ID: 1188572630

View in Genome Browser
Species Human (GRCh38)
Location X:31606668-31606690
Sequence TTTATTTTTTCACCAAACCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 662
Summary {0: 1, 1: 0, 2: 5, 3: 59, 4: 597}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188572630 Original CRISPR TTTATTTTTTCACCAAACCA AGG Intronic
901840302 1:11950065-11950087 TTTATCTTTTCACCAAGCCTGGG - Intronic
903486773 1:23695247-23695269 TTTATTGTTGGACCAAAACACGG - Intronic
903582551 1:24382774-24382796 TTTTTTTTTTAACCACACAAAGG - Intronic
903605953 1:24575294-24575316 TTTATTTTTTTTCCAACCCGAGG - Intronic
904811220 1:33164600-33164622 TTTGTTTGTTTCCCAAACCACGG + Intronic
905783504 1:40733476-40733498 TTTTTTTTTTCTCAAAGCCAGGG - Intronic
907013283 1:50985784-50985806 TTTTTTTTTTCCCCAAGACAAGG + Intergenic
907150500 1:52281953-52281975 TTTATAATTTCTTCAAACCATGG - Intronic
907348935 1:53809958-53809980 GGTATTTTTTAACTAAACCATGG - Intronic
907570632 1:55479884-55479906 TTCTTTGTTTCAACAAACCATGG + Intergenic
907878427 1:58518579-58518601 TTAATTTTTTCACCAAGTCCTGG - Intronic
908032188 1:60013235-60013257 TTTTCTTTTTCACAATACCAAGG + Intronic
908152225 1:61313682-61313704 TTTTTTTTCTCACCAAATGATGG - Intronic
909326216 1:74353629-74353651 TTTTTTTGATCACCAAATCAAGG - Intronic
909503950 1:76366704-76366726 TGTATTTTTTTGCCAGACCAGGG - Intronic
910333437 1:86102017-86102039 TTTTTTTTTTAACCAAAAAAAGG + Intronic
910443156 1:87273547-87273569 TTGCTTTTTTCCCCACACCAAGG - Intergenic
910513979 1:88037333-88037355 TTTGTTTCTTCCCCAGACCAAGG - Intergenic
910767280 1:90794376-90794398 TTTTTTTTTTCACTTGACCAGGG + Intergenic
911471600 1:98326137-98326159 TTTATTTTTTGTCAAAACAAGGG + Intergenic
911558557 1:99376697-99376719 TTTATTTTTTCACAAAATTAAGG - Intergenic
911749983 1:101485126-101485148 TTTATTCTTACAGCAATCCAGGG + Intergenic
911997342 1:104783526-104783548 TTTATCTTTTCTCCAAAGCTGGG - Intergenic
912550871 1:110484421-110484443 TTTATTTCTCCACCAATCCTGGG + Intergenic
913218199 1:116638206-116638228 TTTGTTCTTTCATCAAGCCAGGG + Intronic
914327783 1:146637176-146637198 TTTATTCTTTAACCCATCCAAGG - Intergenic
915684472 1:157617579-157617601 TTTATTTTTTCACAATACTGGGG + Intergenic
916418149 1:164611620-164611642 TTTTTTTTTTTTCCTAACCAAGG - Intronic
916804488 1:168244878-168244900 ATTATTTTTTAAACAAAGCATGG - Exonic
917556674 1:176097215-176097237 GTTTTTTTTTCAACAAAACAAGG - Intronic
917638614 1:176960685-176960707 CTTCTTTTTTCACCAAACCCTGG + Intronic
918123618 1:181561669-181561691 TTTGTTTATTCACCAATCGAGGG + Intronic
918273142 1:182922956-182922978 TTTATTCTTTCAAAAAACAAAGG - Intronic
918977083 1:191503700-191503722 TTTATTTATTCAACAAACATTGG - Intergenic
920630038 1:207643565-207643587 TTTCTGGGTTCACCAAACCACGG - Intergenic
920640788 1:207750315-207750337 TTTCTGGGTTCACCAAACCATGG - Intergenic
921990572 1:221361531-221361553 TTCATTTTTTCACTACTCCAAGG - Intergenic
923401374 1:233618540-233618562 TTTATTCATTCCCCAAAGCAAGG + Intronic
923950469 1:238945809-238945831 TTTATTTTTTAACTACACTAAGG - Intergenic
923994438 1:239476850-239476872 ATTATTTTGTCACCTAACAATGG - Intronic
1063914706 10:10869661-10869683 TGTAATTTTTCATAAAACCAGGG - Intergenic
1064136405 10:12754421-12754443 TTTGTTTCTTCACCAAATCATGG - Intronic
1064178205 10:13093757-13093779 CTTATTTTTTTTCCAAACTAAGG - Intronic
1064584396 10:16824840-16824862 TATGGTTTTTCACCAAACCATGG - Exonic
1065598504 10:27343699-27343721 TTTATTTTTTCTCAAATGCAGGG + Intergenic
1066608887 10:37213740-37213762 ATTATTTTTGAACCAACCCAGGG + Intronic
1067322228 10:45231884-45231906 TTATGGTTTTCACCAAACCATGG - Intergenic
1067578889 10:47426603-47426625 TTTATATCTTCTCCAAATCAAGG - Intergenic
1067805513 10:49389844-49389866 TTTTTTTTTTTTCCAAAGCAAGG + Intronic
1068182175 10:53535019-53535041 TTTTTTTTTTAAGAAAACCATGG - Intergenic
1068349479 10:55823955-55823977 TTTTTTTTTTTACAAAATCATGG + Intergenic
1068395851 10:56460586-56460608 TTTATCATTTCAACAAATCAGGG + Intergenic
1068751662 10:60600616-60600638 TTTGTCTTTCCACCAAACCATGG + Intronic
1068806313 10:61197792-61197814 TTTATTTTTTCACATAAAAATGG + Intergenic
1069274636 10:66574373-66574395 TTTATTTCTTTACAAAAACATGG - Intronic
1069334790 10:67335387-67335409 TTTATTTTGACACCAAACAGTGG + Intronic
1069489941 10:68852588-68852610 TTTTTTTTTTCTCCAAGACAGGG + Intronic
1070046228 10:72839603-72839625 TTTATTCATTCACCAAATGAGGG + Intronic
1070548495 10:77472533-77472555 TTTATTTTTTTATTAAAGCAAGG - Intronic
1071444262 10:85731281-85731303 TTTATTTATTCATCACACCAAGG - Intronic
1073702432 10:105943629-105943651 TTGATCTTTGCAGCAAACCATGG - Intergenic
1074411018 10:113228718-113228740 TTTCTCTTTTCACAAAACCCTGG - Intergenic
1074457079 10:113604547-113604569 TTTCTCCTTTCACCAAACCCGGG - Intronic
1075581051 10:123618758-123618780 TTCATTTTTTCAACAAACAATGG - Intergenic
1076060451 10:127410041-127410063 TTAATATTTTCACCAGAACATGG - Intronic
1077720554 11:4624362-4624384 TTTTTTTTTTTCCCAAAACAGGG + Intergenic
1077927041 11:6691567-6691589 TTTCTTTTTTCAATAAATCAAGG + Intergenic
1078278565 11:9875962-9875984 TTTTTTTTTTCACTAATACATGG + Intronic
1078839930 11:15069040-15069062 TTTCCTTTTTCAGGAAACCAAGG + Intronic
1078931668 11:15917059-15917081 TTTATATTCTCACCAACACATGG + Intergenic
1078993233 11:16670219-16670241 TTTGTTTCTTCCCCAGACCAAGG - Intronic
1079209492 11:18448686-18448708 TTCACATTTTCACCAAATCAAGG + Intronic
1079849085 11:25507036-25507058 TTTATATTATAACCAAACTATGG + Intergenic
1080463073 11:32472636-32472658 TCTATTGTTACAACAAACCATGG + Intergenic
1080502065 11:32880374-32880396 TTTATTTTTTTAAGAAACAATGG - Intergenic
1080676987 11:34437406-34437428 TTTATTTATTCAACAAACTGTGG + Intergenic
1080969082 11:37248174-37248196 TTTATTTTTATACCAAACCCTGG - Intergenic
1081102327 11:39020353-39020375 TTTATGTATTCAACAAAGCAGGG - Intergenic
1081197855 11:40183350-40183372 GTTATTTTTTCCCCCAAACAGGG - Intronic
