ID: 1188562643

View in Genome Browser
Species Human (GRCh38)
Location X:31486993-31487015
Sequence CAAGCAATCCAGGATGTACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 102}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188562643 Original CRISPR CAAGCAATCCAGGATGTACA TGG Intronic
908756008 1:67469446-67469468 CAAGCGATCCAGGATACATAAGG + Intergenic
913525975 1:119693231-119693253 CAAGCATTCCAGGCTGGACGCGG - Intronic
917475035 1:175362112-175362134 CAGGCAGCCCAGGATGCACACGG + Intronic
922537524 1:226392154-226392176 CAAGCAATCCATAAAGTTCAGGG + Intronic
923472643 1:234306103-234306125 CTTGCAATCAAGGACGTACATGG + Intronic
1066531563 10:36346118-36346140 CAAACAATCCAGGATTTTAATGG + Intergenic
1068800600 10:61136057-61136079 CAAGCATTCCAGGGTGTTAACGG + Intergenic
1069980444 10:72248787-72248809 CAACCAATGCAGGAAGTCCAAGG - Intergenic
1073030298 10:100520202-100520224 AAAGCAATCGAGGCTGTAAATGG + Intronic
1074060332 10:109959694-109959716 CAAACAATCCATGCTGTGCATGG - Intergenic
1076341686 10:129753211-129753233 CAAACAATGCATTATGTACAAGG - Intronic
1087684585 11:101248762-101248784 CATCCACTCCAGGATGAACAAGG - Intergenic
1089096142 11:115921683-115921705 CAAGGTATCCAGGATGTGCATGG + Intergenic
1089791888 11:120951582-120951604 CCAGAAATCCAGGAAGTCCATGG - Intronic
1090739480 11:129644089-129644111 CAAGCAATCCACAATTTAGAAGG + Intergenic
1094688551 12:32745748-32745770 CAAGTAATCCAGGTAGTAAATGG + Intronic
1094726781 12:33127068-33127090 CAAGAAACCCTGGATGGACATGG - Intergenic
1097847817 12:64384531-64384553 CAAGCAGGCCAGGCTGTAAAAGG + Intronic
1100409159 12:94297331-94297353 GAAGCATTCCAAGATGTGCAAGG + Exonic
1104932516 12:132347343-132347365 CAAGGAATCCAAGGTGTACCAGG - Intergenic
1105750621 13:23419547-23419569 CAAGAAATCCAAGAAGTAAAGGG - Intronic
1105966222 13:25387173-25387195 AAAGCAATCAAGGATTTCCAGGG + Intronic
1106213273 13:27670616-27670638 AAAACAATCCAGGAAGGACAAGG - Intergenic
1109986506 13:69993375-69993397 CATGGAATGCAGGCTGTACAGGG - Intronic
1110174772 13:72542760-72542782 CAAGCAATTCAGTAAATACACGG + Intergenic
1114238349 14:20842298-20842320 CAAGCAATCCAGGGCTTTCAGGG - Intergenic
1114620378 14:24093036-24093058 ACAGCAATCAAGGATGTTCAAGG - Intronic
1115506764 14:34100492-34100514 CAATCACACCAAGATGTACAAGG + Intronic
1116121271 14:40724374-40724396 CAAGCAATCCATGATATACCAGG - Intergenic
1116361617 14:44005369-44005391 CTAGTATTCCATGATGTACAGGG - Intergenic
1117986049 14:61387140-61387162 CTAGGAATCCTGGATCTACAAGG - Intronic
1122663219 14:103311657-103311679 CAGGCAGTTGAGGATGTACAGGG + Intergenic
1125880526 15:43190088-43190110 CATGCCATCCACGATGTCCAGGG - Exonic
1126218739 15:46187317-46187339 CAAGCAAAACAGGATGTTCTTGG + Intergenic
1128473693 15:67978338-67978360 CAAGCAATCCTGGGTGTAGCTGG - Intergenic
