ID: 1188575090

View in Genome Browser
Species Human (GRCh38)
Location X:31639259-31639281
Sequence CTGTGGAGAGGGAATGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 629
Summary {0: 1, 1: 0, 2: 7, 3: 42, 4: 579}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188575090 Original CRISPR CTGTGGAGAGGGAATGAAGA TGG Intronic
900791745 1:4685342-4685364 CTGTGGAGAGGCTATGCAGGCGG - Intronic
900938181 1:5780275-5780297 CTTTGGAGAGGGCAGGAAGCAGG + Intergenic
901150455 1:7097805-7097827 CTCTGGAGATGGAAAGTAGATGG + Intronic
901181227 1:7343055-7343077 CTGTGGATAGGAAATGAAAAGGG + Intronic
901211527 1:7529115-7529137 TTGTGGATATGGAATGAAGGGGG + Intronic
901533531 1:9868075-9868097 CTGTGGACTGGGAGTGGAGAGGG - Intronic
902632386 1:17712851-17712873 CTGAGGAGATGGAATGCAGATGG + Intergenic
903004417 1:20289346-20289368 CTGGGCAGAGGGAATGGAGGAGG - Intergenic
903333979 1:22612854-22612876 CCGTGGAGAGGGAGGGAGGAGGG - Intergenic
903502155 1:23806628-23806650 CTGTGGAGAAAAAATGAAGCAGG - Intronic
903845494 1:26277630-26277652 GTGTGAAGTGGGAATGAACATGG - Exonic
904503164 1:30929408-30929430 AGGAGGAGAGGGAGTGAAGAAGG + Intergenic
904761342 1:32806610-32806632 CTCTGAAGAGGAAAGGAAGAGGG + Exonic
904879466 1:33684455-33684477 TCGTGGAGGGGGAAGGAAGAAGG - Intronic
905278712 1:36835516-36835538 ATGTGGAGAAGGAAGGAGGAAGG - Intronic
905347339 1:37319866-37319888 CTGGGGATTGGGAATGAGGAAGG + Intergenic
905935318 1:41818804-41818826 GCGTGGGGAGGGAATGAAGAAGG - Intronic
906043567 1:42809085-42809107 CAGTGGTGATGGAAAGAAGATGG + Intronic
906124801 1:43421201-43421223 CTGAGGAGAAGGACTGAAGGTGG - Exonic
906297497 1:44658201-44658223 GTGTGTAGAGGGACAGAAGAGGG - Intronic
906562023 1:46765314-46765336 ATGGAGAGAAGGAATGAAGAGGG - Intronic
907728656 1:57044575-57044597 TTGTAGCTAGGGAATGAAGAAGG + Intronic
908086184 1:60636630-60636652 CTGGAGAGAGGGAAGGAAGAAGG + Intergenic
908353441 1:63308746-63308768 CTGTGGATCGGGAATTCAGAAGG - Intergenic
909670409 1:78182257-78182279 CTGAGGAGAGGGAGTGTTGATGG - Intergenic
909855919 1:80531436-80531458 CTGTGTAGAGGAAAAGAAGTGGG - Intergenic
910246938 1:85149058-85149080 GTGTGGTGAGAGAATGCAGAAGG - Intergenic
910672823 1:89790186-89790208 CTCTGGAGGGGAAAGGAAGAAGG - Intronic
910711808 1:90189892-90189914 CTGCAGAGAGGGAAAGAGGAGGG - Intergenic
910791374 1:91054617-91054639 CTGTGGAAAGGGACTTCAGATGG + Intergenic
911658740 1:100475929-100475951 CTGTGGCGAGGGATTGACAAAGG + Intronic
911723517 1:101217274-101217296 CTGAGGAGATGGAGTGTAGAGGG + Intergenic
912702412 1:111888135-111888157 CTGTGGGGTGGGAGGGAAGAGGG + Intronic
912811746 1:112800346-112800368 CTGGGGAGAAGCAGTGAAGATGG - Intergenic
912913738 1:113790157-113790179 GTGGGGAGTGGGAATGGAGAAGG + Intronic
913612540 1:120522253-120522275 ATGTGGAAAGGGGATAAAGAGGG + Intergenic
913670172 1:121090225-121090247 CTGTGTAGAGGTAAAGAAAATGG - Intronic
914021939 1:143877667-143877689 CTGTGTAGAGGTAAAGAAAATGG - Intergenic
914247233 1:145895494-145895516 ATCTGGAGTGGGAATGAAAATGG - Intronic
914578651 1:148999994-149000016 ATGTGGAAAGGGGATAAAGAGGG - Intronic
