ID: 1188559921

View in Genome Browser
Species Human (GRCh38)
Location X:31455941-31455963
Sequence TTAGGCTTGGCATAGGACCG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 44
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 41}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188559913_1188559921 0 Left 1188559913 X:31455918-31455940 CCTGGGCTCTACTACCAAATTGG 0: 1
1: 0
2: 1
3: 4
4: 102
Right 1188559921 X:31455941-31455963 TTAGGCTTGGCATAGGACCGGGG 0: 1
1: 0
2: 0
3: 2
4: 41
1188559912_1188559921 4 Left 1188559912 X:31455914-31455936 CCAGCCTGGGCTCTACTACCAAA 0: 1
1: 0
2: 0
3: 12
4: 239
Right 1188559921 X:31455941-31455963 TTAGGCTTGGCATAGGACCGGGG 0: 1
1: 0
2: 0
3: 2
4: 41
1188559911_1188559921 15 Left 1188559911 X:31455903-31455925 CCAACTGAAATCCAGCCTGGGCT 0: 1
1: 0
2: 71
3: 2140
4: 4015
Right 1188559921 X:31455941-31455963 TTAGGCTTGGCATAGGACCGGGG 0: 1
1: 0
2: 0
3: 2
4: 41

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188559921 Original CRISPR TTAGGCTTGGCATAGGACCG GGG Intronic
903724902 1:25433615-25433637 TGAGCCTTGGCATAGGAAGGAGG + Intronic
1063225136 10:4008520-4008542 TTAGGCATGACATAGGACTGAGG + Intergenic
1064136168 10:12752660-12752682 TTAGGCTTGTCATAGAATCGGGG + Intronic
1072622870 10:97091796-97091818 ATGGGCTTGGCATTGGACAGAGG - Intronic
1079304892 11:19313485-19313507 CTAGCCTTGGCATAGCACTGTGG + Intergenic
1085369829 11:75990861-75990883 TTAGGCATGGTATAGTACCTGGG + Intronic
1086051177 11:82592387-82592409 TTAGGCTAGGGACAGGACCTTGG - Intergenic
1088884800 11:113998347-113998369 GTATGCTGGGCATAGGACAGAGG + Intergenic
1092081076 12:5716921-5716943 TTATGCTTGGTCTAGGGCCGTGG - Intronic
1097691358 12:62737468-62737490 CTAGGCTTGGCAGAGGGCAGTGG - Intronic
1101199635 12:102421115-102421137 TGATGCTTGGCACAGGACCCTGG + Intronic
1107980033 13:45726141-45726163 TTAGGGTTGGAATAAGACTGTGG - Intergenic
1119211189 14:72833356-72833378 GAAGGCTTGGCAGAGGAACGTGG + Intronic
1133816696 16:9203137-9203159 TGTGGCTTGGGACAGGACCGTGG + Intergenic
1135619063 16:23937684-23937706 TTAGTCTAGGAATAGGACAGTGG - Intronic
1144255257 17:13461271-13461293 TTAGGAATGGCACAGGACAGTGG + Intergenic
1152443445 17:80325107-80325129 TAAGTCCTGGCCTAGGACCGCGG + Exonic
1155815385 18:30301557-30301579 TTAGTCTTAGCATATCACCGAGG - Intergenic
1161504527 19:4636659-4636681 TGAGGCTTGGCTCAGGACCAGGG - Intergenic
1162118224 19:8445121-8445143 TTACCCGTGGCAAAGGACCGTGG - Intronic
930234286 2:48874018-48874040 TTGGGCTTGGCATGAGACTGAGG + Intergenic
935516759 2:104049865-104049887 TTAGGCTTGGCAAAGTATCTTGG + Intergenic
935966839 2:108486798-108486820 TTAGGGTTGGCATGGGATTGGGG - Intronic
939691466 2:145267187-145267209 TTGGGCTTGGAATAAGACCCAGG + Intergenic
1183579528 22:38715638-38715660 TGAGGCTTGGCATAAAACCTGGG + Intronic
949393058 3:3584311-3584333 TTAGGCCTGGCCTAAGACCCTGG + Intergenic
957330156 3:78752931-78752953 TTATGCTTTGCTTAGGACCCTGG + Intronic
996196598 5:120614446-120614468 TTAGGCTTGGCATTGGCCATTGG - Intronic
998515386 5:142749144-142749166 CTAGGTTTGGCATAGGGCTGGGG + Intergenic
1010846509 6:80715738-80715760 TGAGGCGGGGCATAGGATCGAGG + Intergenic
1017742480 6:157419055-157419077 GCAGGCTTGGAATAGGACTGGGG + Intronic
1024247171 7:47479384-47479406 TCAGGCTTGTCATAGGCCCCGGG - Intronic
1026393471 7:69927612-69927634 TCACCCTTGGCGTAGGACCGAGG - Intronic
1027178216 7:75918439-75918461 TAAGGCTTGGTATAGGTCAGCGG - Intronic
1029232556 7:99083026-99083048 TTAGGGTTTGCATAGGATGGTGG + Intronic
1030863003 7:114659885-114659907 TGAGGCTTGGCAGAGAAACGAGG + Intronic
1038617554 8:29109113-29109135 ATTGGCTTGCCATAGGCCCGTGG + Intronic
1041206224 8:55500581-55500603 TTAGGGTTGGAAGAGGACAGAGG - Intronic
1049421324 8:142517878-142517900 TCGGGCTTGGCATATGACTGTGG + Intronic
1049475980 8:142797195-142797217 TTAGGCTGGGCATGGGAGAGGGG + Intergenic
1051350931 9:16197375-16197397 TTAGACTTGGAATAGAACAGGGG - Intergenic
1188559921 X:31455941-31455963 TTAGGCTTGGCATAGGACCGGGG + Intronic
1196344028 X:114630927-114630949 TTAGGCAGGTCATAGGACCCAGG - Intronic
1197593683 X:128441191-128441213 CTAGGCATGGCATAGGCCCTGGG + Intergenic