1081283497 11:41240295-41240317 TTTGTATTTTCCCCAAAGCATGG - Intronic
1081327298 11:41760397-41760419 TTTATTTTATAGCCAAACTATGG - Intergenic
1081343678 11:41956802-41956824 TTTGTTTTTTCCCCAGAACAAGG - Intergenic
1081723332 11:45306044-45306066 TTTATCTATTCACCAATCCAAGG + Intergenic
1085063134 11:73467021-73467043 TTTATTTTTTAACCCAACCTTGG - Intronic
1085873078 11:80373248-80373270 TTTTTTTTTTTGCCAAACTATGG - Intergenic
1086313508 11:85563707-85563729 TTTATCTGTTCACCAAGCCATGG + Intronic
1086511412 11:87562156-87562178 TCTTTTTTCTCCCCAAACCAGGG + Intergenic
1086990640 11:93300074-93300096 ATTATTTTTGCACCAACCCATGG + Intergenic
1087286282 11:96268300-96268322 TTTATTTTTTGTCAAGACCAGGG - Intronic
1087287571 11:96281573-96281595 TTTAATATTTCTCAAAACCAGGG - Intronic
1087499768 11:98935076-98935098 TTTATGTTTTCAACATACCCTGG - Intergenic
1087960324 11:104340175-104340197 GTTCTTTTTTCACCTGACCAAGG - Intergenic
1090040149 11:123283492-123283514 TTTATTATTACAGCAATCCAAGG - Intergenic
1090133040 11:124165106-124165128 TTTATTTATTCAACAAATGAAGG - Intergenic
1090283273 11:125476863-125476885 TGGTTTTTTTCACCAAAACAAGG + Intronic
1090418384 11:126556620-126556642 TTCTTTTTTTCACCAAAACAAGG - Intronic
1090513681 11:127401760-127401782 TTTATTTCTTCATGAAACAATGG - Intergenic
1090532010 11:127600699-127600721 TTAATTTGTTACCCAAACCAGGG + Intergenic
1090777832 11:129980635-129980657 TTTATTATTTGACCACAACAAGG + Intronic
1090982182 11:131733180-131733202 ATAATTTTTTCATTAAACCAAGG - Intronic
1091914637 12:4261840-4261862 TTTACTTTTTCACTTCACCATGG - Intergenic
1092822795 12:12368853-12368875 TTTATTTATTCAACAAACACTGG + Intronic
1093026815 12:14253107-14253129 TTTATTTTTTCACAGAGACAGGG - Intergenic
1093213541 12:16335855-16335877 TTTAGTTTTTCAGCAAACTTAGG + Intergenic
1093430060 12:19074322-19074344 GTTATTTTTCCACCAAACAATGG - Intergenic
1093643662 12:21556828-21556850 TTGATGTTTTTACAAAACCATGG - Intronic
1093861928 12:24176320-24176342 TTTTTTTCTTCCCCAAAACAGGG - Intergenic
1093903855 12:24666137-24666159 TTTATTTCTTGAGCATACCAAGG - Intergenic
1094016823 12:25873748-25873770 TTTATTTTTTCCACAAATCCAGG - Intergenic
1094402687 12:30079143-30079165 CTTATTTTTTCACCCAATAAAGG + Intergenic
1095406947 12:41877153-41877175 TTTATCTTTTCACCCATCAATGG - Intergenic
1095619004 12:44226838-44226860 TTTATTTTCTCTCCATTCCAGGG - Intronic
1095757501 12:45785531-45785553 TTTTTTTTTCCACTAACCCAGGG - Intronic
1095839042 12:46671733-46671755 TTTTTTTTTTCATTATACCAGGG - Intergenic
1097091846 12:56511908-56511930 TTTCTATTGTCACCAAACCCTGG - Intergenic
1097230081 12:57505500-57505522 TTTTTTTTTTCTCCAAGCCCAGG - Intronic
1097325648 12:58273416-58273438 TTTATTTTTTTAAACAACCATGG + Intergenic
1098350957 12:69559566-69559588 TTTAAATTTTCACCTAACAAGGG + Intronic
1098499572 12:71175494-71175516 TTTATTTTATCATTAAAGCATGG + Intronic
1098521376 12:71438478-71438500 TTTGTTTTTTCACCCAAGAAAGG + Intronic
1099012390 12:77307444-77307466 TTATTTTTTTAACCCAACCAGGG - Intergenic
1100093022 12:90994780-90994802 TTTATTTTTAAAACAAAACAAGG - Intronic
1100155707 12:91798079-91798101 TTAATTTCTTCACAAAGCCAAGG + Intergenic
1100165705 12:91915261-91915283 TTTATTTTTTTTCCAAAAAAAGG + Intergenic
1101297772 12:103442268-103442290 GTTATTTCTTCACAAAAGCAAGG + Intronic
1102302613 12:111781682-111781704 TTCATTTTTTAAAGAAACCAAGG + Intronic
1104678307 12:130730670-130730692 TTTTTTTTTTCACGTAATCAAGG - Intergenic
1105768776 13:23587515-23587537 TTTATTTATTCAACAAACATTGG - Intronic
1106076940 13:26468441-26468463 TTTATTTTTGCAGCAATCCAAGG - Intergenic
1106632097 13:31485377-31485399 TTTATTGCTTCACCATCCCAAGG + Intergenic
1107291387 13:38858201-38858223 TTTCTTTCTTCACCGAACAAAGG + Intronic
1107784017 13:43936216-43936238 TTTTATTTCTCACCAAACAAAGG - Intergenic
1108095463 13:46896140-46896162 ATTATTTTCTCACCAAACCGAGG + Exonic
1108301706 13:49083818-49083840 TTTATAATATCACCCAACCAGGG - Intronic
1108589015 13:51895705-51895727 TTTATTTTTTCCCCCATCCCAGG - Intergenic
1109054555 13:57531328-57531350 TTTATATTTTACTCAAACCAAGG + Intergenic
1109487243 13:63042112-63042134 TTTATTTATTCAACAAATTAAGG - Intergenic
1109507704 13:63328345-63328367 TTAATATTTGCACCAATCCAAGG + Intergenic
1110302247 13:73942499-73942521 TTTATTGATTAACCTAACCATGG - Intronic
1110895715 13:80750192-80750214 TTTATTTTTCAACTAAATCATGG - Intergenic
1111062884 13:83046238-83046260 TTTATTTTCTGACCACACGAGGG - Intergenic
1111285144 13:86081257-86081279 CTGTTTCTTTCACCAAACCATGG - Intergenic
1111338039 13:86847487-86847509 TTTGTTTCTTCCCCAGACCAAGG - Intergenic
1111947914 13:94684664-94684686 TTTTTTTTTTTTCCAAAACAGGG - Intergenic
1112115722 13:96351090-96351112 TTAATTATTTCTCTAAACCATGG - Intronic
1112422000 13:99260716-99260738 TTTTTTTTTTCCCCAAACAGAGG + Intronic
1112503979 13:99963666-99963688 TTTTTTTTTTAAATAAACCATGG + Exonic
1113146379 13:107212593-107212615 ATGATTTCTTAACCAAACCATGG + Intronic
1113338615 13:109400611-109400633 TTTAGTTTTTCAAGAAACCTTGG - Intergenic
1114393326 14:22333599-22333621 TCTTTTGTTTCACCAAACAAAGG - Intergenic
1114583686 14:23789357-23789379 ATTATTTTCTCACCAAAAAATGG - Intergenic
1114850342 14:26375849-26375871 ATTATGTTTTCCCCAAATCATGG - Intergenic
1115073863 14:29362065-29362087 TTTTTTTTTTCACCAAAGGCAGG - Intergenic
1115356968 14:32458989-32459011 TCTATCTTTTCACCAATCGATGG - Intronic
1115388906 14:32831383-32831405 TTTATTTTGACACTAAAACATGG + Exonic
1116717982 14:48452347-48452369 TTTATTTTTGCAGATAACCATGG + Intergenic
1117087803 14:52219517-52219539 TTTTTTTTTTAACCAAGACAGGG + Intergenic
1117128523 14:52659569-52659591 TTAATTCTTTCACCAATCCTAGG - Intronic
1117303721 14:54452898-54452920 TTTTTTTTTTCCCCGAAACACGG + Intergenic
1117452440 14:55864999-55865021 TTTGTTTCTTCCCCAGACCAAGG + Intergenic
1118078499 14:62329343-62329365 TTAATTTTTTAAACAAACAAGGG + Intergenic