914660420 1:149785595-149785617 CTGTGTAGAGGTAAAGAAAATGG - Intronic
915736993 1:158091332-158091354 TGGTGGAGAGGGAAGGAAGAAGG - Intronic
915924397 1:160004968-160004990 CTGTGGAGGGGGGATGGAGGTGG - Intergenic
916075140 1:161196304-161196326 CTGTGGAGAGGGATCATAGAAGG + Intronic
916310957 1:163398422-163398444 TGGTGGGGAGGGAATCAAGAGGG - Intergenic
916572165 1:166037499-166037521 ATGTGGATAGTGAAGGAAGAGGG + Intergenic
916724691 1:167512338-167512360 ATTTGGAGAGGCAAGGAAGAAGG + Intronic
917231984 1:172847157-172847179 CTGTGAAGAAGGAAAGGAGAGGG + Intergenic
917269404 1:173257010-173257032 CAGTGGAGAAGTGATGAAGAAGG - Intergenic
917804146 1:178598290-178598312 CTGAGGAGAGGGTATGGAGGAGG - Intergenic
919921886 1:202171090-202171112 CAGTGCATAGGGAATGAAGCCGG + Intergenic
920190001 1:204187649-204187671 TTGTGGAGAGGCACTGCAGATGG + Intergenic
920547336 1:206829381-206829403 GTGGGGAGAGGAAAGGAAGAGGG + Intronic
920681081 1:208073275-208073297 CTGTGTAGAAGGACTGAAGCAGG - Intronic
920823860 1:209406042-209406064 CTGGGGAGAGGGAATTTTGAAGG - Intergenic
921034083 1:211359720-211359742 CTGAGGAGAGGGCATGGGGAGGG - Intronic
922068528 1:222168245-222168267 TTGTGAGGAGAGAATGAAGATGG - Intergenic
923259876 1:232258359-232258381 CTGTGGTGAGGGGAGGGAGAAGG + Intergenic
923710608 1:236385932-236385954 GTGGGGAGAGGGAAAGGAGAGGG - Intronic
923731113 1:236551169-236551191 CTGTGGGCAAGGAATGAAGGCGG - Exonic
1062995873 10:1866274-1866296 ATATGGACAGGTAATGAAGAGGG + Intergenic
1063191289 10:3697222-3697244 CTGGGGAGGAGGAATGAGGATGG - Intergenic
1063377189 10:5561410-5561432 CTGCAGAGAGGGGAGGAAGAGGG + Intergenic
1063956581 10:11273084-11273106 GTGTGGGCAGGGAATGGAGAGGG + Intronic
1064097108 10:12431961-12431983 CTGGGGAGAGGCAATCAAGAAGG + Intronic
1064691717 10:17925333-17925355 CTATGGCAAGGGAATTAAGAGGG - Intergenic
1065932307 10:30490672-30490694 AAGAGGAGAAGGAATGAAGAGGG + Intergenic
1066034315 10:31466906-31466928 ATGAGGAGAGGGATTAAAGATGG + Intronic
1067473825 10:46553705-46553727 TTGTGGAGGGGGAATGGGGAAGG - Intronic
1068543132 10:58318673-58318695 CTGGAGAGAGGAAAGGAAGAAGG - Intergenic
1068584403 10:58780598-58780620 CTGTGGAATAGGAATGAAGTGGG + Intronic
1068639997 10:59392748-59392770 CTGTAGAGAAGGGATGAATATGG + Intergenic
1069577897 10:69543819-69543841 AGGGGGAGAGGGAAGGAAGAAGG + Intergenic
1069824458 10:71246563-71246585 CTGGGTTGAGGGAAGGAAGAAGG + Intronic
1070319516 10:75343984-75344006 TTGTGGAGGGGAAAGGAAGATGG + Intergenic
1070757370 10:79001691-79001713 CAGTGGAGTGGGAAGGAAGTGGG + Intergenic
1070931123 10:80261243-80261265 CTGTTACAAGGGAATGAAGATGG - Intergenic
1071068531 10:81665847-81665869 CTGGAGAGAGAAAATGAAGAAGG + Intergenic
1072578777 10:96722266-96722288 CTTTGGGGAGAGAAGGAAGAGGG - Intergenic
1073095456 10:100977007-100977029 TTGTGGAGAGGGACTGAATGTGG + Intronic
1073146558 10:101285385-101285407 ATGTGAAGAGGGGATGAAAATGG - Intergenic
1073158994 10:101373409-101373431 TTCTGGAGACAGAATGAAGAAGG + Intronic
1073546073 10:104350162-104350184 CTGTGGAGAGAGAATACAAAAGG - Intergenic
