ID: 1188559918

View in Genome Browser
Species Human (GRCh38)
Location X:31455934-31455956
Sequence AAATTGGTTAGGCTTGGCAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 145}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188559912_1188559918 -3 Left 1188559912 X:31455914-31455936 CCAGCCTGGGCTCTACTACCAAA 0: 1
1: 0
2: 0
3: 12
4: 239
Right 1188559918 X:31455934-31455956 AAATTGGTTAGGCTTGGCATAGG 0: 1
1: 0
2: 0
3: 7
4: 145
1188559911_1188559918 8 Left 1188559911 X:31455903-31455925 CCAACTGAAATCCAGCCTGGGCT 0: 1
1: 0
2: 71
3: 2140
4: 4015
Right 1188559918 X:31455934-31455956 AAATTGGTTAGGCTTGGCATAGG 0: 1
1: 0
2: 0
3: 7
4: 145
1188559913_1188559918 -7 Left 1188559913 X:31455918-31455940 CCTGGGCTCTACTACCAAATTGG 0: 1
1: 0
2: 1
3: 4
4: 102
Right 1188559918 X:31455934-31455956 AAATTGGTTAGGCTTGGCATAGG 0: 1
1: 0
2: 0
3: 7
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188559918 Original CRISPR AAATTGGTTAGGCTTGGCAT AGG Intronic
903307749 1:22425198-22425220 AAATTAGCTAGGCATGGCAGCGG + Intergenic
903599720 1:24527721-24527743 ATATTCCTTAGGCTTGGCAATGG - Intronic
906472184 1:46140329-46140351 AAAATGGTGGGGGTTGGCATAGG - Intronic
907137170 1:52150615-52150637 AAATTGGCTGGGCGTGGCGTTGG + Intronic
907155035 1:52325738-52325760 ATATGTGTTAGGCTTAGCATAGG - Intronic
909097427 1:71305280-71305302 AAATAAGTTAGGCTGGGTATTGG + Intergenic
910316743 1:85893931-85893953 AAATTGGTTAGGCCTGGGCATGG - Intronic
911865177 1:103009262-103009284 AAATTGGCTGGGCATGGCATCGG + Intronic
912664413 1:111566339-111566361 AAGTTGGCTAGACTTGTCATTGG + Intronic
913260375 1:116992163-116992185 GAATTGGTTAGCCCTGGCAGGGG + Intergenic
914764388 1:150625293-150625315 AAATTGATTAGGCTGAGCCTTGG - Intronic
917168670 1:172144541-172144563 ACATTGGTTAGACTGGGCAAGGG - Intronic
920938545 1:210458706-210458728 AAATAGATTGGGCTTGGCCTTGG + Intronic
1069399437 10:68026850-68026872 AAATTAGTTAGGCATGGTAGTGG + Intronic
1073335326 10:102703591-102703613 AAATTGGCTGGGCGTGGCAGTGG - Intronic
1077703668 11:4463891-4463913 AAATTGATAAGGCTTTGCAATGG - Intergenic
1078257024 11:9667005-9667027 AAATTAGTCAGGCATGGCAGCGG - Intronic
1078629643 11:12990582-12990604 AAATTTGTTTGGCTTTGGATAGG - Intergenic
1080939769 11:36902461-36902483 AAGTTAGTTAGGCTTTGTATTGG + Intergenic
1081978326 11:47249796-47249818 AAACTGATCAGGCTTGGCCTGGG + Intronic
1087603732 11:100348595-100348617 AAATTGGTGAGGATTGGCAGGGG - Intronic
1097260756 12:57718753-57718775 AAATTGGCCAGGCATGGCAGTGG + Intronic
1107620104 13:42218656-42218678 AAATTAGTTAGGCATGGTGTTGG - Intronic
1108999987 13:56787866-56787888 AAGTTGGTTATGATAGGCATAGG + Intergenic
1111569968 13:90071666-90071688 AAATTGGTCAGTCTTGGTATAGG - Intergenic
1114550450 14:23529882-23529904 AGATAGGTGAGGCTTGGCAAGGG + Intronic
1116903953 14:50387371-50387393 AAATTAGTTAGGCATGGTAGTGG + Intronic
1118004711 14:61554943-61554965 AAATTGGAGTGGCATGGCATCGG - Intronic
