ID: 1188572303

View in Genome Browser
Species Human (GRCh38)
Location X:31602675-31602697
Sequence CTTCACATGCTGAATCTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 141}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188572300_1188572303 30 Left 1188572300 X:31602622-31602644 CCAAATTGAAGAAAACGGCTGTT 0: 1
1: 0
2: 1
3: 9
4: 118
Right 1188572303 X:31602675-31602697 CTTCACATGCTGAATCTGGAAGG 0: 1
1: 0
2: 1
3: 17
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188572303 Original CRISPR CTTCACATGCTGAATCTGGA AGG Intronic
900749696 1:4387591-4387613 GTTCTCATGCTGAATGAGGATGG + Intergenic
902843091 1:19087833-19087855 CCTCACGTGCTGCATCTGCAGGG - Exonic
905994863 1:42373107-42373129 CTTGACAGGCTTAATCTAGATGG + Intergenic
906532239 1:46530533-46530555 CTACACATGGTGAGGCTGGAGGG - Intergenic
909116210 1:71540625-71540647 TTTGACATGCTGAATCTAAAAGG + Intronic
913478597 1:119262894-119262916 CATCAGAAGCTGAATCTGTAAGG - Intergenic
920189790 1:204186285-204186307 CTTCAGATGCTGACATTGGAGGG - Intergenic
922571230 1:226635726-226635748 CTGCCCACGCTGAATCTGCAGGG - Intronic
922666263 1:227471991-227472013 CTTAACATGGTGAAGCAGGAGGG - Intergenic
1063069051 10:2640856-2640878 CCACACATGTTGAGTCTGGATGG + Intergenic
1064618605 10:17191436-17191458 CTGCAGATGCTTTATCTGGAAGG + Intronic
1065857105 10:29839557-29839579 CTTAGCATGCTGAAGCTGGGAGG + Intergenic
1066979904 10:42403242-42403264 GTTCACATGCTGAAGCAAGAGGG + Intergenic
1067008620 10:42690245-42690267 CTTCTCCTGCAGAATCTGGAGGG - Intergenic
1067457975 10:46437004-46437026 CTTCACATGGTGGAGCAGGAGGG + Intergenic
1070730094 10:78821109-78821131 CTTCACACGCTGCAACGGGAAGG + Intergenic
1070893665 10:79963233-79963255 CTTGGCAGGCTGAATCTGGGAGG + Intronic
1078627923 11:12975221-12975243 CTTCACATGCTAAATCTAATGGG + Intergenic
1080286633 11:30621807-30621829 CTGCAAACGCTGAATATGGAAGG + Intergenic
1082066383 11:47904100-47904122 CTTCACATGGTGGAGGTGGAGGG - Intergenic
1082080818 11:48011253-48011275 CTGCACAGGCTTGATCTGGATGG - Intronic
1087126971 11:94637907-94637929 ATTCCCAAGCTGAGTCTGGAAGG + Intergenic
1090051238 11:123381575-123381597 ATTAACATGCTGGAACTGGAAGG + Intergenic
1091000261 11:131905068-131905090 CTTCTCATGCTGGGACTGGAAGG - Intronic
1091044889 11:132316589-132316611 CTTAACATGCTAAATCTCTAGGG + Intronic
1093315731 12:17647513-17647535 CTTCACATGGTGGAGCAGGAGGG - Intergenic
1094447070 12:30543002-30543024 CTTCATATAATGAATTTGGAAGG + Intergenic
1095316940 12:40775218-40775240 CTTTAGATGCTGTATTTGGAAGG + Intronic
1096456386 12:51790729-51790751 GTTCACATGCTGATTCTTGGTGG - Intronic
1103142696 12:118563653-118563675 GTTCAAGTTCTGAATCTGGAGGG - Intergenic
1103702818 12:122856508-122856530 CTTCACCTGCTCCACCTGGAAGG - Exonic
1104264666 12:127220285-127220307 CTTAGCAAGCTGATTCTGGAGGG - Intergenic
1104883205 12:132086437-132086459 CACCACATGCTGACTCTGTAAGG - Intronic
1106765513 13:32909461-32909483 CTCCACCTCTTGAATCTGGAAGG - Intergenic