1118998596 14:70860443-70860465 TTTATATTTACTCCAAGCCATGG + Intergenic
1119194966 14:72710887-72710909 TTTATGTTTTACCCAATCCATGG - Intronic
1120131605 14:80814471-80814493 TTTTTTTTTTAACCAAATAATGG - Intronic
1120658355 14:87222553-87222575 TTGATTTTTTCATTAACCCAGGG - Intergenic
1121771763 14:96550908-96550930 TTTAATATTCCACCAACCCATGG + Intronic
1122627014 14:103089991-103090013 TTTATTTCTGCTTCAAACCACGG - Intergenic
1124769131 15:32515201-32515223 TTTTTTTTTTCTCTAAAGCAGGG + Intergenic
1124884592 15:33673210-33673232 TTTAAAAGTTCACCAAACCAAGG + Intronic
1125284235 15:38074593-38074615 TGTATTTTTTAGCCACACCAAGG - Intergenic
1125287352 15:38108090-38108112 TTTTTTTTTTCCCCAAAAAATGG - Intergenic
1127116752 15:55735707-55735729 TTTTTTTTTTTAGCAAAGCATGG - Intronic
1127131337 15:55867709-55867731 GTTCTTTGATCACCAAACCAGGG + Intronic
1127366448 15:58295028-58295050 CTTTTTTTTTCACCAGAGCATGG + Intronic
1127753775 15:62069861-62069883 TTTGTTTTTTCACCAAAAGCAGG - Exonic
1127803139 15:62494617-62494639 TTTATTTTTCAACTAAAGCACGG - Intronic
1127904904 15:63369188-63369210 TTTATATTTTCAATAAACAAAGG - Intronic
1128374212 15:67064413-67064435 TTTTTTTTTTTAACAAAGCAGGG + Intronic
1128587716 15:68865347-68865369 TTTTTTTTTTGACCAAAAAATGG - Intronic
1128956295 15:71949426-71949448 TTTTTTTTTTAACCAAATAAGGG + Intronic
1129416742 15:75387491-75387513 TTTTTTTTTTTTCCAACCCAGGG - Intronic
1130163139 15:81422664-81422686 TCTGTTATCTCACCAAACCAAGG - Intergenic
1131515656 15:93074616-93074638 AATATTTTTCCCCCAAACCAGGG + Intronic
1131714277 15:95091391-95091413 TTTTTTTTTTTCCCAAACCATGG - Intergenic
1132056960 15:98659240-98659262 TTTTTTTTTTCAGTAAACGATGG + Intronic
1132165561 15:99584874-99584896 TTTATTTTTTCAGAAAAGAACGG + Intronic
1133339713 16:5028409-5028431 TTTATTTTTTCATAAAGACAGGG + Intronic
1133511969 16:6468256-6468278 TTGACTTTTTCACCAAATAAAGG + Intronic
1134879479 16:17732715-17732737 TTTATTCTTTTACAAAAGCAAGG - Intergenic
1135620568 16:23951777-23951799 TTTATTTTTAGACTAAATCACGG - Intronic
1137531186 16:49280144-49280166 TGTATTTCCTCCCCAAACCACGG + Intronic
1137900687 16:52265056-52265078 TATATTTTCACAACAAACCATGG - Intergenic
1137932747 16:52604194-52604216 AGTATTTTCTCACCAACCCAAGG + Intergenic
1137962430 16:52896143-52896165 TTTATATTTATGCCAAACCAGGG - Intergenic
1138003717 16:53310326-53310348 TTTTTTTTTTCACCAGAAAATGG + Intronic
1138428742 16:56953939-56953961 TTTATTTTTTGTACAGACCAGGG - Intergenic
1138566620 16:57838022-57838044 TATATTTTTTCCCCTAACCCCGG - Intronic
1139105978 16:63826743-63826765 TTCATATTTTACCCAAACCAAGG - Intergenic
1139205079 16:65020982-65021004 TTTTTTTTTTTACCAAATCCTGG + Intronic
1139456498 16:67082964-67082986 TTTATTTTTTGACCAAACCGTGG - Intronic
1140005776 16:71073761-71073783 TTTATTCTTTAACCCATCCAAGG + Intronic
1140140489 16:72251979-72252001 TTTCTCCTTTCACCAAACAATGG - Intergenic
1140886403 16:79247708-79247730 TTTATTTTTTTAACCAACAAAGG - Intergenic
1141372538 16:83500906-83500928 TTTATTTGTTGACCAAACAGAGG + Intronic
1145718938 17:27050034-27050056 TTTATTCTTTGCCCATACCAAGG - Intergenic
1146593535 17:34149993-34150015 TTTATTTATTCACCTATCAATGG - Intronic
1146932716 17:36789262-36789284 TTTATTTTTTCTAGAGACCAGGG + Intergenic
1149568130 17:57653602-57653624 TTTATCTTTTCCCCAACCCCAGG - Intronic
1149914022 17:60591886-60591908 TGTATTATTTCACCAAAAGAAGG + Intergenic
1151040615 17:70856220-70856242 TTTATTTATTCATCAATCTACGG + Intergenic
1151085967 17:71380988-71381010 TTTATTTTCTCACTAAATCAAGG + Intergenic
1151781958 17:76252687-76252709 TTTTTTTTTTCACTATACCCGGG + Intergenic
1152969306 18:146238-146260 TTTATTTTTTAAAAAAACAATGG + Intergenic
1153141632 18:1979196-1979218 TTTATTTATTCAGCAACCAATGG + Intergenic
1153165769 18:2260309-2260331 TTTGTTTTTTAAACAACCCACGG - Intergenic
1153243931 18:3055309-3055331 TTTATTTTTTCTCGAAGTCAGGG + Intergenic
1153359089 18:4173733-4173755 TCTTATTTTTCACCAAATCACGG - Intronic
1153424339 18:4945611-4945633 TTTGTTTTTTCCTCAGACCAAGG - Intergenic
1154470207 18:14693328-14693350 TTTATTCTTTCCCCAGGCCAAGG + Intergenic
1155608932 18:27640861-27640883 TTGATCTTTGCAGCAAACCACGG + Intergenic
1155646082 18:28079569-28079591 TTTATTTTAAAACAAAACCAAGG + Intronic
1155835046 18:30570711-30570733 TTTATTGTGTTACCAAGCCAAGG + Intergenic
1156262430 18:35458226-35458248 TTTTTTTTTTTACCTTACCAGGG + Intronic
1156272876 18:35553073-35553095 TTTTTTTTTTTAGCAAAACAGGG - Intergenic
1156750769 18:40452162-40452184 TTTAGTTTTACAATAAACCAGGG - Intergenic
1156833019 18:41518288-41518310 TTTATTTTATTACTAAAACAGGG - Intergenic
1157696548 18:49728164-49728186 TTGATTATTACTCCAAACCATGG - Intergenic
1158263647 18:55636340-55636362 TTTTTTTTTTAACCATCCCAAGG - Intronic
1159097387 18:63919625-63919647 TTTAGTTTTTGACCAAAACTGGG + Intronic
1159492834 18:69161022-69161044 TTTATTCTTCCAACAACCCAAGG - Intergenic
1159658796 18:71066740-71066762 TTCATTTTTTTTCCAAACCATGG - Intergenic
1161651692 19:5489691-5489713 ATTAGATTTTCACCAAACGAGGG - Intergenic
1162085047 19:8243653-8243675 TTTTTTTTTCCCCCAAAACAGGG + Intronic
1162961928 19:14133267-14133289 TTTATCTTTGCTCCAATCCAGGG - Intronic
1164335888 19:24321018-24321040 TTTCCTTTTTCAGGAAACCAAGG - Intergenic
1164469279 19:28515602-28515624 TTTGTTTATTTACCAAACCAGGG + Intergenic
1165650070 19:37479927-37479949 TTTATCTTTTAACCAAATGATGG + Intronic
1166427519 19:42692762-42692784 TTTTTTTTTTTACAAAATCATGG + Intronic
1166438580 19:42790327-42790349 TTTTTTTTTTCACCAAATTGTGG + Intronic
925617891 2:5761356-5761378 TTTATATTTTTAGCAAACAAGGG + Intergenic
925619537 2:5777758-5777780 TTTATTTTTTGACACAATCATGG - Intergenic
926641467 2:15242512-15242534 TATATTTTTTAACCATACCCTGG - Intronic
926966918 2:18425254-18425276 TTGATATTATCACCAGACCATGG - Intergenic
927170280 2:20363535-20363557 CTTATTTTGTCACTAATCCAGGG + Intergenic
