ID: 1188563160

View in Genome Browser
Species Human (GRCh38)
Location X:31493244-31493266
Sequence ATGTCCTTCAAGAAGATTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 263
Summary {0: 1, 1: 1, 2: 2, 3: 22, 4: 237}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188563160 Original CRISPR ATGTCCTTCAAGAAGATTTT TGG (reversed) Intronic
901237505 1:7675417-7675439 ATGTCTTTAAAGATGATTCTGGG + Intronic
904005555 1:27361391-27361413 ATGTCCTGCAAGAAGAAATGGGG + Exonic
904589660 1:31604883-31604905 ATGACCATCAAGAAAGTTTTAGG + Intergenic
904899738 1:33847360-33847382 ATGTCCCCCAAGATGACTTTGGG + Intronic
905361701 1:37425295-37425317 TTGTCCTTCCAGAATATTTCTGG + Intergenic
908689634 1:66763884-66763906 ATTTCCTTCAAGAACTTTTCAGG + Intronic
908868899 1:68584929-68584951 ATGCCCTTCAAGGAGACATTTGG + Intergenic
909209977 1:72810700-72810722 ATGTCCTTCTAGAAGACTGAAGG + Intergenic
909814082 1:79968857-79968879 ATAGCCTTCAAGATGATTTTTGG - Intergenic
910494279 1:87809275-87809297 ATGTACTTTAAAAAGATTGTTGG + Intergenic
913490167 1:119372010-119372032 ATGCCCTCCAAGTAGAGTTTTGG - Intronic
917766115 1:178219345-178219367 ATTTCCTTCAAGAACTTTTCAGG + Intronic
918079330 1:181193623-181193645 AAGTTCTTCAAGAAGTTTTAAGG - Intergenic
918465314 1:184815818-184815840 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
918988607 1:191666564-191666586 ATGTCCTTTAGCAAGTTTTTGGG + Intergenic
919659033 1:200225236-200225258 ATGTCCTTCAAGAAACTCTTGGG + Intergenic
921549513 1:216517099-216517121 ATCACCTGCAAGAATATTTTGGG + Intronic
921598527 1:217081525-217081547 ATGTCTTTTAGGAATATTTTTGG - Intronic
924679064 1:246212927-246212949 GTGTCCTTCCAGAAGATATGGGG + Intronic
1066286097 10:33967613-33967635 ATGTTCTTCAAGAATATTTAAGG - Intergenic
1068048627 10:51919636-51919658 TTGACCTTAAAGAACATTTTTGG - Intronic
1068493957 10:57761234-57761256 ATGTCCTTCAATGTTATTTTTGG - Intergenic
1069086478 10:64145616-64145638 ATTTCCTTTTAGAAGAATTTAGG + Intergenic
1069393441 10:67962162-67962184 ATGTCCTACAAGAGGAATATTGG - Intronic
1071197419 10:83177316-83177338 GTGTCCCTCCAGAATATTTTTGG - Intergenic
1073873765 10:107897586-107897608 ATGACCAACAAGAAGTTTTTGGG - Intergenic
1075658734 10:124178758-124178780 TTCTCCTTCAACAACATTTTTGG + Intergenic
1078311813 11:10251260-10251282 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1079166065 11:18044552-18044574 ATGTCCTGTAAGATTATTTTGGG - Intergenic
1079222322 11:18574062-18574084 ATGTGCTTAAAGGACATTTTTGG - Intronic
1079530971 11:21453071-21453093 ATGCACCTCAAGAAAATTTTTGG + Intronic
1079796386 11:24808239-24808261 ATGACTTCCAAGAATATTTTGGG + Intronic
1081154314 11:39670197-39670219 AGTTCAATCAAGAAGATTTTAGG - Intergenic