1073631481 10:105154270-105154292 CTGTGGTGAGGGGCTGAGGAAGG - Intronic
1074020851 10:109581093-109581115 CAGAGGAGAGGAAATGAAGTAGG + Intergenic
1074271618 10:111959234-111959256 CTTTGGAGAATGAAGGAAGAGGG + Intergenic
1074351827 10:112745174-112745196 TTGTGGAGAGAGTAGGAAGAGGG + Intronic
1074677970 10:115874060-115874082 CTGTGGAGGAGACATGAAGATGG - Intronic
1075559528 10:123458475-123458497 AGGTAGAGAGGGAAAGAAGAAGG - Intergenic
1075995625 10:126873993-126874015 GTGTGGAGAGGAAAGGAAGGAGG - Intergenic
1076071167 10:127490963-127490985 CTGGGGAGGGGGAGGGAAGAAGG - Intergenic
1076073152 10:127508975-127508997 CTATGGAAAGTGATTGAAGAGGG + Intergenic
1077044762 11:539860-539882 CTGTGGAGAAGGAGGGAAGTGGG + Intronic
1077239496 11:1503127-1503149 CTGTGGAGAAGGGATGGGGAGGG + Intergenic
1077801531 11:5543686-5543708 GTGAGGAGAGGGAATGAGGGTGG - Intronic
1077854410 11:6108180-6108202 CTATGGAGGGGTACTGAAGAGGG - Exonic
1078050896 11:7963836-7963858 GTGTTGAGAGGGAAAGAGGAAGG - Intronic
1079119584 11:17672339-17672361 CTGGGGAGGGGGCATAAAGAAGG + Intergenic
1079456354 11:20639702-20639724 GGGTGGAGTGGGAATCAAGATGG + Intronic
1079928223 11:26523103-26523125 CAGTAGAGAAGAAATGAAGAAGG + Intronic
1080315295 11:30940375-30940397 CTGGGGAGAGGTAAAGAAGAGGG - Intronic
1081563290 11:44239161-44239183 ATGTGGGGAGGCTATGAAGAAGG + Intronic
1081806011 11:45890929-45890951 CTGAGCAGAGGGCAGGAAGATGG + Intronic
1082774039 11:57232335-57232357 CAGTGGAGAGTGAATGGGGATGG - Intergenic
1082798092 11:57393100-57393122 CTGTGGGGAGGGCTTGCAGATGG - Intronic
1083507887 11:63177541-63177563 CTGGGGAAAGGGTATTAAGAAGG - Intronic
1083790562 11:64982638-64982660 CTGGAGGGAGGGAATGAAGGAGG - Intergenic
1084153628 11:67302536-67302558 CTGTGGAGAGGCACTGTGGATGG + Intergenic
1084157367 11:67321409-67321431 CTGTGGAGCGGGAGTGAAGTGGG - Intronic
1084817005 11:71654023-71654045 ATGTGCAGGTGGAATGAAGAGGG + Intergenic
1085858136 11:80198977-80198999 CTATGGAGAGGGAGAGATGAGGG - Intergenic
1086521583 11:87674351-87674373 CTTTGGAGAGGATATGAACATGG + Intergenic
1087896668 11:103594108-103594130 CTGTGAAGACTGAATAAAGATGG + Intergenic
1087896793 11:103595025-103595047 CTGTGAAGATTGAATAAAGATGG + Intergenic
1087923226 11:103890669-103890691 CTGAGGAAAGGGAATGAAACAGG - Intergenic
1088022763 11:105139595-105139617 GGGTGGAGAGAGAAAGAAGAAGG - Intronic
1088112587 11:106278902-106278924 CTGTGGAAAGGTAAAGAACAAGG + Intergenic
1088557754 11:111080077-111080099 CTGTTCACAGGGAAAGAAGAGGG + Intergenic
1088667486 11:112107972-112107994 CTGTGGATAGGGAATGTCAATGG - Intronic
1088788651 11:113204813-113204835 CAGGGGAGAGGGAAATAAGAAGG - Intronic
1089134631 11:116239298-116239320 CTGTGGAGAGAGGGTGAAGCCGG - Intergenic
1089588377 11:119524225-119524247 CGGAGGAGAGGGCATGCAGAGGG + Intergenic
1089913700 11:122129961-122129983 GTGGGGAGAAGGAATAAAGAGGG + Intergenic
1091135201 11:133182152-133182174 CTTTGGTGAGGCACTGAAGATGG - Intronic
1091204253 11:133808722-133808744 CTGTGGAGATGCAGTGATGATGG - Intergenic
1091657593 12:2356824-2356846 CTGTGGAATGGGAATGCAGGTGG - Intronic