1116858790 14:49977436-49977458 CTTCATATGTCGAATCTGAAAGG + Intergenic
1117293192 14:54353515-54353537 CAGCACATGCTGGCTCTGGAGGG - Intergenic
1117976409 14:61301250-61301272 GTTCACAAGCTAAATCTGGAAGG + Intronic
1118227080 14:63911766-63911788 TTTCACATCCAGAATATGGAGGG + Intronic
1119244565 14:73092861-73092883 CTTAAAATTCTGAATCTGGCTGG - Intronic
1125006370 15:34822256-34822278 CCTCACATGCTGAAGCGGGATGG - Intergenic
1130176149 15:81573579-81573601 CTTTGCATACTGAATCTGCAAGG - Intergenic
1130851750 15:87801741-87801763 CTTTACATGCTTTATCTGGAAGG - Intergenic
1132708997 16:1258324-1258346 CTTCCCAGGGTGACTCTGGAGGG + Exonic
1134021817 16:10926283-10926305 ATTTACAAGCTGAACCTGGATGG - Exonic
1134820351 16:17241788-17241810 CTCCACATGCTGGAGTTGGAAGG + Intronic
1135327053 16:21533173-21533195 CCTCCCATGCTGAATCAGGATGG + Intergenic
1136337369 16:29619013-29619035 CCTCCCATGCTGAATCAGGATGG + Intergenic
1137351242 16:47715785-47715807 AGTCACATTCTGAAGCTGGAAGG + Intergenic
1140690301 16:77477398-77477420 CCTCACATGGTGAAGGTGGAGGG + Intergenic
1141453767 16:84124620-84124642 CTGCACAGCCTGAGTCTGGATGG - Exonic
1142040171 16:87888357-87888379 CCTCCCATGCTGAATCAGGATGG + Intronic
1143666594 17:8365677-8365699 CTTCACATGCAGAATCTCGCTGG + Intergenic
1150730150 17:67685782-67685804 TTTCACATACTGAAGGTGGATGG + Intronic
1152719209 17:81914688-81914710 CACCACATGCTGCACCTGGAAGG + Exonic
1155086654 18:22465546-22465568 AGTCACTTGCTGAATCTGAAAGG + Intergenic
1155540752 18:26865556-26865578 CTTCTTAGGCAGAATCTGGAAGG - Intronic
1158355722 18:56616836-56616858 CTTGACTGACTGAATCTGGAAGG + Intronic
1158836697 18:61337306-61337328 CTTCACATGCTGTTTTTAGAGGG - Intronic
1159214208 18:65368483-65368505 GTTAACGTGCTGAATCTGAAGGG + Intergenic
1159787626 18:72733099-72733121 ATTCAGATGAGGAATCTGGAGGG + Intergenic
1162591281 19:11593629-11593651 CTTCGCATAATGAATTTGGAAGG - Intronic
1163454194 19:17396534-17396556 CTTGACATAATAAATCTGGAAGG - Intergenic
1166556088 19:43700616-43700638 CTTCAACTGGTGAACCTGGAGGG + Intergenic
925531769 2:4871228-4871250 ATTCATATGCTAAATCTGCAGGG + Intergenic
927078210 2:19601449-19601471 TTTCTCATGATGAATGTGGATGG + Intergenic
929905560 2:46043049-46043071 CTTCAAATGTTTAATTTGGATGG - Intronic
930479281 2:51926451-51926473 CTTGCCATGTTGAAGCTGGAGGG - Intergenic
931418897 2:62107427-62107449 CTCCACTTGGTGAATATGGATGG + Intronic
935292871 2:101624840-101624862 TTTCCCTTGCGGAATCTGGAGGG - Intergenic
936111921 2:109671545-109671567 CTTCTCCTGGAGAATCTGGAGGG + Intergenic
939096040 2:137834566-137834588 CTTCCCATGCTGCACCTGGACGG + Intergenic
942559032 2:177200929-177200951 TATCACTTGCTGAATCAGGAGGG - Intergenic
943347125 2:186752243-186752265 GGTCACATGTTGAAGCTGGATGG + Intronic
943751405 2:191513494-191513516 TTTCTCATGCTGAATCTTGTTGG + Intergenic
944748016 2:202677667-202677689 CCTCACTTTCTTAATCTGGAGGG + Intronic
946100561 2:217316865-217316887 CATAAGATCCTGAATCTGGATGG + Intronic