927628839 2:24752882-24752904 TTTTTTTTTTCTCCAAATCCTGG + Intronic
928317961 2:30260395-30260417 TTTAATTTTTCACCAAGGCAGGG - Intronic
930485006 2:52000230-52000252 TTTTTTTTTTCACTACACCAGGG + Intergenic
930936330 2:56956738-56956760 TTTACTTTTTCTTCAAAGCAAGG - Intergenic
930965856 2:57325811-57325833 TTTATTTTTTAACAAATACAAGG + Intergenic
930996027 2:57719491-57719513 TTTATTTATTCACTGATCCATGG - Intergenic
931079385 2:58752438-58752460 TTTATTTTTTCACAAAAATAAGG + Intergenic
932282344 2:70504526-70504548 TTTATCTTATCACAAAACTATGG - Intronic
933320437 2:80769353-80769375 TTTATTTTTTCCTCAAATCAGGG - Intergenic
933411885 2:81936218-81936240 TTTTTTTTTTAACCAACCAATGG - Intergenic
933501520 2:83117960-83117982 TTTTTTTTTTCAACAAGGCAAGG - Intergenic
934138603 2:89022099-89022121 TTTTTTTTTTATCCAATCCACGG - Intergenic
934230642 2:90178464-90178486 TTTTTTTTTTATCCAATCCACGG + Intergenic
937002474 2:118480123-118480145 TATAATTTATCACAAAACCATGG + Intergenic
937003438 2:118489469-118489491 TTTAATCTTGCACCAGACCAGGG + Intergenic
937104874 2:119301323-119301345 TTAACTTTTTCAACAAAGCAAGG + Intergenic
937429361 2:121825534-121825556 TTTATTTGTTCAGCAAACATGGG + Intergenic
938113045 2:128581849-128581871 CTTATTTTGTCACCTACCCAAGG - Intergenic
938411121 2:131065440-131065462 TTTAATTTTTAAACAAACCAAGG + Intronic
939070971 2:137542068-137542090 TATATTTTTTCATCAAACTCAGG - Intronic
939122455 2:138134213-138134235 TTTACTTATTCATCAAAGCATGG - Intergenic
939219975 2:139289185-139289207 TATATTTTTTCTCCAAAGTAAGG + Intergenic
939583535 2:143979999-143980021 TCTTTTTTTTCAGCAAAACAAGG + Intronic
939666046 2:144952786-144952808 TTTATTTTTACAGCAACCCTAGG - Intergenic
939909179 2:147960001-147960023 TTTATTTTTTTTGCAATCCATGG + Intronic
939988969 2:148859465-148859487 TTTTTATTCTCACCAATCCATGG - Intergenic
940214807 2:151294039-151294061 TTTATTTTTCCAGCATTCCAAGG - Intergenic
940355694 2:152738955-152738977 TTTATTCATTCACAAAAACATGG - Intronic
941013817 2:160331954-160331976 TTAATTTTTTGACAAATCCATGG - Intronic
941509934 2:166394869-166394891 AATATTTATTCAGCAAACCAAGG + Intergenic
941520765 2:166539255-166539277 TTCTTATTTTCACCAAATCAGGG + Intergenic
941768200 2:169322031-169322053 TTTATTCTTTCACAAACCCAAGG + Intronic
942354241 2:175090938-175090960 TTTATTATTGCAGAAAACCATGG - Intronic
942433872 2:175949130-175949152 TTTAGTCTTTAACCAAGCCATGG + Intronic
942725834 2:179006512-179006534 ATTATTGTATCACTAAACCATGG - Intronic
943611806 2:190043874-190043896 TGGGTGTTTTCACCAAACCAAGG + Intronic
944241527 2:197490237-197490259 TTTCTATTGTCACCAAACCCTGG + Exonic
944317264 2:198296271-198296293 TTTTTTTTTTCACTAATTCATGG - Intronic
945143989 2:206716643-206716665 TTTTTTTTTTCTCCAAACATAGG - Intronic
948337849 2:237224473-237224495 TTTCTGCTTTCACCAAACCCAGG + Intergenic
1168767241 20:389944-389966 TTTGTTTTTTAACCACAGCATGG - Intronic
1168857288 20:1017564-1017586 TTTGTTCCTTCAGCAAACCAAGG + Intergenic
1169850958 20:10050056-10050078 TTAATATTATCACCAAAGCAGGG + Exonic
1170141325 20:13127739-13127761 TTTTCTTTTTCACTAAAGCAGGG + Intronic
1170324948 20:15147435-15147457 TTTTTTTTTTTACCCAGCCAGGG + Intronic
1170558555 20:17535947-17535969 TTTATTTTTTTAAAAAAACAGGG + Intronic
1170779376 20:19410572-19410594 CTTATTTTTCAACCCAACCAGGG - Intronic
1170973079 20:21134671-21134693 TTTTTTTTTTCCCCAAGACAGGG + Intronic
1171347504 20:24477343-24477365 TTTCTTTTTTTACCAGAGCAGGG + Intronic
1172579559 20:36036167-36036189 TTTATTTTTCCCCCAAACAGTGG - Intergenic
1173157479 20:40626665-40626687 TTTCATTTTTCCCCATACCATGG + Intergenic
1173210437 20:41028245-41028267 TTTAATTTTTCAACCAACCAAGG - Intergenic
1173266045 20:41483066-41483088 TTTTTTTTTTAAGCAAAGCAAGG + Intronic
1173429684 20:42975854-42975876 TTTATTTCTTCCCCAAAACGGGG - Intronic
1173442144 20:43087379-43087401 TTTTTTTTTTCTCCGAAACAGGG + Intronic
1173453777 20:43188526-43188548 TTTATTATTTCACCGAAAGAAGG - Intronic
1174371643 20:50093032-50093054 TTTACTTTTTCACAATATCATGG + Intronic
1174735063 20:52958282-52958304 TTTATTTTTTTGAGAAACCAGGG + Intergenic
1174749064 20:53093996-53094018 TTTTTTTTTTAAATAAACCAGGG + Intronic
1174929141 20:54794183-54794205 TTTGTTTCTTCCCCAGACCAAGG + Intergenic
1175325420 20:58123832-58123854 TTTATTCATTCACCAATCAAAGG - Intergenic
1176804288 21:13464537-13464559 TTTATTCTTTCCCCAGGCCAAGG - Intergenic
1177289640 21:19094571-19094593 GCTATTATTTAACCAAACCATGG - Intergenic
1177428792 21:20961590-20961612 TTTACTTTTTCACCTAAACCAGG - Intergenic
1177698978 21:24612205-24612227 TTTATTTTTTTAACAAAAGAAGG + Intergenic
1178064393 21:28888067-28888089 TTTCTATTGTCACCAAACCCTGG + Intergenic
1178119347 21:29452135-29452157 TTTATTTTTTTACCTAAGCTAGG + Intronic
1178194102 21:30322710-30322732 TTTTTTTTTTTAATAAACCATGG + Intergenic
1178792280 21:35711648-35711670 TTTTTTTTTTTACAACACCAAGG - Intronic
1178842772 21:36151109-36151131 TTTTTTTTTTCCCCAAGACAGGG - Intergenic
1180539843 22:16434158-16434180 TTTTTTTTTTAAACCAACCAAGG - Intergenic
1180819506 22:18816286-18816308 TTTGTTCTTTCATCAAGCCAAGG + Intergenic
1181205732 22:21250731-21250753 TTTGTTCTTTCATCAAGCCAGGG + Intergenic
1181385059 22:22538659-22538681 TTTATTTTTACAACAATCCAGGG - Intergenic
1181939991 22:26468316-26468338 GTTGTTTTTTCTTCAAACCAAGG - Intronic
1182560785 22:31157356-31157378 TTTATTTTTTTAAAAAAACATGG - Intergenic
1184286288 22:43473571-43473593 TTCATTTTTTATCCAAATCAGGG + Intronic
1184631686 22:45786262-45786284 TTTATTTTGTCACAAAAGCTTGG + Intronic
1184696772 22:46143774-46143796 TTTGATCTTTCACAAAACCAAGG - Intergenic
1185159538 22:49214908-49214930 TGCATCTTTTCACCAACCCATGG - Intergenic
1203221189 22_KI270731v1_random:44682-44704 TTTGTTCTTTCATCAAGCCAGGG - Intergenic
1203269636 22_KI270734v1_random:42139-42161 TTTGTTCTTTCATCAAGCCAGGG + Intergenic
949188357 3:1220465-1220487 TTTATATTTCCAACAAACAAAGG - Intronic