1081496687 11:43618378-43618400 ATGTATTTCAAGAAGAATTTTGG + Intronic
1082698362 11:56398723-56398745 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1083444627 11:62699538-62699560 ATGTCTTTATAGAAGATTCTAGG + Intronic
1084697735 11:70765830-70765852 ATGTCATTCAAGAAAAGTGTTGG - Intronic
1085867359 11:80310019-80310041 GTGTCCCTCCAGAAGATATTTGG - Intergenic
1086249095 11:84793121-84793143 ATTTCTTTCAAAAAAATTTTCGG + Intronic
1087226903 11:95611422-95611444 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1087524702 11:99295517-99295539 ATGTCCTTCTAGAAGACTGAAGG + Intronic
1087560102 11:99778685-99778707 TTGTCCTTGGAGAAGATCTTAGG - Intronic
1088485889 11:110340031-110340053 ATGTGGTGGAAGAAGATTTTTGG + Intergenic
1089095571 11:115917515-115917537 ATGACCTTTAGGAATATTTTGGG + Intergenic
1090292885 11:125561329-125561351 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1090933575 11:131321549-131321571 TTGTTCTACAAGAAGATTGTGGG - Intergenic
1091413949 12:263889-263911 GTCTCCTTCAAGAAGACTTCCGG - Intergenic
1092663996 12:10773882-10773904 ATTTGCTGCAAGAAGATGTTTGG + Intergenic
1093252400 12:16822832-16822854 AAGTCTTTCAAGATGATTCTAGG + Intergenic
1093846761 12:23981202-23981224 ATGTCCTCCACTAAGAATTTTGG - Intergenic
1094289736 12:28833502-28833524 CTTTGCTTCTAGAAGATTTTAGG - Intergenic
1095370192 12:41458017-41458039 ATGTTCTTCATGAAGTTTTCTGG - Intronic
1095437223 12:42203214-42203236 ATGTCCTTCAATAAAATGTTGGG + Intronic
1097254578 12:57663910-57663932 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1097530934 12:60799050-60799072 ATGTCCTTCAGATATATTTTTGG - Intergenic
1097539142 12:60914375-60914397 GTGTCCTTCAGGAATATTATAGG + Intergenic
1098725000 12:73952649-73952671 ATGTCCTCAAGTAAGATTTTAGG + Intergenic
1099697837 12:86044114-86044136 ATTTCTTTCTGGAAGATTTTAGG + Intronic
1100249254 12:92799484-92799506 CTGTCTTTCAAGAATATTCTCGG + Intronic
1101189409 12:102315861-102315883 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1102113362 12:110382023-110382045 AGGGCCTTCAATATGATTTTTGG - Intronic
1104905539 12:132211727-132211749 AGGTCCTTCAAGAGCATTTGTGG + Intronic
1105337697 13:19488808-19488830 ATTTTCTTCAAGAAGTTTTTTGG + Intronic
1105498947 13:20954583-20954605 GTTTTCTTCTAGAAGATTTTTGG - Intergenic
1106086324 13:26545253-26545275 TTGTGCTTCAAGATTATTTTGGG + Intergenic
1106674332 13:31941903-31941925 TGGTCCGCCAAGAAGATTTTAGG - Intergenic
1107668834 13:42721869-42721891 GTGTCCAGAAAGAAGATTTTAGG - Intergenic
1107820753 13:44283302-44283324 ATGGCATTTAAGAAAATTTTAGG - Intergenic
1109732039 13:66425218-66425240 ATGTCTTTCACAAAGTTTTTAGG - Intronic
1110795386 13:79631134-79631156 ATGTCCTTCATCCACATTTTAGG + Intergenic