1092060802 12:5548864-5548886 CTGTGGAGTGAGAGTGAGGAAGG - Intronic
1092091709 12:5809122-5809144 GTGGGGAGAGGGAGTGCAGATGG + Intronic
1092229871 12:6770369-6770391 CTGTGGAGAGGGAGAGAATGGGG - Intronic
1092425993 12:8376042-8376064 ATGTGCAGGTGGAATGAAGAGGG - Intergenic
1092655802 12:10684431-10684453 CCGTGGAGAGAGAAAGAAGTGGG + Intergenic
1094556648 12:31506982-31507004 CTCTGGAGAGGGAAAGGAGTTGG - Intronic
1095187786 12:39221880-39221902 GAGTGGAGAGGGAAAGGAGAAGG - Intergenic
1095473994 12:42566378-42566400 CGGTGGAGAGGGTTTGAGGATGG + Intronic
1095972945 12:47916818-47916840 CTGTGGAAAGGGAAAGAGCATGG + Intronic
1096892684 12:54787965-54787987 CTGAGAAGAGGGTCTGAAGAGGG + Intergenic
1096929358 12:55188553-55188575 CTGTTGGGAGGGCATGAGGAGGG + Intergenic
1098469371 12:70826103-70826125 ATGGAGAGAGGGAAAGAAGAAGG + Intronic
1098575366 12:72035907-72035929 CTGTGGAAAGGGAGTGTAGTGGG + Intronic
1099247705 12:80214064-80214086 CTGTGGAGATGTAATCAGGAAGG + Intronic
1099483758 12:83201301-83201323 CTGTGAAGAGGTAATGTAGCAGG - Intergenic
1100437488 12:94584866-94584888 ATGGGGATAGGGAATAAAGAAGG + Intronic
1100477641 12:94948980-94949002 CTGTTGAGTGGGACTGAAGTGGG + Intronic
1100527241 12:95431356-95431378 TTGTGGAGACAGAGTGAAGAGGG + Intergenic
1101037030 12:100716623-100716645 CTGAGGAGAGGGAAAGGAGTGGG - Intergenic
1101327790 12:103731874-103731896 CTGGGGAGAGGGAAAGAAATTGG + Intronic
1101676433 12:106921220-106921242 CACTGGAAAGAGAATGAAGAGGG - Intergenic
1101694565 12:107112906-107112928 TTGGGAAGAGGGAATGAAGAAGG + Intergenic
1101759881 12:107649812-107649834 CTGGGGAGAGTGAAGGAAGCAGG - Intronic
1101879977 12:108619597-108619619 CTTTGGGGAAGGAATGAACAAGG - Intergenic
1102167835 12:110820676-110820698 CTGGGGAGAGGGGAGGAGGAGGG - Intergenic
1103187456 12:118971857-118971879 CTGAGGAGAGGGAGGGAATAGGG + Intergenic
1103448025 12:121007446-121007468 CTGTGCAGTGGGAACGATGAAGG + Intronic
1104079464 12:125417408-125417430 CTGTTGCCAGGGAATGAGGATGG + Intronic
1104675259 12:130708109-130708131 CTGTGCTGAGGGAAAGAAGCCGG + Intronic
1104803285 12:131569347-131569369 CTGAGGAGAGGGAGGGAGGAGGG - Intergenic
1105846978 13:24301787-24301809 CTGTGCAGAGGTAATTTAGAAGG - Intronic
1106560438 13:30840939-30840961 CTGTGGAGGAACAATGAAGAAGG + Intergenic
1106804050 13:33287829-33287851 GGGTGGAGAGAGAAAGAAGAGGG + Intronic
1107727080 13:43309496-43309518 CAGTGGAGAGGAAACGCAGAAGG + Intronic
1108573750 13:51773618-51773640 CTGCTCAGAGGGAATGAGGACGG - Intronic
1109167937 13:59058960-59058982 ATGTAGAATGGGAATGAAGACGG + Intergenic
1109239557 13:59868718-59868740 CTGAGGAGAGGGAAGAAGGAAGG - Intronic
1109821332 13:67659478-67659500 ATGTGGAGAGGGAACAGAGAAGG + Intergenic
1112119453 13:96393730-96393752 CTGTGGCAAGGGAAGGGAGATGG + Intronic
1112177965 13:97047294-97047316 ATGAGGAGAAGGAATGAGGAGGG - Intergenic
1112607243 13:100918986-100919008 CTATGGAGAGGGAAGAAATAGGG + Intergenic
1113108040 13:106792173-106792195 CTCAGGACAGAGAATGAAGATGG - Intergenic
1113270095 13:108663614-108663636 CTGTCAAGAGGGAATGTAGAGGG - Intronic