949249457 3:1965566-1965588 TTTATATTTTCACTATCCCACGG - Intergenic
949472335 3:4409383-4409405 TTTTTCTTTTCACCAATCCCAGG - Intronic
950326882 3:12119211-12119233 TTTTTTTTTTAACCTAACCAAGG - Intronic
950437641 3:12990176-12990198 TTTATTTTTTCAGTGATCCAAGG - Intronic
951077943 3:18419845-18419867 TCTTTGTTTTCGCCAAACCAAGG + Intronic
951289567 3:20858770-20858792 TTTTATTTTTTACAAAACCATGG - Intergenic
951351538 3:21612997-21613019 TTTTTTTTTTTTCAAAACCAGGG + Intronic
951597324 3:24332355-24332377 TTATTTTTTTCTCCAAAGCAGGG - Intronic
951613211 3:24515553-24515575 TTTGATTTTTCACAAAACAAAGG + Intergenic
952066866 3:29581107-29581129 TTTATTTTTTCACAAATCTAAGG + Intronic
952245101 3:31579466-31579488 TTTTTTTTTTTATCAAAACAGGG - Intronic
953131668 3:40145435-40145457 TCATTTTTTCCACCAAACCAGGG + Intronic
953348371 3:42195411-42195433 TTTAGCATTTCATCAAACCATGG - Intronic
953445388 3:42960531-42960553 TTAATTTTTTCTCCTAACCTGGG + Intronic
954058248 3:48046404-48046426 GGTATTATTTAACCAAACCATGG + Intronic
954854257 3:53629204-53629226 TTGTTCTTTTCACTAAACCAGGG - Intronic
955077904 3:55631161-55631183 TTTTTTTTTTCCCCAAGCAATGG + Intronic
955501082 3:59583604-59583626 TTTGTGTTCTGACCAAACCAGGG + Intergenic
955632428 3:60988934-60988956 TTTTTTTTTTAACAAAGCCATGG - Intronic
955718793 3:61860350-61860372 TTTTTTTTCTCATCAAACAATGG - Intronic
955986432 3:64578277-64578299 TTTTTTTTTTAACCAAAGGAAGG - Intronic
956058651 3:65327592-65327614 TTTGTTTTTTAACCAATTCAGGG - Intergenic
956167394 3:66406919-66406941 AATATTTTTTCTCTAAACCATGG - Intronic
956628969 3:71295797-71295819 TTTATTAGATCACCAAACCAAGG + Intronic
957189887 3:76994049-76994071 TTTTTTTTCTCACCAAATTACGG - Intronic
957197846 3:77093405-77093427 TTTATTTTTTGACCAAATAATGG + Intronic
957357035 3:79102619-79102641 ATTATTTTGTCAACCAACCATGG - Intronic
957378867 3:79397872-79397894 TTTAGTTTTTCAGTAAACCCAGG - Intronic
957393444 3:79609608-79609630 TTTATTTGTTCACCTATCCATGG - Intronic
957637122 3:82800753-82800775 TTTTTTTTTTCAAAAATCCATGG - Intergenic
957821991 3:85388585-85388607 TAATTTTTTTCACAAAACCAAGG + Intronic
958450542 3:94267414-94267436 TTTTTTTTTTCAACAAAGTAAGG - Intergenic
958841749 3:99213523-99213545 TTTACTCTTTTACCAATCCAGGG + Intergenic
958852416 3:99345037-99345059 TTCTTTTTTTCACGAAACCTAGG + Intergenic
959961886 3:112306819-112306841 TTTATTTTTTAACTTAACTAAGG - Intergenic
960187165 3:114657833-114657855 TTTATTTTTAACCCATACCATGG + Intronic
960202105 3:114849160-114849182 TTCTTTTTTTTAACAAACCAAGG + Intronic
960429875 3:117556324-117556346 TTTCTTTTTTCATAATACCAGGG - Intergenic
962551224 3:136494097-136494119 TTTATTTTTTCTAGAAACTAGGG - Intronic
962744385 3:138386798-138386820 TTTATTCTTTCACCAGTCAATGG + Intronic
962783383 3:138743213-138743235 GTTATTATTTCACCAAAACTTGG + Intronic
962963398 3:140332021-140332043 TTTATTTTTCCACTAGAACAGGG - Intronic
963173263 3:142272458-142272480 TTTATTTATTTACCAAAACAGGG - Intergenic
963306216 3:143656269-143656291 TTGATTTTTTCATCATACCAAGG + Intronic
963740998 3:149081214-149081236 TTTATTTTTTGACCCATCAAAGG - Intronic
964050576 3:152388477-152388499 TTTATTGTTTCACTCAACTATGG - Intronic
964331417 3:155607612-155607634 TGTATTTTTTCATAAAAACAGGG + Intronic
964544668 3:157820794-157820816 TTTATTTTCCCACCAAACTTTGG + Intergenic
964999113 3:162929205-162929227 TTTATTTTCTCATAAAACAATGG - Intergenic
965492228 3:169352094-169352116 TTTATTTTTTAGCTAAAACAGGG + Intronic
965600404 3:170448549-170448571 TTTTTTTTTTAACAATACCAAGG - Intronic
965899577 3:173622011-173622033 TTTCATTTTTTACCAAAGCAGGG + Intronic
967095543 3:186174580-186174602 TTTCTTTTTACTCCAAAACAGGG + Intronic
967421137 3:189274113-189274135 TTTTTTTTTTCACTGATCCATGG + Intronic
967486190 3:190033819-190033841 TTTATTTTTCCAACAAAAAATGG + Intronic
967543571 3:190697101-190697123 TTTTTTTTTTAACCATAACACGG + Intergenic
967726272 3:192865231-192865253 TTTATTCTTACAGCAACCCAGGG + Intronic
968128444 3:196177295-196177317 TTTTTTTTTTCCCCAAGACAGGG - Intergenic
969367456 4:6706002-6706024 ATTATTTTTTCATCACAGCATGG + Intergenic
970372435 4:15421559-15421581 TTAATTTTTACAACAATCCAAGG + Intronic
970703948 4:18777209-18777231 ATCATTTTTACACCAAACCCCGG + Intergenic
971617148 4:28806326-28806348 TTTATTTTTTCCCCAAAACCTGG - Intergenic
971777711 4:30988525-30988547 TTTCTTGTTTCAACAATCCAAGG - Intronic
972211962 4:36849242-36849264 CTTTTTTTTTCCCCAAAGCAAGG + Intergenic
972216414 4:36902521-36902543 TCTCTTTTTTTGCCAAACCAAGG - Intergenic
972275955 4:37558095-37558117 TAGATTTTCTCACCAAAGCATGG - Intronic
972896383 4:43626222-43626244 TTTTTTTTTTCACTCAAACATGG - Intergenic
973609711 4:52624054-52624076 TTTATTTTTTAAAGAAATCAGGG - Intronic
973628395 4:52795098-52795120 TTTATTTATTCATCCATCCATGG - Intergenic
974222749 4:58997657-58997679 TTTATTTGTTCCCCAACCTATGG + Intergenic
974386280 4:61203919-61203941 TTTTTTTTGTAACCAAAGCAAGG + Intronic
974822068 4:67080123-67080145 TTTTTTTTTTCAACAAATCCAGG + Intergenic
974887069 4:67832882-67832904 TTTATTTTTTTTCCAAATTAAGG - Intronic
975302756 4:72810322-72810344 TTAATTTTTTAACCAGAGCATGG + Intergenic
975480052 4:74867975-74867997 TTTATTTTATACCCAAACCATGG + Intergenic
976059848 4:81114310-81114332 TTTTTTTTTTCACCAAACACAGG - Intronic
976156160 4:82147105-82147127 TTTATTTATTGATCAGACCAAGG + Intergenic
976306186 4:83561795-83561817 TTTTTTTTTTTACCAAAAAAGGG - Intronic
976522558 4:86045989-86046011 TTTATCTTCTCACTAGACCATGG + Intronic
977017912 4:91717065-91717087 TTTAGTTTTTCATCAAACATGGG - Intergenic
977215889 4:94283397-94283419 TTTGTTTTTTCGGCAAAGCATGG + Intronic
977528917 4:98176650-98176672 TTTTTTGTTTCACAAAAACATGG + Intergenic
977636567 4:99304992-99305014 TTTTTTTTTTGATCACACCAAGG + Exonic
978894270 4:113868231-113868253 TTTATTTTTTCTCAAAAAAAAGG - Intergenic
978913842 4:114099306-114099328 TTTTTTTTTTACCCAAACAAGGG - Intergenic