1111421402 13:88016379-88016401 AGGTCCTTCAGGAAGCTTTGTGG + Intergenic
1112944881 13:104916018-104916040 ATGACTTTCCGGAAGATTTTAGG - Intergenic
1114940566 14:27605102-27605124 TTTTCCTTCCAGAAGTTTTTTGG - Intergenic
1115608621 14:35030771-35030793 AAGTTCTTCAAGTATATTTTTGG - Intergenic
1116575354 14:46567592-46567614 ATGTCCTCCAAGCTGATTTTAGG + Intergenic
1116942392 14:50803579-50803601 ATGTGATTCAAGAAGGCTTTAGG - Intronic
1117601110 14:57375780-57375802 ATGACCATCAAGCAGATTATTGG - Intergenic
1117853415 14:60000657-60000679 ATTTTCTTCAAAAAAATTTTTGG - Intronic
1118687684 14:68307556-68307578 CTGTACTTCAAGCAGTTTTTGGG + Intronic
1118860583 14:69659911-69659933 ATGTCCTTAAAGGACATGTTTGG + Intronic
1120329039 14:83064938-83064960 ATGGGCCACAAGAAGATTTTGGG + Intergenic
1120499571 14:85278273-85278295 AGATCCTTCAATAAAATTTTTGG + Intergenic
1121863020 14:97337223-97337245 ATGTCCTTCAAGAAGCAGTTGGG + Intergenic
1123143189 14:106103241-106103263 ATTTCCTTCATGTAGACTTTAGG + Intergenic
1123191218 14:106573795-106573817 ATTTCCTTCATGTAGACTTTAGG + Intergenic
1123789283 15:23703986-23704008 ATATCATTCAAGAAGTCTTTGGG - Intergenic
1124682442 15:31746291-31746313 ATGTCCATCAAGAAGAGAATGGG + Intronic
1125130879 15:36282804-36282826 AAATTCTTCAAGAAGTTTTTAGG + Intergenic
1125196139 15:37048775-37048797 ATGCCCTTTATGAAGTTTTTAGG + Intronic
1125705117 15:41727462-41727484 GTGTGTTTCAAGCAGATTTTTGG + Intronic
1126988024 15:54337369-54337391 ATGAATTTCAAGAAGATATTTGG - Intronic
1129556910 15:76519939-76519961 ATGTCCATCAAGAACATTAAGGG - Intronic
1129743527 15:78001970-78001992 ATCTCCTATAAGGAGATTTTTGG - Intronic
1130204882 15:81866667-81866689 ATGACAAGCAAGAAGATTTTAGG - Intergenic
1130893754 15:88154437-88154459 TTGGCCTTCAAGAAGAATGTTGG - Intronic
1131149587 15:90038633-90038655 ATGTAATGCATGAAGATTTTTGG - Intronic
1132278367 15:100590470-100590492 ATGCCCTTCTAGAAGATTGAAGG - Intronic
1136985268 16:35097803-35097825 ATGTTCTTCAATATGATCTTTGG - Intergenic
1140642189 16:76988570-76988592 ATGTCCTTTAAGAAAGTTTCAGG - Intergenic
1144523020 17:15966973-15966995 ATGCCCTTCAGGAATGTTTTGGG + Intronic
1145688446 17:26703613-26703635 ATGTGTTTCAAGTAGATATTTGG + Intergenic
1146985130 17:37208883-37208905 GTGTACTTCAAGGAGATTTTTGG - Intronic
1147896325 17:43754046-43754068 ATGATTTTCAAAAAGATTTTTGG + Exonic
1149404147 17:56329797-56329819 GAGGCCTTCAAGAAGATATTAGG + Intronic
1149546785 17:57509873-57509895 GTGTCATTCCTGAAGATTTTTGG + Intronic
1151687850 17:75659841-75659863 ATGACCTTCAAGAGGCGTTTTGG - Intronic
1153162510 18:2223745-2223767 CTGTTCTTCAAGCAGATCTTTGG + Intergenic
1155264098 18:24074480-24074502 ATGCCATTCAGGAAGATATTGGG + Intronic
1155440631 18:25858264-25858286 ATGTCCTTCTGGGAGATTCTTGG - Intergenic