1113337155 13:109387699-109387721 CTGTGGAGTGGGAAGGCAGTGGG - Intergenic
1113438787 13:110312447-110312469 CTGGGGAGAGGGAAAGAAAATGG + Intronic
1114947975 14:27711056-27711078 CAGTAGAGATGGAAAGAAGAGGG - Intergenic
1118295673 14:64566702-64566724 GTGTGCAGAGGGAATGGGGAGGG - Intronic
1118360587 14:65053363-65053385 CTCTGGGGAGGGAAGGGAGAGGG + Intronic
1118492387 14:66273764-66273786 CTGTAGAGACTGCATGAAGAGGG + Intergenic
1118592288 14:67410732-67410754 CTTTGGGAGGGGAATGAAGAGGG - Intronic
1118655018 14:67937755-67937777 CTGTGGTAAGGGGCTGAAGAAGG - Intronic
1119202380 14:72765976-72765998 CTCTGGGGAGGGAGTAAAGAAGG + Intronic
1119557790 14:75566912-75566934 CTGAGCAGAGGGAAGGAGGAAGG + Intergenic
1120299476 14:82688166-82688188 CTGGTGAGACAGAATGAAGAAGG + Intergenic
1120763859 14:88310501-88310523 CTGTGGAGAGGGACTTTATAGGG + Intronic
1121001872 14:90456839-90456861 ATGTGGAGTGGGGAGGAAGAGGG + Intergenic
1121338092 14:93089327-93089349 GTGTGGAGAGGGGAGGAACAGGG - Intronic
1122148185 14:99706569-99706591 CTGTGGAGAGGGAGGGCACATGG + Intronic
1122261399 14:100525199-100525221 CTCTGGTGAGGGGATGGAGAAGG - Intronic
1122262960 14:100533656-100533678 ATGTGGAGCAGGAATGAAAAAGG + Intergenic
1122293733 14:100693606-100693628 CCATGGAGAGGGAAGGAGGAAGG - Intergenic
1122825965 14:104370605-104370627 CTGTGGAAAGAGCGTGAAGACGG - Intergenic
1122983197 14:105200704-105200726 CTCTGGGGAGGGGATGGAGAAGG - Intergenic
1123038360 14:105480410-105480432 CTGTGGGGAGGTAAGGAAGGTGG + Intergenic
1126769105 15:52037322-52037344 CTCTGGTGAGGGTCTGAAGAAGG - Intronic
1128395744 15:67223638-67223660 CTGTGGAGAGTAGATGATGAGGG - Intronic
1128797647 15:70477311-70477333 CTATGGGGAGGGAATGGGGAGGG - Intergenic
1129200147 15:73993843-73993865 CTGGAGAGCGGGTATGAAGAGGG - Intronic
1129332048 15:74832719-74832741 ATGGGGAGGGGGAAGGAAGAAGG - Intergenic
1129686387 15:77688445-77688467 ATGGGGAGAGGGAGGGAAGAGGG + Intronic
1129858862 15:78844645-78844667 CTGTGGCCAGTGAATGAGGATGG - Intronic
1130010648 15:80151195-80151217 CCCTGGGGAGGGAATGAAGGTGG - Intergenic
1130012332 15:80161329-80161351 CTGTGCAATGGGACTGAAGATGG + Intronic
1131816189 15:96223656-96223678 CTGGGGAGAGAGAATAAATATGG + Intergenic
1132507499 16:318880-318902 CTGTGCAGAGAGAATGCAGCCGG + Intronic
1132682004 16:1146265-1146287 CTGTGGAGTGGGAAGGAGGAGGG - Intergenic
1133688478 16:8189785-8189807 CTGTGGAGAGGGATGGAGGGTGG - Intergenic
1133985367 16:10664264-10664286 CTGCAGGGAGGGAAGGAAGAGGG + Intronic
1135010870 16:18877442-18877464 GTGGGGAGAGGGAACGAGGAAGG + Intronic
1135317757 16:21465027-21465049 GTGGGGAGAGGGAACGAGGAAGG + Intergenic
1135370652 16:21896826-21896848 GTGGGGAGAGGGAACGAGGAAGG + Intergenic
1135441134 16:22473893-22473915 GTGGGGAGAGGGAACGAGGAAGG - Intergenic
1136034111 16:27525724-27525746 CTGAGGAGTGTGAATGAAGTCGG + Intronic
1136314528 16:29444709-29444731 GTGAGGAGAGGGAACGAGGAAGG + Intronic
1136327970 16:29546477-29546499 GTGGGGAGAGGGAACGAGGAAGG + Intergenic
1136442655 16:30286478-30286500 GTGAGGAGAGGGAACGAGGAAGG + Intergenic