1118223073 14:63873543-63873565 AAATTGGCTAGGCGTGGTGTTGG - Intronic
1118503623 14:66387264-66387286 AAATTAGTCAGGCATGGCAGCGG + Intergenic
1119086192 14:71741474-71741496 AAATTGGTTCGGTTTGACTTTGG - Intergenic
1120299827 14:82692358-82692380 AAATTGATTAGGCTGAGCCTTGG - Intergenic
1120328925 14:83062864-83062886 AAATTACTTAGGCTTGGACTTGG - Intergenic
1122811153 14:104289792-104289814 AAATTGTTTAGGCTTCTCTTAGG - Intergenic
1124993150 15:34695676-34695698 CAAATGGTTAGGATTGGCAATGG - Intergenic
1127242363 15:57130910-57130932 AAATTGGTAAGTCATGGAATTGG + Intronic
1128364799 15:66991283-66991305 AAATTGGTTAGGCATGGTGGCGG + Intergenic
1130379770 15:83361426-83361448 AGATTGGGTGGGCTTGGCAGTGG - Intergenic
1131671304 15:94622399-94622421 ATATTTGTTATGCTTGGCACAGG + Intergenic
1131678872 15:94700936-94700958 AAATTAGTTAGTTTGGGCATTGG + Intergenic
1133009388 16:2902124-2902146 AAATTGGCCAGGCGTGGCAGTGG + Intergenic
1136679108 16:31944986-31945008 AAGTTGGTGAGGTGTGGCATTGG - Intergenic
1139307029 16:65995404-65995426 AAATCAGGTAGGCTTGGCATAGG - Intergenic
1142993970 17:3750302-3750324 AAATGGGTGAGGCTGGGCCTGGG + Intronic
1146430944 17:32794176-32794198 AAATTGCTTAGGCTTACCACAGG + Intronic
1146641822 17:34547530-34547552 AAATTCATCAGGCTTGGGATTGG + Intergenic
1149058227 17:52390188-52390210 TAATTGGTTGGGCTGGCCATAGG + Intergenic
1149640980 17:58202339-58202361 AAATTGGTATGGCTTGTCTTTGG + Intronic
1150777265 17:68091325-68091347 AAATTTGTTGGGCGTGGCGTGGG + Intergenic
1150918052 17:69456349-69456371 AACTTGGTTAGGGATGGCCTGGG + Intronic
1155479082 18:26265920-26265942 AAATTAGCTAGGCATGGCAGTGG - Intronic
1158897547 18:61929132-61929154 AAATTAGTTGGGCATGGCAGTGG + Intergenic
1161704337 19:5812017-5812039 AAATTGGCTGGGCGTGGTATTGG - Intergenic
1161844341 19:6703455-6703477 AAATTAGCCAGGCTTGGCAGCGG + Intronic
1162461673 19:10817416-10817438 ACATTGGTTAGGCTGGGCTTGGG - Intronic
1162960961 19:14126452-14126474 AAATTAGCTAGGCGTGGCAGCGG - Intronic
1163792143 19:19313557-19313579 AAATTAGCTAGGCATGGCAGTGG + Intronic
1165503881 19:36212287-36212309 AAATTGGCTAGGCGTGTCAAAGG + Intronic
1166678151 19:44751749-44751771 AAATTAGCCAGGCTTGGCAGTGG - Intronic
1167871776 19:52376657-52376679 AAATTAGCTGGGCTTGGCAGTGG - Intronic
1168021342 19:53611049-53611071 AAATTGGTCAGGCATGGTGTTGG - Intergenic
925493894 2:4424773-4424795 AAAATGGCTATGCTTGTCATTGG + Intergenic
927929041 2:27032516-27032538 AAATTAGCTGGGCTTGGCAGCGG + Intergenic
933465813 2:82649845-82649867 AAAATGCTTGGGCTGGGCATGGG + Intergenic
935760523 2:106316497-106316519 AAATTAGTAAGGCTTGGGAATGG - Intergenic
938172045 2:129088024-129088046 AAATTAGTCAGGCGTGGCAGTGG - Intergenic
939236189 2:139497029-139497051 AAATTCATTAGGCTGGGCTTGGG - Intergenic
940804771 2:158174449-158174471 AAATTGGTGGGGGTGGGCATGGG - Intronic
943264516 2:185710926-185710948 ATGTTGGTTAGTATTGGCATTGG + Intergenic
944824368 2:203466783-203466805 AATTTGAGGAGGCTTGGCATTGG - Intronic