1155453314 18:25985506-25985528 ATCTGCTTCAAGAGTATTTTAGG - Intergenic
1156339686 18:36200161-36200183 ATCTCCTTCTATAAGATCTTCGG + Exonic
1156567687 18:38214237-38214259 ATTTTCTTCTAGAAGATTTATGG - Intergenic
1157132416 18:45019132-45019154 ATGTCCTTCAAGCACATTTTTGG + Intronic
1157478871 18:48040170-48040192 ATGTCCTTGAAGAAGTCATTAGG + Exonic
1166623379 19:44326066-44326088 ATGTCCATCAATATGAATTTGGG - Intergenic
926088998 2:10037950-10037972 ATGTCCTCAAAGAAGCTTTCAGG + Intergenic
926126062 2:10272557-10272579 ATGTCCTTTAAGAAGAGATTAGG + Intergenic
926656270 2:15410438-15410460 ATGACCTTCAAGAAAGTGTTAGG + Intronic
928634841 2:33234302-33234324 ATTTCTTTCTAGAAGGTTTTTGG + Intronic
929034115 2:37674108-37674130 CTTTGCTTCAGGAAGATTTTAGG + Intronic
929428940 2:41870659-41870681 ATGTCCTTCAAGAAGAGTTTAGG + Intergenic
931383891 2:61779054-61779076 ATCTCCTTCAAGAGTTTTTTTGG - Intergenic
935574118 2:104691244-104691266 ATGTATTTCAGGATGATTTTTGG - Intergenic
936031711 2:109077304-109077326 ATCTCCTTGAAGAAGATTCAAGG + Intergenic
936395985 2:112130485-112130507 TTGTCCTTGAAGACTATTTTTGG - Intergenic
938116222 2:128604387-128604409 ATGTCCTTCAAACAGAGATTTGG - Intergenic
939421345 2:141974390-141974412 ATTTGGTTCAAGAAGATTTAAGG + Intronic
939429368 2:142083156-142083178 ATGTCCAGCAAGAAGTTTCTGGG + Intronic
939453661 2:142404533-142404555 ATGTCCTCCAAGAAAATTTTAGG - Intergenic
939691778 2:145271743-145271765 ATGTATTTCAAGAATATTTGTGG + Intergenic
941294927 2:163725835-163725857 ATCTCCATCAATAAAATTTTTGG - Intronic
941622351 2:167792565-167792587 ATGTCCTAAAAGAGCATTTTAGG + Intergenic
942358892 2:175150677-175150699 CTGTCTTTCAAAAATATTTTGGG - Intronic
944693647 2:202181268-202181290 ATGTTCTTAAAAATGATTTTAGG - Intronic
945887103 2:215387202-215387224 AAGTAATTCAAGCAGATTTTAGG + Intronic
946508743 2:220331394-220331416 ATTTGTTTCAAGAAAATTTTTGG + Intergenic
947067707 2:226248802-226248824 TTGTTCTTCAAGAATATTTCTGG - Intergenic
947449634 2:230195331-230195353 ATGTCATTTAAAAAGTTTTTTGG + Intronic
947809101 2:232988972-232988994 AACTCCTTCCAGAAGTTTTTAGG - Intronic
948028643 2:234798898-234798920 CTGTCTTTTAAGAATATTTTTGG - Intergenic
1168928509 20:1602440-1602462 CTGTACCTCAAGAATATTTTGGG - Intronic
1169034653 20:2439674-2439696 ATGTCCTTCAGAAAGATTCCTGG + Intergenic
1169838968 20:9912861-9912883 ATGTTTTTCTAGAAGATGTTAGG + Intergenic
1170745189 20:19092771-19092793 ATGTACTTAAAGAGTATTTTAGG - Intergenic
1171106859 20:22441863-22441885 TTTTCTTTCTAGAAGATTTTAGG - Intergenic
1174187993 20:48720641-48720663 ATAGCTTTCCAGAAGATTTTAGG - Intronic
1175293927 20:57895897-57895919 AGGGCCTCCAAGAAGATTTAGGG - Intergenic
1178574845 21:33777009-33777031 ATTTTCTTCTAGAAGTTTTTGGG + Intronic