946486109 2:220102421-220102443 CTTCAAATAGTGAATCAGGACGG - Intergenic
947653958 2:231810491-231810513 TTTCACCTGCTGAAGCTGAAGGG - Intergenic
1170503274 20:16996991-16997013 TTTCACATGCTGGTGCTGGAAGG - Intergenic
1172025009 20:31942645-31942667 CTCCAGATGCTGAATGTGGATGG - Intronic
1174936867 20:54880323-54880345 CTTCACATTCGAAATCTGTAGGG - Intergenic
1177031823 21:15989881-15989903 AATCAAATGCTTAATCTGGATGG - Intergenic
1177391471 21:20479003-20479025 ATACAAATGCTGAATTTGGAAGG - Intergenic
1178065365 21:28898896-28898918 CTTAATATTCTTAATCTGGATGG + Intergenic
1179470947 21:41609981-41610003 TTTCACATGCTGTATCTGAGTGG - Intergenic
1182488541 22:30654423-30654445 CTTCAGATGCACAACCTGGAGGG + Intronic
1182508213 22:30800605-30800627 CTACACATGCTCATTCTGGCAGG - Intronic
1182697709 22:32207601-32207623 CTTCTCCTGCAGAATCTGGAGGG + Intergenic
1182715171 22:32352543-32352565 CATCTCCTGCAGAATCTGGAGGG - Intergenic
1183637074 22:39070620-39070642 CTCCACAGGCTGAGTCAGGAAGG + Intronic
1185169747 22:49285892-49285914 CTTTACATCCTGAGGCTGGAAGG + Intergenic
951507122 3:23459652-23459674 GTTCACATGCTGAGTTTGTATGG - Intronic
951994768 3:28714804-28714826 CTACACTTGCTGAATCTTGAAGG + Intergenic
953343008 3:42151258-42151280 CTTGCCATGGTCAATCTGGAGGG + Intronic
954646222 3:52133203-52133225 CCTCACATGCAGAAGGTGGAAGG - Intronic
954856429 3:53647709-53647731 CTTCATTTGTTGAATGTGGAGGG + Intronic
956286384 3:67614622-67614644 CTTCACAGGCTGAAGGTGAAGGG + Intronic
956595752 3:70965282-70965304 CTGCCCATGCTGAATGTGAATGG - Intronic
956932763 3:74064177-74064199 CTTCAATTGATGAATTTGGAAGG + Intergenic
957038422 3:75316453-75316475 ATTCAGATGCTGAAACTTGATGG - Intergenic
957911379 3:86623627-86623649 CTTCTAATGGTGAATCTGGGAGG + Intergenic
958611318 3:96430507-96430529 AGTCACCTTCTGAATCTGGAAGG - Intergenic
962869765 3:139477824-139477846 CTTCACAGGATGAATCTCCAAGG - Intronic
962930470 3:140031220-140031242 CTTCACATGCAGAATGTGGAGGG + Intronic
963037753 3:141047361-141047383 CATCACATGGTGACTCTGTAGGG - Intergenic
963828246 3:149979212-149979234 CTTCACATGGTGGAGCGGGAGGG - Intronic
969861038 4:10035471-10035493 CTTCACCTTCTGCATCTCGAAGG + Intronic
970010763 4:11456390-11456412 CTTCACAGGATGAATATGAAGGG - Intergenic
970204509 4:13642738-13642760 GTTCCCTTGCTGAAGCTGGAAGG + Intergenic
974470971 4:62316885-62316907 CTGCACATTCTGATCCTGGAGGG - Intergenic
975740418 4:77424175-77424197 ATTCACATGCTGAAACTTAATGG - Intronic
976943993 4:90741508-90741530 CATCAGATACTGAATCTGGCTGG + Intronic
978827092 4:113038627-113038649 CTTCACCCCTTGAATCTGGAAGG + Intronic
979626737 4:122853357-122853379 CATCACACTCTGATTCTGGAGGG - Intronic
981139257 4:141249356-141249378 CTTTAAATGCTGAATCTAAATGG + Intergenic
986753130 5:10808375-10808397 CTTCACTTTTTGACTCTGGAAGG - Intergenic
986831768 5:11588219-11588241 CTTCACATGGTGACTCTGGTTGG + Intronic
994572463 5:101531802-101531824 CTTCAGTTTCTGAATTTGGAGGG - Intergenic