946927838 2:224643463-224643485 AAGTTCATTTGGCTTGGCATGGG + Intergenic
1172194302 20:33081647-33081669 AAAGGGGTGAGGGTTGGCATGGG + Intronic
1172383382 20:34515584-34515606 GAATTGGTTAGGGCTGGCCTGGG - Intergenic
1172857643 20:38018857-38018879 AAAAAGGTAAGGCTGGGCATGGG + Intronic
1174263676 20:49316133-49316155 AAATTAGCTGGGCTTGGCAGTGG - Intergenic
1177439107 21:21096895-21096917 AAATTGGTTAAGGCTGACATTGG - Intronic
1178072758 21:28987515-28987537 AAAGAGGTTAGGCTAGGCTTTGG - Intronic
1180227291 21:46402139-46402161 ACAGTGGTCAGGCTGGGCATGGG - Intronic
1181347040 22:22227042-22227064 GAATTGGTGAGACTTGGCATAGG - Intergenic
1181765535 22:25089145-25089167 AAATTGGGTAGTATTTGCATGGG - Intronic
1181938933 22:26460207-26460229 AAATTGGCAGTGCTTGGCATTGG - Intronic
1182109895 22:27715601-27715623 AAAGTGGTTCGACTGGGCATTGG - Intergenic
1182910123 22:33976563-33976585 AAATTTGTTAGGCATGCCCTTGG + Intergenic
1183126997 22:35792165-35792187 AAATTAGGTAGGCGTGGCAGTGG + Intronic
951905064 3:27697713-27697735 ATAGTGGTTACCCTTGGCATGGG + Intergenic
955124199 3:56094170-56094192 AAATTTGTAAGGTGTGGCATGGG + Intronic
957675497 3:83358799-83358821 AATTAGATTAGGCTGGGCATGGG + Intergenic
960275856 3:115728376-115728398 AAATCCCTTAGGCATGGCATGGG + Intergenic
960801363 3:121543831-121543853 AAATTAGCTAGGCATGGCAGCGG + Intronic
962280925 3:134051235-134051257 ACATTTGTGAGGCCTGGCATAGG + Intronic
962546319 3:136439901-136439923 AGGTTGGTTTGGCTTGGCTTGGG - Intronic
965655738 3:170982402-170982424 AAATTAGTCAGGCTTGGTAGTGG + Intergenic
966992296 3:185245457-185245479 AAATTAGTTAGCTTTGGCACAGG + Intronic
969131167 4:4992018-4992040 AAATTGGCTGGCCTGGGCATAGG - Intergenic
970430007 4:15980515-15980537 AATTTGTTTTGGTTTGGCATAGG - Exonic
970632452 4:17964816-17964838 AATTATGTTACGCTTGGCATAGG - Intronic
973665795 4:53157964-53157986 AAATTTGTTAGGTCTGGGATGGG + Intronic
973868052 4:55134675-55134697 TAATTGGTCAGGCTGGTCATAGG + Intergenic
974704455 4:65493780-65493802 AAATTTGTTAGGATTGGAAATGG - Intronic
975452508 4:74545733-74545755 AATTTGGTTAGGCTGGGGATGGG + Intergenic
978962996 4:114706981-114707003 AAATGGGCTAGACTTGGCTTTGG + Intergenic
981125866 4:141105611-141105633 AGATTGCTGAGGCTTGGCACAGG - Intronic
981635030 4:146867387-146867409 AAATGAGTTAGGCCTGACATAGG - Intronic
982008455 4:151084843-151084865 GAATTGGCTAGCCCTGGCATGGG - Intergenic
983512999 4:168629164-168629186 AAATTAGTTGGGCATGGCAACGG - Intronic
991094085 5:62720863-62720885 AGATGGGTTAGGCTGGGCAATGG + Intergenic
993131185 5:83900217-83900239 AGACTGGTGGGGCTTGGCATCGG + Intergenic
994689559 5:102999831-102999853 AAAATGGTTTGGCTAGGCCTAGG - Intronic
1000564053 5:162825904-162825926 TATTTGGTTAGGCTTGCCAAGGG - Intergenic
1003731187 6:8826442-8826464 AAATTGCCTAGACTTGGCAGTGG - Intergenic
1003948587 6:11097126-11097148 AAATGCGTTTGGCTGGGCATGGG - Intronic
