ID: 1188559920

View in Genome Browser
Species Human (GRCh38)
Location X:31455940-31455962
Sequence GTTAGGCTTGGCATAGGACC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 63}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188559913_1188559920 -1 Left 1188559913 X:31455918-31455940 CCTGGGCTCTACTACCAAATTGG 0: 1
1: 0
2: 1
3: 4
4: 102
Right 1188559920 X:31455940-31455962 GTTAGGCTTGGCATAGGACCGGG 0: 1
1: 0
2: 0
3: 5
4: 63
1188559912_1188559920 3 Left 1188559912 X:31455914-31455936 CCAGCCTGGGCTCTACTACCAAA 0: 1
1: 0
2: 0
3: 12
4: 239
Right 1188559920 X:31455940-31455962 GTTAGGCTTGGCATAGGACCGGG 0: 1
1: 0
2: 0
3: 5
4: 63
1188559911_1188559920 14 Left 1188559911 X:31455903-31455925 CCAACTGAAATCCAGCCTGGGCT 0: 1
1: 0
2: 71
3: 2140
4: 4015
Right 1188559920 X:31455940-31455962 GTTAGGCTTGGCATAGGACCGGG 0: 1
1: 0
2: 0
3: 5
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188559920 Original CRISPR GTTAGGCTTGGCATAGGACC GGG Intronic
901680517 1:10910188-10910210 GTGAGACTTGGCAAAGGAGCAGG + Intergenic
904052341 1:27647166-27647188 GTTTGGCTTGGCATATGCTCAGG + Intergenic
907620550 1:55973825-55973847 GTAAGGCTTAGCACAGGGCCTGG + Intergenic
912383375 1:109259582-109259604 GTGAGGCTGGGCCTAGAACCTGG + Intronic
1063141836 10:3262693-3262715 GAAGGGCTTGGCATAGTACCTGG + Intergenic
1064136167 10:12752659-12752681 TTTAGGCTTGTCATAGAATCGGG + Intronic
1067801698 10:49363493-49363515 GGCAGCCCTGGCATAGGACCTGG - Intergenic
1072280311 10:93860128-93860150 GTTAGGCTTGTTATAGGAGACGG - Intergenic
1073592482 10:104770126-104770148 GGCAGGCTTGGGATGGGACCTGG + Intronic
1079635505 11:22734646-22734668 GTTATGCTTAGCATAGTACTTGG - Intronic
1083178249 11:60966697-60966719 GTTTGGCTTGGCCCAGGAGCAGG + Intergenic
1085369828 11:75990860-75990882 TTTAGGCATGGTATAGTACCTGG + Intronic
1087265739 11:96058800-96058822 GAAGGGCTTGGCATAGGACTTGG - Intronic
1100876780 12:98970409-98970431 GTTTGGCCTAGCATAGTACCTGG + Intronic
1104210725 12:126685818-126685840 GTGAGGCCTGGAATAGTACCAGG + Intergenic
1107849292 13:44554291-44554313 GTTAGTCTTGGCATCAGCCCTGG - Intronic
1109321132 13:60811301-60811323 GCTAGGCTTGGCACAGTAGCAGG + Intergenic
1114884219 14:26827542-26827564 GTTGGGCTTGGCATATGACTTGG + Intergenic
1115727122 14:36229252-36229274 GTTTTGTTTGGCATAGCACCAGG + Intergenic
1120176655 14:81301333-81301355 ATTTAGCTTGTCATAGGACCTGG - Intronic
1121139280 14:91526625-91526647 GTCAGGCCTAGCATAGGGCCTGG + Intergenic
1122120456 14:99550677-99550699 GAAAGCCCTGGCATAGGACCTGG + Intronic
1127647883 15:60975743-60975765 GTTAGGCTGGGCACAGGAAACGG + Intronic
1132989595 16:2785982-2786004 GTGAGGGTTGGCTGAGGACCTGG + Intronic
1140779130 16:78277715-78277737 GTTTGGCTTGGCTTGGGACTCGG + Intronic
1148339269 17:46863725-46863747 GTTAGACATGGCAGAGGACAAGG + Intronic
1148872620 17:50667758-50667780 GTGAGGCTTGGCACAGGGCTGGG + Intronic