1182211629 22:28681732-28681754 AGGTCCTTCAGGAAGTATTTTGG - Intergenic
1183533282 22:38376286-38376308 ATTTTCTTCAAGAAGTTTTTTGG + Intronic
1183643423 22:39107351-39107373 ATGTCCTTCTAGAAGAGTAAAGG - Intergenic
1184026086 22:41857731-41857753 ATGTCCTTCAAGGGGTTTCTGGG - Intronic
951250336 3:20386953-20386975 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
951276082 3:20688153-20688175 ATTTCCATCAAGAACATTTCTGG + Intergenic
952877422 3:37957953-37957975 ATGTCCTTAGAGAAGGATTTAGG + Intronic
954948496 3:54447880-54447902 ATGTTCTTCAATAATACTTTGGG + Intronic
957153606 3:76518903-76518925 TTCTCCTTCAAAAAAATTTTAGG - Intronic
959401681 3:105910303-105910325 ATATTCTTAAAGAAGTTTTTAGG + Intergenic
961242014 3:125419281-125419303 ATGTGGTGGAAGAAGATTTTGGG - Intergenic
961248662 3:125480214-125480236 ATGTGCATCAAAAAGCTTTTGGG + Intronic
961268353 3:125667291-125667313 ATGACATTCCAGAGGATTTTTGG - Intergenic
961385025 3:126518329-126518351 AGGTCCTTCAAAAAGAGCTTTGG - Intergenic
964510252 3:157442392-157442414 ATGCGTTCCAAGAAGATTTTTGG + Exonic
965482078 3:169231054-169231076 ATTTCCACCAAGAATATTTTGGG - Intronic
966536207 3:181037152-181037174 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
966705463 3:182908913-182908935 ATGGCCTTCAAGGAGTTATTTGG - Intronic
967114975 3:186328893-186328915 ATTTCCTTCAAGAAAAGTTAGGG + Intronic
967389420 3:188940994-188941016 ATGTCCTTGTAGAACCTTTTGGG + Intergenic
967686078 3:192418386-192418408 ATGTCAGTCAAGAAGTTGTTGGG + Intronic
967821716 3:193844856-193844878 TTGTCCTTCATGAAGTTTTATGG - Intergenic
967911200 3:194543965-194543987 ATGTCCTTCAAGTAGATGAATGG - Intergenic
968849843 4:3071756-3071778 ATGTCTTACAAGAAGAGATTAGG + Intergenic
972133979 4:35868691-35868713 TTGTCCATTAAGAAGCTTTTTGG + Intergenic
973705052 4:53572913-53572935 CTGTCCTTCAAGAAGGTGTGAGG - Intronic
976435750 4:85015940-85015962 CTGTCATTCAGGAAGATATTTGG - Intergenic
976543460 4:86305109-86305131 ATGTCCTTCAAGTATAATATAGG - Intronic
979046907 4:115878626-115878648 AGGTCATTCTAGAAGAATTTGGG - Intergenic
979815302 4:125094791-125094813 ATGTTCTTAAAGAGGGTTTTTGG - Intergenic
982503193 4:156185097-156185119 CTGTCATTCAACAAGATTATTGG + Intergenic
982519264 4:156392870-156392892 ATATGCATCAAGAAGATTTAAGG - Intergenic
982522411 4:156435401-156435423 ATGCCCTTCAAAAATATATTGGG + Intergenic
983810540 4:172055380-172055402 ATTTACTTCAAGAAAATTGTTGG - Intronic
984896345 4:184544439-184544461 ATTTTCTTCAAAAATATTTTTGG - Intergenic
989336791 5:40327096-40327118 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
989985946 5:50698097-50698119 ATGACCTTCATGAAGACTTTTGG + Intronic
990290870 5:54350119-54350141 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
