ID: 1188559919

View in Genome Browser
Species Human (GRCh38)
Location X:31455939-31455961
Sequence GGTTAGGCTTGGCATAGGAC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 83}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188559911_1188559919 13 Left 1188559911 X:31455903-31455925 CCAACTGAAATCCAGCCTGGGCT 0: 1
1: 0
2: 71
3: 2140
4: 4015
Right 1188559919 X:31455939-31455961 GGTTAGGCTTGGCATAGGACCGG 0: 1
1: 0
2: 0
3: 7
4: 83
1188559913_1188559919 -2 Left 1188559913 X:31455918-31455940 CCTGGGCTCTACTACCAAATTGG 0: 1
1: 0
2: 1
3: 4
4: 102
Right 1188559919 X:31455939-31455961 GGTTAGGCTTGGCATAGGACCGG 0: 1
1: 0
2: 0
3: 7
4: 83
1188559912_1188559919 2 Left 1188559912 X:31455914-31455936 CCAGCCTGGGCTCTACTACCAAA 0: 1
1: 0
2: 0
3: 12
4: 239
Right 1188559919 X:31455939-31455961 GGTTAGGCTTGGCATAGGACCGG 0: 1
1: 0
2: 0
3: 7
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188559919 Original CRISPR GGTTAGGCTTGGCATAGGAC CGG Intronic
901567140 1:10126612-10126634 GGTTAGACTTGTCAAAGAACAGG + Intronic
903194101 1:21672149-21672171 GGTTTGGATTGAAATAGGACAGG - Intergenic
907486616 1:54782381-54782403 GGTCAGCCTTGGCACAGGCCAGG + Exonic
908029146 1:59981568-59981590 GGTGAGGCTTGGCAAAAGAGTGG - Intergenic
908044248 1:60151149-60151171 TATTAGACTTGGCATAGGAAAGG + Intergenic
910621740 1:89262886-89262908 GGAGAGGCTTGCCATAGGAGAGG + Intronic
912498550 1:110106831-110106853 TGTCAGGCCTAGCATAGGACAGG - Intergenic
918392737 1:184083434-184083456 GCATAGGTTTGGCATAGGAAAGG - Intergenic
919565880 1:199187239-199187261 GTTTAGGCTGGGCATAAGACTGG + Intergenic
1067831216 10:49612090-49612112 GCTCAGCCTTGGCATGGGACTGG + Exonic
1069559896 10:69422068-69422090 GGTGAGGCTTGTCTTAGGAGAGG + Intergenic
1070166289 10:73900703-73900725 GGTTGGGATTGGCAGAGGGCAGG - Intergenic
1070604499 10:77889239-77889261 GGTTCTGCTTGGCAGAGGCCTGG - Intronic
1075229913 10:120667117-120667139 GGTCAGGCTTGGCAAAGGTTTGG + Intergenic
1080188713 11:29521304-29521326 GGCCAGGCTGGGCAGAGGACTGG + Intergenic
1083801150 11:65047172-65047194 GGTTAAACTTGGCAGAGGCCGGG + Intronic
1083994363 11:66264951-66264973 GGTTGGGCTGGACACAGGACTGG - Intronic
1084345610 11:68546055-68546077 ACTTTGCCTTGGCATAGGACAGG - Intronic
1084736292 11:71107833-71107855 GGGGAGGCTTGGCTCAGGACAGG + Intronic
1085231614 11:74976352-74976374 TATTAGGCCTGGCATATGACAGG + Intronic
1093766046 12:22964092-22964114 GGGAAGGCTTGGCAAAGGAAGGG - Intergenic
1095475915 12:42587690-42587712 GGCTAGGCTTGGCCTGGGACAGG - Intronic
1105785076 13:23740356-23740378 GGTGGGGCTTGGCAGAGGAGAGG - Intronic
1106208900 13:27622557-27622579 GGATAGGATTAGAATAGGACTGG - Intronic
1109502733 13:63258635-63258657 GGCAAGGATTGGCATAAGACTGG + Intergenic
1110780155 13:79455980-79456002 GGTTAAGGTTGGAATAGGATTGG + Intergenic
1120768195 14:88350915-88350937 GGTGAGGCTTGGCTGAGGATGGG - Intergenic
1122376201 14:101260731-101260753 GGATAGGCTGGGCAAAGGATGGG - Intergenic
1123774586 15:23566033-23566055 GCTTCGGCTTGGCAACGGACTGG - Exonic
1124993147 15:34695671-34695693 GGTTAGGATTGGCAATGGAGGGG - Intergenic
1127482065 15:59386857-59386879 GGTTAGGATTGCTATAGGAAAGG + Intronic
1130432943 15:83867319-83867341 GGCCAGGCTTGGGACAGGACTGG - Intronic
1133026087 16:2989552-2989574 GGTGAGGCCTGGCATAGGGAAGG + Intergenic
1135922586 16:26664337-26664359 GGTTTGGTTTGGCTAAGGACAGG + Intergenic
1136184041 16:28574654-28574676 GGTGTGGCTTGGCATAGAAAGGG - Intronic
1138225268 16:55289498-55289520 GGGTGGGGTTGGCATAGGAATGG + Intergenic
1144842755 17:18198407-18198429 GGTTTGTCTTGGGAAAGGACGGG + Intronic
1148872619 17:50667757-50667779 GGTGAGGCTTGGCACAGGGCTGG + Exonic