978913843 4:114099307-114099329 TTTTTTTTTTTACCCAAACAAGG - Intergenic
979676571 4:123415753-123415775 TTTTTTTTTTTACCAAACTTTGG - Intergenic
980515114 4:133847275-133847297 TTTTTTTTTTCCCCAACACATGG - Intergenic
980562834 4:134500758-134500780 TTTATCTTTTCAGAAAAACACGG + Intergenic
981037286 4:140185722-140185744 TCTATATTTTCACCCAAACATGG + Intergenic
981446606 4:144846533-144846555 TTTCTATTGTCACCAAACCCTGG - Intergenic
981704984 4:147649405-147649427 TTTGTTTTTTTAAAAAACCATGG - Intronic
981814936 4:148819626-148819648 TTTCTTTTTACACAAAAACATGG - Intergenic
982223532 4:153144972-153144994 TTTATTAATTCACCAATTCATGG + Intergenic
983063048 4:163179493-163179515 TTTATCTTCTCAGCAAACCCAGG + Intergenic
983414194 4:167435247-167435269 TTTATTTTTTAATTAAAGCATGG - Intergenic
983862472 4:172724752-172724774 TCTATTTTTTCCCCAAACTTTGG - Intronic
983901137 4:173135717-173135739 ATTCTTTATTCCCCAAACCAAGG - Intergenic
983917626 4:173309476-173309498 TTTATTTATGAAACAAACCAAGG + Intronic
984080053 4:175237343-175237365 TTTATTTTTTTACAAAAACAAGG + Intergenic
984827747 4:183942346-183942368 TTTTTTTTTAGACAAAACCAAGG + Intronic
985009450 4:185567694-185567716 TTTCTTTTTTCCCCAAACCAAGG + Intergenic
986009762 5:3701420-3701442 TTCTTTTTTTCCCCAAAGCATGG + Intergenic
986445007 5:7813833-7813855 TTTTGCTTTTTACCAAACCAAGG - Intronic
987739177 5:21883497-21883519 TTTCTATTGTCACCAAACCCTGG - Intronic
987816362 5:22905983-22906005 TTTATTTTTTAAACAAAGGAGGG + Intergenic
988134500 5:27152176-27152198 TTTATTTATTCATTTAACCATGG - Intergenic
988238623 5:28578634-28578656 TGTATTTGTTAACCAAGCCAGGG - Intergenic
988271150 5:29018687-29018709 TTTTTTTTTTCAGAAAACCTAGG + Intergenic
988307456 5:29510960-29510982 TTTATTTATTCGCCAAATCGTGG - Intergenic
988327579 5:29789638-29789660 CTTTTTTTGTCACCATACCAAGG + Intergenic
988422515 5:31023906-31023928 TTTGTTTTTTTTACAAACCAGGG + Intergenic
990082872 5:51938462-51938484 TTTATTTATTCACAAGACAAAGG - Intergenic
990259693 5:54008585-54008607 CTTATTTCTTCACCAAAGCCAGG + Intronic
990297487 5:54417223-54417245 TTTATTTATACATCAAACTAAGG + Intergenic
990657515 5:57973411-57973433 ATTTTTTTTTCACCAAACAGTGG - Intergenic
990835948 5:60020405-60020427 TTTATTTTTTCACCAATTGAAGG - Intronic
991470045 5:66958244-66958266 TGTTTCTTTTCAACAAACCAGGG + Intronic
991484905 5:67124900-67124922 TTTATTCTTTCATAAAATCATGG + Intronic
992679842 5:79142779-79142801 TTTATTTTTTCCCCAAACTCTGG + Intronic
993258856 5:85631022-85631044 TTTAATGTTTTTCCAAACCATGG + Intergenic
993413753 5:87601320-87601342 TTTGTTTTTTCCCCAGCCCAAGG + Intergenic
993539129 5:89126415-89126437 TTTATTTTCACAACAAACCTGGG - Intergenic
994555477 5:101295346-101295368 TTTATTGTTTCAGACAACCATGG - Intergenic
994628249 5:102249188-102249210 TTTTTTTTTTCAGCTAAACATGG + Intronic
994640667 5:102405291-102405313 TTTATATTTTCACCAAATTTGGG - Intronic
994663381 5:102679827-102679849 TTTATTTATTCCTCAAACCATGG - Intergenic
994846100 5:104990377-104990399 TTTGTGTTTTCAGCTAACCAGGG + Intergenic
994894194 5:105680944-105680966 TTTTGTTTTTCAACAAACCGTGG + Intergenic
995230473 5:109755768-109755790 TTTTTTTTTTCAGCAAAAAAAGG + Intronic
995270997 5:110219801-110219823 TTTGTTTTTTCCCCAGACCGAGG + Intergenic
995496966 5:112756370-112756392 TTTATTCTTTCCACAAACTATGG + Intronic
995560719 5:113378322-113378344 TTTATTTTTTCCTTAGACCATGG + Intronic
996103696 5:119473010-119473032 TTTATTCATTCACCTATCCATGG + Intronic
996161191 5:120167769-120167791 TTTATTTTTCCCCCAACCCCTGG + Intergenic
996642076 5:125767726-125767748 TTTATCTTTTCAACAAATTAAGG + Intergenic
996886979 5:128368849-128368871 TTTTTTTTTTTACCAAGACAGGG + Intronic
997180975 5:131828635-131828657 TTTAAAATTTCCCCAAACCAAGG + Intronic
997740698 5:136251232-136251254 TTTATTTTTGCACAAAACACAGG + Intronic
997835639 5:137190898-137190920 TATATTTTCTGAGCAAACCAAGG + Intronic
998894832 5:146788328-146788350 TTTTTTTTTTCTTTAAACCAGGG - Intronic
999033627 5:148321496-148321518 TTTTTTTTTTTAACAAACGAGGG + Intronic
999162621 5:149516473-149516495 TTTTTTTTTTTTCCTAACCAGGG + Intronic
999339891 5:150761367-150761389 TTTTTATTTTCACCAAGGCAGGG - Intergenic
999632898 5:153588960-153588982 TTTATTTATTCATCCATCCAAGG - Intronic
1000568859 5:162885069-162885091 TTTTTTTGTTAACCAAAACAGGG - Intergenic
1001145373 5:169179284-169179306 TTTTTTTTTTTTCCAGACCAAGG + Intronic
1001306426 5:170577168-170577190 TTACATTTTTCACCAAAGCATGG - Intronic
1001367184 5:171154110-171154132 TTTTTTTTTTAACCAAATTAAGG + Intronic
1002059981 5:176620382-176620404 TTTTTTTTTTAACCAAAACCAGG - Exonic
1004954575 6:20714922-20714944 TTTATTTTTTAAATAAAACAAGG - Intronic
1005219037 6:23564923-23564945 CTTTTTTTTTCCCCAAACAAAGG - Intergenic
1005229074 6:23678954-23678976 TTTTTTTTTTTACAAAATCAGGG + Intergenic
1007256541 6:40533639-40533661 TTTATTTTGTGTCCAAAGCAGGG - Intronic
1007277413 6:40685354-40685376 ATTATTTTGTAACCAAATCATGG + Intergenic
1008206630 6:48668012-48668034 TTAATTTTTTCCCCTAATCATGG + Intergenic
1008537724 6:52519746-52519768 TTTATTCATTCATCAATCCATGG - Intronic
1009448248 6:63769147-63769169 ATTATTTGTACACCAAACCTCGG + Intronic
1010657223 6:78525891-78525913 ATTTTTTTTCCCCCAAACCAAGG + Intergenic
1011619018 6:89224787-89224809 TTTTTTTTTTCCCCAAGACAGGG + Intronic
1011742752 6:90378953-90378975 TTTACATTTTCACCAACACATGG - Intergenic
1011987649 6:93469886-93469908 TTTATTTTATCATGTAACCAAGG - Intergenic
1012174394 6:96062025-96062047 TTTATTTTATAACTATACCAGGG + Intronic
1012396139 6:98799702-98799724 TTTATTTTTCCCCCCAAACAAGG - Intergenic
1012729271 6:102860215-102860237 TTTTTTTTTTTACCAAAAAAAGG - Intergenic
1012779819 6:103544106-103544128 TTAATTTTTTAATCAAAGCATGG - Intergenic
1012823097 6:104113480-104113502 TTTATTTTTTCAGCAAACGTTGG + Intergenic
1013104684 6:107016760-107016782 TTTTTTTTTTCTTCAAAACAGGG - Intergenic
1013118133 6:107118418-107118440 TTTATTTTTTCAGCACACAGGGG - Intergenic