1008140222 6:47823434-47823456 AAATAGATAAGGCTTGCCATGGG - Intronic
1009288223 6:61850329-61850351 CAATTAGTTAGGATTGGCTTAGG - Intronic
1011461517 6:87610356-87610378 AAATTAGCTAGGCGTGGCAGCGG - Intronic
1012883960 6:104823282-104823304 AAATTAGTTGGGCATGGCAGTGG + Intronic
1013809955 6:114033242-114033264 AAATTAGTTAGGCATGGTAGTGG + Intergenic
1014950981 6:127555842-127555864 AAATGGGGTAGACTTTGCATAGG + Intronic
1017367239 6:153658096-153658118 AAATTGATTAGCCTGGGAATAGG - Intergenic
1018071979 6:160172872-160172894 AAATTGTCTCCGCTTGGCATTGG - Intronic
1022108289 7:27212582-27212604 AAATTTTTTAGTCTTGGCGTAGG + Intergenic
1024190137 7:46997775-46997797 CAAATGTTTTGGCTTGGCATTGG + Intergenic
1025827263 7:65020582-65020604 AAATTAGTTGGGCATGGCAGTGG + Intergenic
1030648411 7:112090596-112090618 AAATTGGTTAGGTTTTGAAAAGG + Intronic
1032175407 7:129620245-129620267 AAATCGGTTAAGCTTTGCTTTGG - Intronic
1032757367 7:134903931-134903953 AAGTGGGATAGGCTAGGCATGGG + Intronic
1033440876 7:141377519-141377541 AAATTAGCTAGGCGTGGCAGTGG + Intronic
1033574509 7:142667449-142667471 AACTTGTTTAGTCTTAGCATAGG - Exonic
1033979995 7:147152103-147152125 AAACTGCTTAGGCTGGGTATTGG - Intronic
1034254483 7:149716949-149716971 AAATAGGTTAGGTTTGGCTGAGG + Intronic
1036493799 8:9251410-9251432 AAATATGTTAGGCTTGGCTGTGG + Intergenic
1036929633 8:12942524-12942546 AAACTGGTTATGTTTGGAATAGG - Intergenic
1037043060 8:14261577-14261599 AAATAGCTTATACTTGGCATTGG - Intronic
1041746705 8:61215092-61215114 TAAGTGGTTAGGGTTGGAATGGG - Intronic
1042464575 8:69113000-69113022 ACATTAGTTATGGTTGGCATGGG - Intergenic
1043074694 8:75683404-75683426 TAATTGCTTAGGGCTGGCATTGG + Intergenic
1043074826 8:75684980-75685002 TAATTGCTTAGGGTTGGCACTGG + Intergenic
1047058865 8:121199221-121199243 TAATTGGCTTGGCTTGGCTTGGG - Intergenic
1047727854 8:127699949-127699971 AAATTGGGTAGCCATGGCCTTGG - Intergenic
1052464862 9:28817630-28817652 AGATTGGTCAGGCTTGGGTTAGG + Intergenic
1052886977 9:33658886-33658908 AACTTGTTTAGTCTTAGCATAGG - Intergenic
1053813420 9:41878631-41878653 AAATTAGCTGGGCGTGGCATCGG + Intergenic
1054617176 9:67308808-67308830 AAATTAGCTGGGCGTGGCATCGG - Intergenic
1057106963 9:92428237-92428259 AGAGTGGTCAGGGTTGGCATGGG - Intronic
1058748255 9:108013294-108013316 AAAATAATTAGTCTTGGCATGGG + Intergenic
1060501526 9:124160836-124160858 AAATTAGCTGGGCTTGGCAGCGG - Intergenic
1061109227 9:128555539-128555561 AAATTGGTTAGGATTTGTTTGGG + Intronic
1061903170 9:133683380-133683402 ACCTTGCTGAGGCTTGGCATAGG - Intronic
1061936326 9:133859422-133859444 CAATTGGCCCGGCTTGGCATTGG - Intronic
1187779669 X:22805358-22805380 AAATTAGTTGGGCGTGGCGTGGG + Intergenic
1188559918 X:31455934-31455956 AAATTGGTTAGGCTTGGCATAGG + Intronic
1192330416 X:70170874-70170896 AAAGTAGGTGGGCTTGGCATTGG - Intergenic
1196858381 X:120004820-120004842 AAATTAGTTGGGCATGGTATTGG + Intergenic
1197852808 X:130881820-130881842 AAATTGCTTCTGCTTTGCATAGG - Intronic