990969345 5:61485876-61485898 ATGTCCTTCCAAAATATTTTAGG + Intronic
991971633 5:72147267-72147289 TTGTTTTTTAAGAAGATTTTGGG - Intronic
992477260 5:77115906-77115928 ATTTCATTCAAGAAGGTTTATGG + Intergenic
993468312 5:88274725-88274747 ATGTCCTTCAAGAAGAAATAAGG - Intergenic
994469166 5:100180479-100180501 CTGTACTTCAAAAAGATTTATGG + Intergenic
998753741 5:145352967-145352989 AAGTTATTCAACAAGATTTTAGG + Intergenic
1000561763 5:162798302-162798324 GTGTCCTTCAAGAAGACTTGTGG + Intergenic
1001808903 5:174611956-174611978 ATGACCATCATGAATATTTTGGG - Intergenic
1002441028 5:179264592-179264614 ATGTCCTCCAAAGAGCTTTTCGG - Intronic
1003348230 6:5291049-5291071 ATATGCTTCAAGAAGACATTTGG - Intronic
1003683635 6:8279760-8279782 ATCACCTTCAAGGAGGTTTTCGG - Intergenic
1005073760 6:21887493-21887515 ATGACCCTGAAGTAGATTTTTGG + Intergenic
1006211554 6:32400071-32400093 CTGTCTCTCAAGAAGGTTTTAGG - Intronic
1007996390 6:46312568-46312590 ATGTGCCTCATGAATATTTTAGG + Intronic
1008037019 6:46756173-46756195 TTGTCCTTCCCCAAGATTTTAGG - Intronic
1009895487 6:69744806-69744828 ATGTATTGCAAGAGGATTTTGGG - Intronic
1009949393 6:70378374-70378396 TTGTGCTTCTAGAACATTTTAGG - Intergenic
1010430808 6:75776419-75776441 ATGTTATTCAAAAAGATTTATGG - Intronic
1012205374 6:96455005-96455027 ATCTCCTTCACCAAGATATTAGG + Intergenic
1012418829 6:99039200-99039222 ATTACCTTCAAGAAGTTTTGTGG + Intergenic
1012696203 6:102387443-102387465 TTGTGCTCCAAGGAGATTTTAGG - Intergenic
1014341651 6:120215711-120215733 ATGCCCTTTATGAAGACTTTAGG + Intergenic
1015256822 6:131186768-131186790 CTGTCCTTAAAAGAGATTTTGGG - Intronic
1015322446 6:131891479-131891501 ATGTCCACCAAGAAGATGTGAGG - Exonic
1017259462 6:152370087-152370109 ATATCCTTTAAGAACTTTTTAGG + Intronic
1017787152 6:157765876-157765898 AAGACCTTTTAGAAGATTTTTGG - Intronic
1017835438 6:158173327-158173349 AAGTCTTCCAAAAAGATTTTGGG + Intronic
1018110884 6:160535952-160535974 AGATCCTTCAAGAGGATTATGGG - Intronic
1018471917 6:164105131-164105153 TTGTCCTTCAGGAAGAGTCTTGG - Intergenic
1018649664 6:165982420-165982442 ATGTCTTTCAAGATGGTTTTAGG - Intronic
1020968140 7:14898973-14898995 ATATCCTTAAAAAAGAATTTCGG + Intronic
1021212510 7:17871892-17871914 AAGTCCTTCAAGAGGCTTATAGG - Intronic
1021296575 7:18915186-18915208 ATATCCTTACAGAAGATTTTAGG - Intronic
1022987349 7:35669787-35669809 ATCTACTTCAAGAAGATTTAGGG + Intronic
1023246497 7:38210519-38210541 TTTTCCTTCTAGAAGATCTTAGG + Intronic
1023362096 7:39427408-39427430 ATGGCTTTTAAGAAGCTTTTAGG + Intronic
1024327923 7:48126683-48126705 AAAGCCTTCAAGAAGTTTTTGGG - Intergenic
1028244777 7:88463745-88463767 ATGTCCTTCAACGAGCTTCTGGG - Intergenic
1028336527 7:89664007-89664029 AGGTCTCTCAAGAAGATTTTAGG - Intergenic