1013376904 6:109526208-109526230 ATTATTTGTACACCAAACCCCGG + Intronic
1013918555 6:115371090-115371112 TTTATTTTTTCCCCTAATTAAGG - Intergenic
1014161835 6:118178586-118178608 TTTTTTATTCCACAAAACCATGG + Intronic
1014271639 6:119343124-119343146 TTTTTTTTTTCAGCCAACGATGG - Intronic
1014324591 6:119976786-119976808 TTGCTTTTCTCTCCAAACCAAGG + Intergenic
1014574337 6:123052032-123052054 TATATTTTTTCAACAAATCTTGG + Intronic
1015101842 6:129490765-129490787 TTTCTTTCTTTACCAAACTATGG - Intronic
1015698391 6:136007641-136007663 TTTTTTTTTTCACCAAGAAAGGG - Intronic
1016036593 6:139389667-139389689 TTAATTTTTTCACAGAAACAGGG + Intergenic
1016104266 6:140142561-140142583 TCTATCTTTAGACCAAACCATGG + Intergenic
1016573677 6:145543619-145543641 TTTAGTTTTTCATCAAAGAAGGG + Intronic
1017267536 6:152466307-152466329 TCTATTTCTTCACCAACCAAGGG + Intronic
1017622790 6:156316441-156316463 TTTATCTTTTCAACAAACAAAGG + Intergenic
1018075411 6:160207884-160207906 TTTATTTATTCACAAATACATGG - Intronic
1020475881 7:8593862-8593884 AATATATTTTTACCAAACCAAGG - Intronic
1020509765 7:9039220-9039242 TTTATTTTTTAACCAAAGCAAGG - Intergenic
1020727099 7:11829856-11829878 TTTTTTTTTTTACCAAACCAAGG + Intronic
1021110319 7:16686574-16686596 TTTATTCTATAACCAAACCATGG - Intronic
1021163870 7:17309593-17309615 TTTAATTTTCCACCAAACAATGG + Intronic
1022342739 7:29484219-29484241 TTTACTTTTTAAACAAACGAGGG - Intronic
1022811526 7:33873402-33873424 TTTATTTTTTCAATTAACAAAGG + Intergenic
1023015004 7:35958267-35958289 TATATTTTTTCTCCAAAAAAAGG + Intergenic
1023181471 7:37488022-37488044 TTTTTTTTTTTAACAAACCTAGG - Intergenic
1023720268 7:43085790-43085812 TTTATATTTTCACCAAAATTGGG - Intergenic
1024013096 7:45287394-45287416 TTTATTTATTCACTACACTATGG - Intergenic
1024165393 7:46724544-46724566 TTTGTTTCTTCCCCAGACCAAGG - Intronic
1024433089 7:49313351-49313373 TTTTTTTTTTCACCCAAAGAAGG - Intergenic
1024437658 7:49377737-49377759 TGTATTTTTCCAGCAAACCAAGG - Intergenic
1024748551 7:52435182-52435204 CATATTTTTTCACAAAACTAAGG - Intergenic
1024758059 7:52560004-52560026 TTTTTTTTTGTACCTAACCATGG - Intergenic
1024913939 7:54477399-54477421 TTTCTTTTTTCTCCAAATCATGG + Intergenic
1026506667 7:70990381-70990403 GTTCTTTTCTCACAAAACCATGG + Intergenic
1027409806 7:77904500-77904522 TTTATTTTTTCACCATTCTGAGG + Intronic
1027457749 7:78414750-78414772 GTCACTTTTTCACCAAACCCAGG - Intronic
1027911654 7:84259716-84259738 TTTAATTTTTCTCCTACCCAAGG - Intronic
1028077430 7:86533913-86533935 TTTGTTTCTTCCCCAATCCAGGG + Intergenic
1028088884 7:86672605-86672627 TTTTTTTTTTCAGGAGACCATGG + Intronic
1030168247 7:106575857-106575879 TTTATTTGTTCCCTGAACCAAGG + Intergenic
1030216409 7:107047522-107047544 TTTTTTTTTTCTTCTAACCAGGG - Intronic
1030260383 7:107558114-107558136 CTTATTTTTTCCCCAATCCAGGG - Exonic
1030291122 7:107873388-107873410 TTCTTTTTTACCCCAAACCAGGG + Intergenic
1030387792 7:108887071-108887093 CCTATTTTTTCACCATGCCAGGG - Intergenic
1031182584 7:118436093-118436115 TTTGTTTCTTCCTCAAACCAAGG - Intergenic
1031521244 7:122769200-122769222 TGTATTCTTTCACCAACACATGG + Intronic
1031576383 7:123420020-123420042 TTTATTTTTTCAGAAAAAAAAGG + Intergenic
1031841510 7:126746108-126746130 TTCATTTTTTCAGCTCACCAGGG + Intronic
1033072364 7:138215823-138215845 ATTGTTTTTACTCCAAACCATGG + Intergenic
1033857520 7:145582830-145582852 TTTTTTTTTTTACCAGACCGGGG - Intergenic
1034085566 7:148319403-148319425 TTTGTTTTTTCACTACTCCAAGG + Intronic
1034301474 7:150019260-150019282 TTAATTCTTTCACAAAACCCTGG - Intergenic
1034728210 7:153360236-153360258 TTTATTTCTTCACCTACCCTTGG + Intergenic
1034761034 7:153671990-153672012 TTTGTTTTTTCACAAAGTCAGGG + Intergenic
1035101919 7:156404781-156404803 TTTATCTTTTCACCCATCGATGG + Intergenic
1035401403 7:158568443-158568465 TTTTTTTCTTCTCCAAACCAAGG - Intronic
1035492493 7:159292511-159292533 TTTCTTTTTCCAGCACACCAAGG + Intergenic
1035975796 8:4309973-4309995 TTTATTTTCACACCAGACTAAGG + Intronic
1036150528 8:6293193-6293215 TGTATTTTTTCAACACAACAGGG - Intergenic
1036153864 8:6324082-6324104 TTTATGGTTTCATCAACCCAGGG + Intergenic
1036283300 8:7419752-7419774 TTTCTATTGTCACCAAACCCTGG - Intergenic
1036338170 8:7891769-7891791 TTTCTATTGTCACCAAACCCTGG + Intergenic
1036697368 8:10985585-10985607 TTTTTTTTTTAACCAAAAGATGG - Intronic
1037029776 8:14090761-14090783 TTTGTTTGTTCAACAAAGCATGG - Intronic
1037468255 8:19182159-19182181 TTTATTTCAACACCAAGCCAGGG + Intergenic
1038037445 8:23698502-23698524 TTTTCTTTTTCACAAAACGAGGG - Intergenic
1038231590 8:25705590-25705612 TTAATTTTTGCAACAAAGCAAGG - Intergenic
1038302433 8:26365803-26365825 TATAATTTATCACCAAACCAAGG + Intronic
1038597296 8:28899745-28899767 TTTATTATATTACCAAACCAGGG + Intronic
1038771011 8:30480014-30480036 TTTAGTTTTTCAACATACTAAGG - Intronic
1038972370 8:32650216-32650238 GTTTTTTTTTCCCCAAGCCAGGG + Intronic
1038982271 8:32772961-32772983 TTTATTTTTTTGCAAAACAAAGG + Intergenic
1039608280 8:38900691-38900713 TTTATTTTTTAATCAAGACAGGG - Intergenic
1039865049 8:41493226-41493248 TTCAATTTTTCATCAAAGCAAGG - Intronic
1039997121 8:42542971-42542993 TTTTTTTTTTTACAAAAACAGGG - Intronic
1041276371 8:56163227-56163249 TTTTTTTTTTAACCAAGCTAAGG + Exonic
1041346115 8:56899886-56899908 TTTCTTTATTCACCAAATGAGGG - Intergenic
1041420100 8:57658085-57658107 TTTATTTTTTCACCGTTCTAGGG + Intergenic
1041657662 8:60370063-60370085 TTTTTTTTTCCCCCAAAACAGGG - Intergenic
1041853455 8:62420273-62420295 TATATAATTTCACCAAACAATGG + Intronic
1042476343 8:69252801-69252823 TTTATTTTATCACTAAAAGAAGG - Intergenic
1043058929 8:75475313-75475335 ATTATTTTTTAAAAAAACCATGG + Intronic
1043321556 8:78993443-78993465 TTTATTCATTCATCAATCCATGG - Intergenic
1043323381 8:79018321-79018343 TTTATTTTTTCACTCCACCCTGG - Intergenic
1044560509 8:93607381-93607403 TTTATTTTTTGCCTAAACAATGG + Intergenic