1151569601 17:74919680-74919702 TTTAGGCTTGGACGAGGACCTGG - Exonic
1151576076 17:74953218-74953240 GTTGGGCTGGGCCTAGGGCCTGG - Intronic
1151579642 17:74970966-74970988 AGTAGGCTTGGAATAGAACCTGG - Intronic
1152111791 17:78360770-78360792 GTCAGGGTTGGCAAAGAACCTGG - Intergenic
1161504528 19:4636660-4636682 TTGAGGCTTGGCTCAGGACCAGG - Intergenic
1165495473 19:36150118-36150140 GCTAGGCTTGGCACAGGTACAGG - Exonic
926182304 2:10655878-10655900 GTTAGTCTTGGGTTAGGACTTGG - Intronic
935588071 2:104819922-104819944 GTGAGACTTGGCATTGGAACTGG + Intergenic
946927839 2:224643469-224643491 ATTTGGCTTGGCATGGGCCCTGG + Intergenic
1170236696 20:14114273-14114295 AATGGGCTTGGCTTAGGACCTGG + Intronic
1172352590 20:34255010-34255032 GTTAGGCTGGGGATTTGACCTGG + Intronic
1173530602 20:43766592-43766614 GCCAGGCTGGGCATAGCACCAGG + Intergenic
1173562818 20:44018331-44018353 GTTAGGCTTGGCATGCTGCCTGG - Intronic
1175708069 20:61196009-61196031 GTTGGGCTTTGCAGAGGTCCTGG - Intergenic
1183564670 22:38605129-38605151 ATAAGGTTTGGCATAGTACCTGG + Intronic
1183579527 22:38715637-38715659 ATGAGGCTTGGCATAAAACCTGG + Intronic
955920528 3:63949965-63949987 GAACTGCTTGGCATAGGACCTGG + Intronic
956667079 3:71652122-71652144 CTTGGGCTTGGCATAGAACCAGG - Intergenic
964392398 3:156211532-156211554 GTGGGCATTGGCATAGGACCTGG - Intronic
975705221 4:77105072-77105094 GCTGGGCTTGGCATAGGGCCAGG - Intergenic
975979740 4:80144001-80144023 AGTAGGCTTGGGATAGGACTTGG + Intergenic
983472874 4:168177886-168177908 GACAGGCTTCCCATAGGACCTGG - Exonic
984583627 4:181537977-181537999 GGAAGGCTTGGCATAGGAGAAGG + Intergenic
984895472 4:184535771-184535793 AATGGGCTTAGCATAGGACCTGG - Intergenic
991965023 5:72082188-72082210 GTTAGGCATCTCAGAGGACCAGG - Intergenic
993653630 5:90552181-90552203 GTTAGGCTTTGAAAAGGAACAGG - Intronic
998515385 5:142749143-142749165 GCTAGGTTTGGCATAGGGCTGGG + Intergenic
1001388564 5:171359919-171359941 GTTTGGCGTTGCATAGGATCTGG + Intergenic
1006535393 6:34695738-34695760 GTTAGACTTGGGACAGGGCCTGG - Intronic
1024247172 7:47479385-47479407 CTCAGGCTTGTCATAGGCCCCGG - Intronic
1028923991 7:96337700-96337722 GTTAGGCCTGGGATAGGGCCAGG + Intergenic
1035290011 7:157831773-157831795 GCCAGGCTTGTCATAGGACTGGG - Intronic
1038779534 8:30558175-30558197 GTTTTCCTTGGCATAGGACCTGG + Intronic
1044663873 8:94616569-94616591 AATAGATTTGGCATAGGACCAGG - Intergenic
1045234972 8:100343691-100343713 GAGAGGCTTGGCAGAGGACAAGG - Intronic
1047948122 8:129903134-129903156 TTTTGGCTTAGAATAGGACCTGG - Intronic
1049475979 8:142797194-142797216 GTTAGGCTGGGCATGGGAGAGGG + Intergenic
1053036305 9:34829447-34829469 GTTATGTTTGGCATAGTACTTGG + Intergenic
1188559920 X:31455940-31455962 GTTAGGCTTGGCATAGGACCGGG + Intronic
1189997136 X:46649836-46649858 GTTAGGATCTGCAGAGGACCCGG + Intronic
1190033174 X:46994316-46994338 GTTGGGCTTGGCATAGCTTCTGG + Intronic
1197593682 X:128441190-128441212 CCTAGGCATGGCATAGGCCCTGG + Intergenic