-147695588 CCATCTTGGTAGCAGAGCCTGGG - Intergenic
981911845 4:149991093-149991115 CCATCTTGGAAGTAGAGACCAGG - Intergenic
982005326 4:151057862-151057884 CTAATTTTGTAGTAGAGACGGGG - Intergenic
982864592 4:160493947-160493969 ACAAGTTGGGAGTAGAGCACAGG + Intergenic
987967099 5:24891530-24891552 ACAATTTGTGAGTGGAGCCCTGG + Intergenic
991004872 5:61818169-61818191 CCTAGTTGTGAGTAGAGCCCAGG - Intergenic
996996056 5:129697895-129697917 CCAATTTGGTGAAAGAGCCATGG + Intronic
1003308397 6:4948301-4948323 ACATTTTGGAAGTGGAGCCCTGG + Intronic
1005641695 6:27802303-27802325 CCAATTTGGAAGCAGAGACCTGG + Intergenic
1006850756 6:37096574-37096596 CTACTTTGGTAGTATAGGCCCGG - Intergenic
1008578624 6:52885192-52885214 CCATTGTGGTAGTAGAGCTTGGG + Intronic
1015091535 6:129364675-129364697 CAAATTTGGTGGTAGGGGCCAGG - Intronic
1015434462 6:133169647-133169669 ACAATTTGGTAGGAGAGGCATGG - Intergenic
1015590984 6:134822988-134823010 CAGATTTGGAACTAGAGCCCAGG + Intergenic
1018896097 6:168018654-168018676 CCAGGGTGGTAGGAGAGCCCCGG + Intronic
1020597300 7:10223771-10223793 CCACTTTGGAAGTGGAGACCAGG - Intergenic
1021539634 7:21742942-21742964 CCATTTTGGAAGCAGAGACCAGG - Intronic
1027643131 7:80762645-80762667 CTAATTTTGTAGTAGAGACAGGG - Intronic
1030010382 7:105160463-105160485 CCAATTAGGTACTAGGGCCTAGG + Intronic
1031750861 7:125571915-125571937 CAGATTTGGGACTAGAGCCCAGG - Intergenic
1032662050 7:133994994-133995016 CCAACTTTCTAGTAGAGCTCTGG + Intronic
1035629020 8:1094158-1094180 CCCATTTGGGAACAGAGCCCTGG + Intergenic
1035725051 8:1819060-1819082 CCTATTTGATGATAGAGCCCAGG + Intergenic
1039883476 8:41641899-41641921 CCAACTTGGAAGCAGAGACCAGG - Intergenic
1040317390 8:46272101-46272123 CCAAGTGGGTTGTAAAGCCCCGG + Intergenic
1041758808 8:61341756-61341778 CCAATCTGTTAGTACAACCCTGG - Intronic
1042003227 8:64150212-64150234 CCACCTTGGAAGTAGAGCCTGGG + Intergenic
1042211873 8:66389395-66389417 CCAACTTGGAAGTGGAGACCAGG - Intergenic
1042330793 8:67578508-67578530 CCAATTTGGCACGAGATCCCTGG + Intronic
1049704707 8:144035895-144035917 CCAATTCCTTAGGAGAGCCCAGG - Intronic
1050317673 9:4419898-4419920 CCAATGTGGTAGGTGAGGCCTGG - Intergenic
1053033903 9:34808629-34808651 CCATCTTGGAAGTAGAGACCAGG - Intergenic
1057372904 9:94490159-94490181 CCTATTAGGTAGTAGATTCCTGG + Intergenic
1058610558 9:106771223-106771245 CCATCTTGGAAGTAGAGACCAGG + Intergenic
1061099800 9:128484100-128484122 CCAATTTGATGGTAGCGGCCTGG + Intronic
1188559913 X:31455918-31455940 CCAATTTGGTAGTAGAGCCCAGG - Intronic
1195202696 X:102565436-102565458 CCAGTGGGGTAGCAGAGCCCTGG + Intergenic
1195215389 X:102695248-102695270 CCAATTTGGTATCAGAAACCTGG + Intergenic
1195254760 X:103080866-103080888 CCAGTGAGGTAGCAGAGCCCTGG - Intronic