1044838695 8:96319557-96319579 TTTATATTTTCACCAAAAACGGG + Intronic
1045566872 8:103326998-103327020 TTTATTGTTTCACCACACAGTGG - Intronic
1045577002 8:103433749-103433771 TTTATTTTTTTAAGACACCAGGG - Intronic
1045677559 8:104624641-104624663 TTTATTTGTACTCCAAACCTCGG + Intronic
1045720296 8:105101994-105102016 TTTTTTTTTTAGCCAAAGCAGGG + Intronic
1046171121 8:110507509-110507531 TTTATTTTTCCTCAAAGCCATGG - Intergenic
1046251471 8:111636913-111636935 TAATTTTTTACACCAAACCATGG + Intergenic
1046471829 8:114685312-114685334 TTTATTTTTTCCCCACTTCAGGG + Intergenic
1049387486 8:142350800-142350822 TTTATTTGTTGAAGAAACCAGGG - Intronic
1049640692 8:143713827-143713849 TTGAATTTTTAACCAATCCACGG - Intronic
1049923034 9:382726-382748 TTTATTTTTTAACTAAAACTTGG + Intronic
1050051775 9:1609621-1609643 TTGATCTTATCACAAAACCAAGG - Intergenic
1050567281 9:6899364-6899386 TTTATTTTTTAAGGAAACCCAGG + Intronic
1051956185 9:22697213-22697235 TTTATTTGCTCAGAAAACCAAGG + Intergenic
1053107817 9:35427413-35427435 ATTATTTTTTAACCTAACAAGGG - Intergenic
1053453985 9:38217011-38217033 TTTTTTTTTTCAAGAACCCATGG + Intergenic
1055013453 9:71591739-71591761 TTTTTTTTTTCCCCAAGACAGGG + Intergenic
1055031034 9:71771449-71771471 TGTATTTATTGCCCAAACCAAGG + Intronic
1056182397 9:84097954-84097976 TTTTTTTTTTCCCCAAAATAAGG - Intergenic
1056426870 9:86486173-86486195 TTTTTTTTTTCACCAAAAGAAGG - Intergenic
1056479255 9:86984394-86984416 TTTTTTTTTTCACCCAGCCTTGG - Intergenic
1056480537 9:86999420-86999442 TCTATTTTTTCACCAATTTATGG + Intergenic
1056794188 9:89646140-89646162 TATATTTTTTCAATAAAGCATGG - Intergenic
1057581886 9:96294442-96294464 TTTATTGTTTCACAAAGCAATGG - Intronic
1057646146 9:96877070-96877092 TGATTTTTTTAACCAAACCAGGG + Intergenic
1058105369 9:100964250-100964272 TTTTTTTTTTTAACCAACCAGGG - Intergenic
1058160910 9:101569816-101569838 TTTATTCTTTACCCACACCAAGG + Exonic
1058296054 9:103308585-103308607 ATTATTTTTACAGCCAACCATGG + Intergenic
1058882564 9:109298318-109298340 TTTTTTTTTTCCCCAAGACAAGG + Intronic
1059290162 9:113216071-113216093 TTTTTTTTTTCACAAAATAAAGG - Intronic
1059632155 9:116136298-116136320 TTCATTTTGTCACATAACCAGGG + Intergenic
1059672546 9:116505416-116505438 TTTATTTTTTAAGAAAAGCAAGG + Intronic
1059901142 9:118927504-118927526 TTTTTTTTTTCACTGAACCTTGG - Intergenic
1059963128 9:119587137-119587159 TATATTTTTTCATCAATCCTTGG - Intergenic
1060356810 9:122915846-122915868 TTTTTTTTTAAACCAAACTATGG + Exonic
1060387729 9:123248096-123248118 TATATTTTTCCTCCAAAGCAAGG + Intronic
1061231327 9:129317632-129317654 GCTATGTTTTCACCAAACCCTGG + Intergenic
1061267179 9:129513648-129513670 TTTCTTTTTTCAATAAACCTTGG + Intergenic
1186253075 X:7690131-7690153 TTTCTTTTATCACTAACCCACGG - Intergenic
1186719787 X:12291084-12291106 TTTATTTTTTTACCCAACCAGGG - Intronic
1186724997 X:12348177-12348199 CTTATTTTAACAACAAACCAAGG + Intronic
1187972076 X:24668831-24668853 TTTATTTATTCATTAAAACAGGG - Intronic
1188550849 X:31363103-31363125 CTTATCTGTTCACCAAACTAAGG + Intronic
1188572630 X:31606668-31606690 TTTATTTTTTCACCAAACCAAGG + Intronic
1188791721 X:34413943-34413965 TTTGTTTCTTCCCCAAACCAAGG - Intergenic
1189736875 X:44080428-44080450 TTCATTTATTCAACAAACTAGGG - Intergenic
1190217541 X:48489899-48489921 TTTGTTTTTTCTTCAAAACAGGG - Intergenic
1191071234 X:56402128-56402150 TTTATTTTCTCAACAATCCTAGG - Intergenic
1191650611 X:63533388-63533410 TTTAACTTTTCAAGAAACCAGGG - Intergenic
1192270129 X:69571240-69571262 TGCATTTTTTCCCCAAAGCAAGG - Intergenic
1192732223 X:73812250-73812272 TGTATTATTTAACTAAACCATGG - Intergenic
1193425569 X:81337489-81337511 TTTGTTTTTTCCCCAACCCAAGG + Intergenic
1193873132 X:86826265-86826287 ATAATTATTTCACAAAACCAGGG + Intronic
1193987520 X:88263175-88263197 TTTATTGCTCCACAAAACCATGG - Intergenic
1194234977 X:91372180-91372202 TTTATTTCCTCACCTGACCAAGG - Intergenic
1194842867 X:98766104-98766126 TTTATTTTTCCAACAATCCAAGG + Intergenic
1194886458 X:99321586-99321608 TTTATTTTTTCTCTAGAGCATGG + Intergenic
1194920134 X:99755333-99755355 TTTATTATTTCACCTAACTCTGG + Intergenic
1195091706 X:101466490-101466512 TTTATTTATTCACCAGATGATGG - Intronic
1195327621 X:103770743-103770765 TTTTTTTTTTCCCCAAGACAGGG - Intergenic
1195676979 X:107514132-107514154 TTTAGTTTCTCAACACACCAAGG - Intergenic
1195891710 X:109702287-109702309 TCTATTTTTTAACCATTCCAAGG + Intronic
1196234299 X:113261382-113261404 TTTGTTTCTTCCCCAGACCAGGG + Intergenic
1197450076 X:126601755-126601777 TTTATATTTTCACACAACAAAGG + Intergenic
1197808404 X:130418682-130418704 TTTTTTTTTTCAACAAACTGGGG - Intergenic
1198135085 X:133741242-133741264 TTTATTTTCCCACAAATCCAGGG - Intronic
1198403265 X:136288022-136288044 TTAATTTTTTCCCATAACCATGG + Intergenic
1198657972 X:138935286-138935308 TTCATTTTTTCCCCAAACTGTGG - Intronic
1198702029 X:139407197-139407219 TTTATTTTTTCACTGTAGCAGGG - Intergenic
1198813672 X:140563082-140563104 TTTATCTTTTCAAAGAACCAAGG + Intergenic
1199319513 X:146422008-146422030 TTTACTTTTTCCCCAAAGCAAGG + Intergenic
1200312946 X:155098306-155098328 TTTATTTTCTCTTCAACCCAAGG + Intronic
1201038632 Y:9807384-9807406 TTTTTTTTTTCACGATACCAGGG + Intergenic
1201637498 Y:16140937-16140959 TTTATTTTCTTCCCTAACCAAGG - Intergenic
1201747389 Y:17392420-17392442 TTTATTTCTTCATTAAACTAGGG + Intergenic
1202247337 Y:22833419-22833441 TTTCCTTTTTCAGGAAACCAAGG + Intergenic
1202247353 Y:22833530-22833552 TTTCCTTTTTCAGGAAACCAAGG + Intergenic
1202304422 Y:23453288-23453310 TTTTTTTTTTCATTAAAACAGGG - Intergenic
1202400325 Y:24467167-24467189 TTTCCTTTTTCAGGAAACCAAGG + Intergenic
1202400341 Y:24467278-24467300 TTTCCTTTTTCAGGAAACCAAGG + Intergenic
1202470439 Y:25202808-25202830 TTTCCTTTTTCAGGAAACCAAGG - Intergenic
1202470455 Y:25202919-25202941 TTTCCTTTTTCAGGAAACCAAGG - Intergenic
1202566388 Y:26217303-26217325 TTTTTTTTTTCATTAAAACAGGG + Intergenic