1136508486 16:30721493-30721515 CTGTGGTGAGGGACTTGAGATGG + Intronic
1136991127 16:35151999-35152021 CTGTGGAGAGTGGATGGAGCTGG - Intergenic
1137534132 16:49304716-49304738 CTGGGGAAAGGGAGTGGAGAAGG + Intergenic
1138092170 16:54183940-54183962 GTGTGGAGAGGGCATGGAGCCGG + Intergenic
1138139147 16:54552167-54552189 CTCTGGGGAGGGAAACAAGATGG - Intergenic
1138207408 16:55134946-55134968 CTGTGCAGAGGAGATGAAAATGG - Intergenic
1138482658 16:57314068-57314090 CTGAGGAAAGGGAATGAGAAGGG + Intergenic
1138529532 16:57627607-57627629 CTCTGGAGCTGGAATGCAGACGG + Intronic
1138763587 16:59572784-59572806 CTGTGGAGTGGGAATAAACTTGG + Intergenic
1139889401 16:70238966-70238988 GTGGGGAGAGGGAATGAGGAAGG + Intergenic
1140649425 16:77070839-77070861 GAGAGGAGAGGGAATGCAGAAGG + Intergenic
1140657461 16:77155432-77155454 CTATAGAGAGGGAAAGTAGAGGG - Intergenic
1140712879 16:77694662-77694684 CTATGAGGAAGGAATGAAGAGGG + Intergenic
1140792800 16:78408419-78408441 CAGTGGAGAGGGAATGTGGTGGG - Intronic
1141011429 16:80404012-80404034 CAGTGGGGAGGGAGTGAACAAGG - Intergenic
1141137302 16:81474638-81474660 CTGTGGAAGGGGAATGATGGGGG + Intronic
1141886484 16:86895787-86895809 CTGGGAAGAGGGAGAGAAGAGGG + Intergenic
1143270855 17:5673420-5673442 CTGGAGAGTGGGAAGGAAGAGGG + Intergenic
1143327104 17:6106593-6106615 CTCTGGGGAGGGAAGGAGGATGG + Intronic
1143462624 17:7114008-7114030 CTGTGAACAGGGACTGAGGAGGG - Intronic
1144580552 17:16456626-16456648 CTGTGCAGAGGGAACACAGAGGG + Intronic
1144708630 17:17386087-17386109 ATGAGGAGAGGAAATGAAGGAGG - Intergenic
1144728305 17:17512655-17512677 CTGTGGGCAGGGGATGGAGAGGG + Intronic
1144796343 17:17893814-17893836 ATGTGGGGAGGGAAGGAAAAGGG + Intronic
1145014573 17:19387845-19387867 CTGGGGAGGGGGACTGGAGAGGG - Intergenic
1146296095 17:31651877-31651899 CTGTGGAGCGGGCAGGAGGATGG + Intergenic
1146554770 17:33813923-33813945 CAGTGGAGGGAGAATGAGGAAGG + Intronic
1146919704 17:36702533-36702555 CTGTGGGAAGGGGATGATGAGGG - Intergenic
1146949988 17:36899345-36899367 CTGTGGAGATGGAATTCAGTAGG + Intergenic
1147342050 17:39758507-39758529 CTGTGGCGAGGGATTGGGGAAGG + Intergenic
1148071762 17:44912626-44912648 CTGTGGACAGGAAGAGAAGAAGG - Intronic
1148712090 17:49689365-49689387 CAGTGGAGATGGAAGGAAGTAGG - Intergenic
1150271569 17:63869311-63869333 CTGTGGGGAGGGATGGAATAGGG - Intergenic
1150275104 17:63892192-63892214 CTGTGGGGAGGGATGGAATAGGG - Intergenic
1150277243 17:63906953-63906975 CTGTGGGGAGGGATGGAATAGGG - Intergenic
1150628610 17:66859846-66859868 GGGTGGAGAGGGAGAGAAGAGGG - Intronic
1150935928 17:69635694-69635716 CTGTGGAGATGGACAGAAAAGGG + Intergenic
1151016182 17:70555853-70555875 CTGGAGAGAGGGAATGAGGGAGG + Intergenic
1152070283 17:78130866-78130888 CAGTGGAGGGAGAATGCAGAGGG + Intronic
1152348945 17:79772501-79772523 CTGGGGACAGGGAAGGAGGAAGG + Intergenic
1152710663 17:81869292-81869314 CTGTGGCCAGGGAATGGAGGCGG - Intronic
1152735227 17:81993944-81993966 CCCTGGAGAGGGACTGATGAGGG + Intronic
1153638048 18:7129904-7129926 ATGTGGAGCGAGAATGAAGAAGG + Intergenic