1029810797 7:103046421-103046443 ATGTCCTTCTAGAAGAGTGAAGG + Intronic
1031595474 7:123644879-123644901 ATTTCCTTTATGAAAATTTTAGG + Intergenic
1032752524 7:134855791-134855813 ATGTACTCCAAAGAGATTTTAGG + Intronic
1033842307 7:145389524-145389546 ATGTCCTTCAAAAAGATAAAGGG + Intergenic
1035884885 8:3281132-3281154 ATGTCCTTCAATAAGAAAATGGG + Intronic
1035963522 8:4164564-4164586 AAAACATTCAAGAAGATTTTGGG - Intronic
1038320776 8:26525187-26525209 ATGAAATTCAAAAAGATTTTAGG - Intronic
1041188872 8:55332460-55332482 ATGTCCTACAAGAAATTTTAAGG - Intronic
1042337681 8:67645812-67645834 ATGTCCCTCAAGAAGAAATCTGG - Intronic
1042660327 8:71147943-71147965 ATGTCCTTCAAGAACTTCTCTGG - Intergenic
1045555901 8:103214154-103214176 ATGATCTTCAGGAAGAGTTTTGG + Intronic
1046554968 8:115763157-115763179 ATTACCTTCATGAAGATTCTTGG - Intronic
1050658085 9:7851524-7851546 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1052432323 9:28382613-28382635 ATATCCTGTATGAAGATTTTAGG - Intronic
1054832771 9:69644840-69644862 ATGTGCTTCAAGAAGATGTCTGG + Intronic
1055804986 9:80082757-80082779 ATTTCCTTCTAGAATATTTTAGG + Intergenic
1055970596 9:81908193-81908215 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1056516486 9:87356434-87356456 ATGTACTTAAGGAAGATTTATGG - Intergenic
1057311197 9:93944305-93944327 ATTTCCTCCCAAAAGATTTTTGG - Intergenic
1058780565 9:108330147-108330169 ATGGCATTTAAGTAGATTTTGGG - Intergenic
1060928284 9:127471175-127471197 ATTTTCTTTAAAAAGATTTTGGG + Intronic
1060938266 9:127528286-127528308 ATCTCCTTCCAGAAGCTTTCTGG - Intronic
1185506860 X:638337-638359 ATGCCCTTCCAGAGGCTTTTGGG + Intronic
1186393484 X:9184190-9184212 ATGTTCCTCAAAAAGTTTTTAGG - Intergenic
1186778026 X:12884845-12884867 ATCCCCTCCAAGGAGATTTTAGG - Intronic
1187659886 X:21532124-21532146 ATTTCCTTTAATAAGTTTTTGGG + Intronic
1188563160 X:31493244-31493266 ATGTCCTTCAAGAAGATTTTTGG - Intronic
1189808813 X:44762122-44762144 ATGTTCTTCCATAAGATCTTTGG - Intergenic
1189827851 X:44938258-44938280 ATTCCCTTCAAGAATGTTTTCGG - Intronic
1190001833 X:46696328-46696350 CTGTGCTTTAAGAATATTTTAGG - Intronic
1192295280 X:69841303-69841325 ATGTCCCTCAAGAAAAAATTTGG - Intronic
1193684758 X:84563786-84563808 AAGTCATTCAAGATGGTTTTGGG + Intergenic
1196396767 X:115272117-115272139 TTGTCCATCAAGGAAATTTTAGG - Intergenic
1197393869 X:125901871-125901893 ATGTCCTTCAAAATGTTTTTTGG + Intergenic
1197550424 X:127886098-127886120 ATCTCCTGCAGCAAGATTTTGGG + Intergenic
1198432314 X:136579755-136579777 ATGTCCTAAAACAAGATTGTGGG - Intergenic
1199545188 X:149001158-149001180 GTTTCCTTCAAAAAGATTTCTGG + Intergenic
1201601699 Y:15736641-15736663 ATCTTCTTTAAGAAGATTTCAGG - Intergenic