996319697 5:122201041-122201063 CCACACATGCTGAGTCAGGAGGG - Intergenic
997037866 5:130214298-130214320 CTTCAGATGATATATCTGGAGGG + Intergenic
997522791 5:134534034-134534056 CTTGACACGCAGACTCTGGAAGG + Intronic
999322449 5:150624052-150624074 CTTCGCACGCTCAATCTGAATGG + Intronic
1000471888 5:161653158-161653180 CTTCACAGGCTGTATTTTGAAGG - Intronic
1006382897 6:33711155-33711177 CTTCAAATGCAGAATCTCTAGGG - Intronic
1006560269 6:34905157-34905179 CATCACATGATGAATCTGGCTGG + Intronic
1009345327 6:62607766-62607788 AGTCACCTTCTGAATCTGGAAGG + Intergenic
1010054938 6:71554271-71554293 CATCACATGGTGTATCTTGAAGG + Intergenic
1012287221 6:97405631-97405653 CTCCACATTCTGAATCTGTAGGG + Intergenic
1017231011 6:152073815-152073837 TTGCAGATGCTGCATCTGGAGGG - Intronic
1017971913 6:159319347-159319369 GTTCAGAGGTTGAATCTGGAAGG - Intergenic
1019840651 7:3439537-3439559 CTACTCATTCTGAATCTGTAAGG + Intronic
1020352413 7:7235688-7235710 TTACACATGCTGAGTCTGAAGGG - Intronic
1022645802 7:32227671-32227693 CTTCCCACACTGAATCAGGAAGG + Intronic
1023745430 7:43318722-43318744 GTTCACATGCTGCATCTGGCTGG - Intronic
1024370375 7:48576398-48576420 CTTCACATGGAGAATCTGGTAGG - Intronic
1026117500 7:67508356-67508378 TTTCATCTGCTGAATCTGCATGG + Intergenic
1027554525 7:79647436-79647458 CTTAAAATTCAGAATCTGGATGG - Intergenic
1028090887 7:86699334-86699356 ATCCAGATGCAGAATCTGGATGG + Intronic
1029329395 7:99839373-99839395 GTTCACATACTGAATATGCATGG - Intronic
1031303608 7:120096214-120096236 CTACACATGCTGAAATTGCATGG - Intergenic
1031890879 7:127292227-127292249 CTTCTCATGCTGAATTTATATGG + Intergenic
1033591291 7:142810666-142810688 ATTCAGATGCTGATTCTGTAGGG - Intergenic
1034368295 7:150570909-150570931 CTTCAACTGTTGAATCTGGGTGG - Intronic
1035734875 8:1880946-1880968 CCTCACATGCAGCATCTGGCTGG + Intronic
1038417983 8:27411540-27411562 CTTAACATGATGAGGCTGGAGGG + Intronic
1039631172 8:39112996-39113018 CTTCACTCTCTGAATCTGGTTGG + Intronic
1039848086 8:41340328-41340350 GTTCACATCCAGAAGCTGGAAGG - Intergenic
1041784922 8:61621087-61621109 CTTCCCATGCTGTATCTAAAAGG + Intronic
1044668606 8:94655947-94655969 CTCCAGAGGCTGAAGCTGGAGGG + Intronic
1048790861 8:138102029-138102051 CTTCAGGTTCAGAATCTGGATGG + Intergenic
1052700374 9:31931200-31931222 CACCACATGCTGATTCAGGATGG - Intergenic
1057734708 9:97645234-97645256 CCCCTCATGCTGAATCTTGAGGG + Intronic
1059302652 9:113327537-113327559 CTTGTCATGCTGAATATTGATGG + Intronic
1188572303 X:31602675-31602697 CTTCACATGCTGAATCTGGAAGG + Intronic
1189582390 X:42420532-42420554 CTCCACTAGCTGAATCTGAAGGG - Intergenic
1196987677 X:121292892-121292914 CCTCAAATGGTGATTCTGGAGGG - Intergenic
1197187424 X:123603461-123603483 CATTAGATGCTGATTCTGGATGG + Intronic
1197239992 X:124113894-124113916 CTGGACAGGCTGAATGTGGAAGG - Intronic
1197304716 X:124827467-124827489 CTTCTCATGCTAAACCTGGCAGG + Intronic
1198686672 X:139234964-139234986 ATCCACATGATGACTCTGGAAGG - Intergenic