1153733698 18:8042951-8042973 CGGTTGAGACGGAGTGAAGAGGG - Intronic
1153925651 18:9832740-9832762 CTCTGAAGAGTGAATGATGATGG + Intronic
1155416694 18:25606206-25606228 CTGTTGATAAGGAATGACGAGGG - Intergenic
1155648927 18:28116557-28116579 CAGTGGAGAGTGAATGACCATGG + Intronic
1156719287 18:40049940-40049962 CTCTAGAGTGGGAATGAATATGG - Intergenic
1156887734 18:42155224-42155246 CCCTGGAGAGGGAGTGGAGAGGG - Intergenic
1157024992 18:43831842-43831864 CAGTGGAGAGGGAGAGAAGGGGG - Intergenic
1157246012 18:46056059-46056081 CTGTAGAGAGAGAAGGGAGAGGG - Intronic
1158454666 18:57595494-57595516 CTGTGGAGGGAAAAAGAAGAGGG - Intergenic
1158938015 18:62383048-62383070 GTGTGGAGAGGGGGTGGAGAAGG + Intronic
1159431894 18:68362897-68362919 CAGTGGAGAGGGGATGCAGGAGG - Intergenic
1160205080 18:76824812-76824834 CTCTGGAGATGGAAAGAGGAGGG - Intronic
1160954156 19:1682423-1682445 GAGTGGAGAGTGAGTGAAGACGG - Intergenic
1161821539 19:6533551-6533573 CTCTGGAGGGGGAAGGAAGGGGG - Intronic
1162098454 19:8324831-8324853 CTGGGGAGTGGGGAGGAAGAGGG + Intronic
1162543646 19:11314742-11314764 CTCTAGAAAGGGCATGAAGAGGG + Intronic
1164676375 19:30104304-30104326 CTGTGGAGAGGGTGTGTGGAGGG - Intergenic
1164840725 19:31390311-31390333 ATGGGGAGAGGGAAGGAACAGGG + Intergenic
1164899904 19:31909685-31909707 TTGTGGAGAGGGGGTGATGATGG + Intergenic
1165451461 19:35886209-35886231 CTGTGGAGCGGGTATGAGAATGG + Intergenic
1165454580 19:35903328-35903350 CTGTGGAAAGAGAAAGAAGGTGG - Intronic
1165854621 19:38871871-38871893 CTGTGGTGGGGGGAGGAAGAAGG + Intronic
1166007343 19:39916573-39916595 CTGGGGAAAGGGAAGGCAGAGGG - Intronic
1166574202 19:43821638-43821660 CTGTAGATAGGGAATGAGTAGGG + Intronic
1166974828 19:46599952-46599974 CAGTGGAGAGGTAAAGAAGATGG - Intronic
1167421103 19:49403855-49403877 GTGTGGAGGGGGAAGGTAGAGGG - Intronic
1167612305 19:50513417-50513439 CTGGGGAGAGGGAAAGGAGAGGG + Intronic
1167620110 19:50555918-50555940 GGGTGGAGAGGGATTGAAGCCGG + Intronic
1168098259 19:54127754-54127776 ATGGGGAGAGGGAAAGGAGAAGG - Intronic
1168331239 19:55570421-55570443 CTGTAAAAAAGGAATGAAGAGGG + Intergenic
1168420654 19:56200682-56200704 CTGATGAGAGGAAATGAAGAGGG + Intergenic
1168425930 19:56238703-56238725 CTGATGAGAGGAAATGAAGAGGG + Intronic
1168677012 19:58285939-58285961 CTATGGGGAGTGCATGAAGAGGG + Exonic
925068537 2:949736-949758 CCGTGGAGAGGGAATAAAACGGG + Intergenic
925101563 2:1251002-1251024 CTCTGAAGAGAGAATGGAGATGG - Intronic
925174133 2:1770598-1770620 CTGGGCAGAGGGGAAGAAGAGGG - Intergenic
925196215 2:1928268-1928290 CTGTGCAGAGGAAATGAAGTTGG + Intronic
925306138 2:2849264-2849286 CTGTGGAGGGGGCAGGCAGATGG - Intergenic
925637112 2:5951165-5951187 CTGGGGAGAGAGAAGGAGGAAGG - Intergenic
926453363 2:13034985-13035007 TTGTGGAGTAGGAAGGAAGATGG + Intergenic
926509597 2:13758209-13758231 CTGTTGAGATGGACTAAAGAGGG - Intergenic
926898469 2:17722174-17722196 CTGGAGAGAGGGAATGAATGAGG - Intronic
926918550 2:17916630-17916652 CAATGGAGGGGGAATGAAGCAGG - Intronic
927000321 2:18788213-18788235 CTGTGGACAGGGCATGAAAGAGG + Intergenic