1133366941 16:5217592-5217614 CAAGCAATCCCAGGTGTACCAGG - Intergenic
1135990932 16:27218339-27218361 CAAGCGATCTTGGATGTTCACGG - Intronic
1137022411 16:35441800-35441822 CAAGCAATATAGGAGGGACAAGG + Intergenic
1140239071 16:73184668-73184690 CAGGCAATCAAGGATGTTCTAGG - Intergenic
1143385416 17:6526897-6526919 CAGCCAATACAGGATGTCCAGGG - Intronic
1143456870 17:7073768-7073790 CAATCAATCCAGCATATACCAGG - Intergenic
1143919178 17:10317381-10317403 GAAGCAATCAAGGAGGCACAGGG + Intronic
1146686126 17:34842653-34842675 CAAGCCATCCAGGAAAGACATGG + Intergenic
1146886210 17:36472644-36472666 CAAGCTATCCAGGATGGACCAGG - Intergenic
1150268723 17:63848885-63848907 CAAGCGAGCCGGGATGTCCAAGG + Intergenic
1150790902 17:68199546-68199568 GAGGCCATCCAGGATGTGCACGG + Intergenic
1150874843 17:68959318-68959340 CAAGCAAGACAGCATGTGCAGGG - Intergenic
1153447347 18:5188625-5188647 CAAGCCATCCAGACTGCACAGGG + Intronic
1154049247 18:10937751-10937773 TAAGCAATCCAGGATGTCCTAGG + Intronic
1156894846 18:42234286-42234308 AAAGGAATCCAGAATCTACAAGG + Intergenic
1157202905 18:45674231-45674253 CAAGAAATAAAGGATGTTCAAGG - Intronic
1160989980 19:1856556-1856578 CAAGCAACCCAGGATGCAGCTGG + Intronic
926045993 2:9710022-9710044 CATGCAATCCAGGAGTTGCAGGG - Intergenic
934758168 2:96839073-96839095 GATGCCATCCAGGATGTACAAGG - Exonic
938142789 2:128810613-128810635 CAAGCAAGAAAGCATGTACAGGG - Intergenic
938219855 2:129556726-129556748 CCAGCCATCCAGGATTTAAATGG - Intergenic
938840568 2:135158336-135158358 CGAGCAATCCAGGATGTTCCAGG - Intronic
940763575 2:157765111-157765133 CTAGGAATCCAGGAAGAACATGG + Intronic
941617209 2:167734278-167734300 CACCCAAGCCAGGATGTACAGGG + Intergenic
942319429 2:174723729-174723751 CAGGCAAGCGAGCATGTACAGGG - Intergenic
945374083 2:209058705-209058727 CAAGCTATCCTGGATTTCCATGG - Intergenic
945893008 2:215450364-215450386 CAGGCAAGACAGCATGTACAGGG + Intergenic
1173981354 20:47226526-47226548 CTAGCATTCCATGATGAACAGGG + Intronic
1177920693 21:27148704-27148726 CAAGCAAGACAGCATGTGCAGGG - Intergenic
1178971459 21:37181516-37181538 CAAGAAATTCAGGATCAACAAGG + Intronic
951265004 3:20554412-20554434 CAAGCAAACAAGAATGTAGATGG - Intergenic
957048662 3:75395657-75395679 CAAGCAATGCAGTCTGTCCACGG + Intergenic
961839674 3:129698266-129698288 CAGGCAAGACAGCATGTACAGGG + Intronic
961963341 3:130876012-130876034 CAAAATATCCAGGATATACAAGG - Intronic
962196353 3:133367084-133367106 CATGGAATGCAGGCTGTACAGGG - Intronic
963258859 3:143174218-143174240 CAAGGAAGCCAGGATTTTCAGGG - Intergenic
970193295 4:13534539-13534561 CACCCCATCCAGGATGCACACGG + Intergenic
970266031 4:14287303-14287325 CAGGCAAGACAGCATGTACAGGG + Intergenic
972983683 4:44737377-44737399 CAAGCAATACAGGATGTCTAAGG + Intergenic
973230001 4:47829900-47829922 CAAGTAAACCAGGATCTAAAAGG + Intronic