927721534 2:25386252-25386274 GTTTAGGGTTGTCATGGGACTGG - Intronic
935703816 2:105839012-105839034 GGTTTGGCTTGGCAGAGAATTGG + Intronic
935966841 2:108486800-108486822 GATTAGGGTTGGCATGGGATTGG - Intronic
943463262 2:188196036-188196058 GGTTAGGCTTGGAATTAGAGAGG + Intergenic
945826823 2:214731065-214731087 GGATAGGTTTGGCATGTGACAGG + Intronic
1170289516 20:14752711-14752733 GGTTAAGCATGGCATGAGACAGG - Intronic
1176362428 21:6009006-6009028 GGTTAAGCTTGCCAAAGGAGAGG + Intergenic
1179761090 21:43529539-43529561 GGTTAAGCTTGCCAAAGGAGAGG - Exonic
1181347038 22:22227037-22227059 GGTGAGACTTGGCATAGGATGGG - Intergenic
949371858 3:3343909-3343931 GCTTAGGCTAGGCAGAGGAGAGG - Intergenic
951489866 3:23258081-23258103 GGTTAAGCCTAGCATAGGAATGG + Intronic
954693090 3:52406214-52406236 GGTTGGGCTGGGCAGAGGCCAGG + Intronic
955881485 3:63551089-63551111 GGTTAGTGTTTGCTTAGGACTGG - Intronic
959960271 3:112290149-112290171 GCTTAGTCTTGGCATAAGAGTGG - Intronic
960787877 3:121394434-121394456 GGTTAGGACTTGCATAGGAGTGG + Intronic
961336790 3:126185215-126185237 GGTTAGATTTGGCATGGGGCTGG - Intronic
962412707 3:135155231-135155253 GGTTAGGCTTGGGAAAGAGCAGG + Intronic
968959918 4:3738222-3738244 GGCAAGGCTGGGCATAGGACAGG + Intergenic
983264029 4:165488441-165488463 GGGTGGGGTTGGCAGAGGACTGG - Intronic
985170593 4:187145546-187145568 GGCTAAGCATGGCATAGCACTGG + Intergenic
985194679 4:187416582-187416604 GGTTTGGTTTGGTATAGTACAGG + Intergenic
986430784 5:7679211-7679233 GGATAGCCTTAGCAAAGGACTGG + Intronic
990210953 5:53480898-53480920 GGGGAGGCTTGGCTGAGGACAGG + Intronic
998515384 5:142749142-142749164 AGCTAGGTTTGGCATAGGGCTGG + Intergenic
1003020662 6:2506062-2506084 GGTCAGGCTTTCCATAGGAATGG - Intergenic
1003743320 6:8968557-8968579 GGTAAGGATTGTCATAGGAGAGG + Intergenic
1015382989 6:132591115-132591137 GGTTAGGTATGGCATAAGAAAGG - Intergenic
1016049235 6:139513221-139513243 GGTCAGGCTTGGCAAAGCAGGGG + Intergenic
1016471429 6:144378676-144378698 GACAAGGCTTGGCATAGGAGTGG + Intronic
1019348100 7:540204-540226 GGTGAGGCTTGGCCAGGGACGGG - Intergenic
1019579899 7:1756429-1756451 GGTTAGGGTTGGGTTAGGGCTGG - Intergenic
1021527139 7:21600692-21600714 TGTTAGGCCTGGCAGAGGTCAGG + Exonic
1031146761 7:118005373-118005395 GGATAGGCTTCTCAGAGGACTGG - Intergenic
1035178899 7:157075104-157075126 GGTTAGGAATGGCAGATGACAGG + Intergenic
1035290012 7:157831774-157831796 GGCCAGGCTTGTCATAGGACTGG - Intronic
1039373914 8:37014271-37014293 GGAGAGGCTTGGAATAGAACTGG - Intergenic
1042144194 8:65711200-65711222 GTGCAGGCTTGGCATAGGAGGGG + Intronic
1044587714 8:93883527-93883549 GGATAGGTTTTGCATAGGAGCGG + Intronic
1048975952 8:139673175-139673197 GGTTAGTGGTGGCATAGGCCTGG + Intronic
1049475978 8:142797193-142797215 TGTTAGGCTGGGCATGGGAGAGG + Intergenic
1049815728 8:144598438-144598460 GGTGTGGCTGGGCACAGGACAGG + Intronic
1051350933 9:16197377-16197399 GTTTAGACTTGGAATAGAACAGG - Intergenic
1053282468 9:36829839-36829861 GGTTAGGGGTGGCATAGCACGGG + Intergenic
1055057545 9:72037736-72037758 GGTTTGGCTTAGCATATGAAGGG + Intergenic
1058362375 9:104164128-104164150 GGTTAGGCATGGAATATGATTGG + Intergenic
1059347402 9:113638757-113638779 GTTTAGACTTAGCATAGCACAGG - Intergenic
1059761002 9:117337458-117337480 GATTATGCCTGGCATTGGACTGG + Intronic
1186823315 X:13313398-13313420 GGTCTGTATTGGCATAGGACTGG - Intergenic
1188559919 X:31455939-31455961 GGTTAGGCTTGGCATAGGACCGG + Intronic
1192195075 X:69022568-69022590 AGGTAAGCTTGGCATTGGACTGG + Intergenic
1196739111 X:119008637-119008659 GGTTAGGCTGGGAGTGGGACAGG + Intronic
1198548480 X:137719490-137719512 GGTAAGGCTTGGCTGGGGACAGG + Intergenic
1198799015 X:140431023-140431045 AGTCAGGCTTGGCATTGGAGGGG - Intergenic