976163979 4:82233790-82233812 AGAGTAATCCAGGAGGTACATGG + Intergenic
976881756 4:89933619-89933641 CAAGCAAGACAGCATGTGCAGGG + Intronic
981124014 4:141085181-141085203 CAGGCAAGACAGCATGTACAGGG + Intronic
981271288 4:142848956-142848978 AAATCAAGCCAGGATCTACAGGG + Intergenic
983653833 4:170059967-170059989 CAAACAATCCAGAATGTATAAGG - Intergenic
989525470 5:42448474-42448496 CAAGATATCCAGAATCTACAAGG - Intronic
995208802 5:109513400-109513422 CAAGCAATAAATAATGTACAAGG + Intergenic
996627696 5:125589424-125589446 CAGGCAAGACAGGATGTGCAGGG + Intergenic
998116721 5:139543450-139543472 CGTGCAATCCAGGATCTACGTGG - Intronic
1001571518 5:172733388-172733410 AGAGCAAACCAGGATGTCCAGGG + Intergenic
1002946774 6:1769433-1769455 CAAACAACCCAGGAAGCACAGGG + Intronic
1004028965 6:11847249-11847271 CAGGCAAGACAGCATGTACAGGG - Intergenic
1006241590 6:32684676-32684698 CAATCAATCCAGCAAGGACAGGG + Intergenic
1018179338 6:161207026-161207048 CAAGGAAACCAGGAAGTCCATGG - Intronic
1020773517 7:12425528-12425550 GAAGCAATTCATCATGTACAAGG - Intergenic
1023686252 7:42738429-42738451 CAATCAATTCAGGATGAACCTGG - Intergenic
1027679982 7:81208161-81208183 CAAGCAATCTAGGAAGTACTCGG + Intergenic
1029102734 7:98147126-98147148 AAAGCAATTCATCATGTACAAGG - Intronic
1031039319 7:116822378-116822400 TCAGCAATCCAGAATCTACAAGG - Intronic
1034108113 7:148508770-148508792 CAAGCAATCCAGTAAGAAAATGG - Intergenic
1037824623 8:22153967-22153989 CAAGTCATTCAGGATGTCCAGGG + Exonic
1038936915 8:32262258-32262280 CAAGCAGTCCTGTCTGTACAAGG - Intronic
1039169142 8:34721977-34721999 CAAGCAATACAAAATGTATAAGG + Intergenic
1040705464 8:50121391-50121413 TAAACATTCCAGAATGTACAGGG - Intronic
1041179880 8:55236348-55236370 CATGCAGACCAGGAGGTACAAGG - Intronic
1044555385 8:93557080-93557102 CTAGCAATGCAGGATGTAGAGGG + Intergenic
1046533321 8:115475358-115475380 CAAGTGATCCAGGTTTTACAAGG - Intronic
1048606551 8:135974327-135974349 CAAGCAATCCAGAACAGACAAGG - Intergenic
1050109829 9:2202742-2202764 CAAGCCACACAGGATGTACAGGG - Intergenic
1050254737 9:3782117-3782139 CAAGCAAAACTAGATGTACAGGG + Intergenic
1052183308 9:25558516-25558538 CAGGCAAACCAGTATGGACAAGG + Intergenic
1053715439 9:40884069-40884091 CAAGCAATGCAGTCTGTCCATGG + Intergenic
1055368835 9:75575050-75575072 CAAGTAAACCAGGATTTTCATGG - Intergenic
1057512356 9:95691423-95691445 CAAGCAATTCTAGAGGTACAAGG - Intergenic
1058104410 9:100954376-100954398 CTAGCTATCCAGAATTTACAAGG - Intergenic
1062400290 9:136369806-136369828 TAAGGACTCCAAGATGTACAAGG - Exonic
1187654085 X:21449651-21449673 ATAGCAACCCAGGATGCACATGG - Intronic
1188562643 X:31486993-31487015 CAAGCAATCCAGGATGTACATGG + Intronic
1198644636 X:138792778-138792800 ACAGGAAACCAGGATGTACAGGG - Intronic
1202584621 Y:26409665-26409687 CAAGCAATGCAGTCTGTCCACGG - Intergenic