927294721 2:21440835-21440857 CTGTGGAGAGGGAATCCAAGGGG - Intergenic
927686540 2:25175070-25175092 CTATGGAGAGAGAATGAAGAAGG - Intergenic
927702146 2:25275544-25275566 CTGTGGAGAGGGAAGAACAAAGG + Intronic
928306534 2:30174478-30174500 CTGTCCAGAGGGAGTTAAGAGGG - Intergenic
928312219 2:30220507-30220529 CTGAAGAGAGGCAATGAAGCAGG + Intergenic
928458549 2:31448249-31448271 CTTTGGTGAGGGGAGGAAGATGG + Intergenic
929346781 2:40894253-40894275 CTGTTGAAAGGGAAACAAGATGG + Intergenic
929569855 2:43015608-43015630 CTGTGGAGAGACAATGAGGAAGG + Intergenic
930059611 2:47277273-47277295 CTGGGGAGAGGTAATAAAGGAGG - Intergenic
930462894 2:51706436-51706458 CTATGGAGATGGATTGAACAGGG - Intergenic
930730325 2:54723215-54723237 CGGTGGAGTTGGAATGGAGACGG - Intergenic
931286209 2:60834086-60834108 CAGTGGAGAGGGTATGAGAATGG + Intergenic
931941047 2:67252740-67252762 ATGTGGACAGATAATGAAGAAGG + Intergenic
932408377 2:71529207-71529229 ATGTGGAGAGAGAAAAAAGAAGG - Intronic
932841601 2:75088310-75088332 GCGTGGAGAGGGAAGGAAGGAGG - Intronic
933158017 2:78995191-78995213 AAGTGGGGAGAGAATGAAGATGG - Intergenic
934126235 2:88893701-88893723 CTGTGGAAAAGGAAGTAAGAGGG + Intergenic
934618806 2:95791795-95791817 CTGTGCAGAGGGAAAGAATGAGG - Intergenic
934642087 2:96032762-96032784 CTGTGCAGAGGGAAAGAATGAGG + Intronic
936542551 2:113363961-113363983 GTGTGGGGAGGAACTGAAGAAGG - Intergenic
937096537 2:119239205-119239227 GTGTAGAGAGGGAAAGAGGAAGG - Intronic
937220884 2:120342838-120342860 CTGTGGAAAGGGAGAGAATATGG - Intergenic
937226481 2:120373267-120373289 CTCTGGGGAGGGAGAGAAGAAGG + Intergenic
937251760 2:120528343-120528365 ACGTGGTGAGGGAAGGAAGAGGG + Intergenic
937957234 2:127428240-127428262 CTGGGCAGAGGGCCTGAAGAAGG - Intronic
938118302 2:128617060-128617082 CTGTGCAGAGGGAATGCAAATGG - Intergenic
938566583 2:132524202-132524224 CTGTGAAGAGGGAACGAAGAGGG + Intronic
939463888 2:142532221-142532243 CAGTGGAGAGGGGATGCAGAGGG - Intergenic
939623246 2:144446396-144446418 ATGTGGAGAGGGAAGAAGGAGGG - Intronic
939875667 2:147574545-147574567 CTATGGAGAGGGGAAGAACAGGG - Intergenic
940211944 2:151264021-151264043 TTCTTGAGAGGGAATTAAGAAGG - Intergenic
941377483 2:164749964-164749986 CTGAGGAGTGGCAGTGAAGAAGG - Intronic
941801690 2:169666668-169666690 CTGTGAAGAGTCAATGAATATGG - Intronic
942520029 2:176793919-176793941 CTCTGGGTAGGGAATAAAGAGGG - Intergenic
942997874 2:182286645-182286667 CGGTGGAGAGGGAAAGAACATGG + Intronic
943030380 2:182678802-182678824 AGGGGGAGAGGGAATGGAGAGGG + Intergenic
943256569 2:185601177-185601199 CTGTGGAAAGTGAATGAAGGGGG + Intergenic
943339286 2:186658678-186658700 CTATTGAGAAGGAATGCAGAGGG + Intronic
945141443 2:206690885-206690907 CTGTGGAGGAGGAATGAAGCTGG + Intronic
945416320 2:209577346-209577368 CTGGGGAGAGAGGATGATGATGG + Intronic
946086563 2:217179351-217179373 CTTTGAAGATGGAAGGAAGATGG + Intergenic
946123226 2:217535066-217535088 GTGAGGAGAGCAAATGAAGATGG - Intronic
946127165 2:217572977-217572999 CTGATGAGATGGAATTAAGAAGG + Intronic
946522303 2:220479714-220479736 CTGTGGAGAGGTAAGGAAGAAGG - Intergenic
946659135 2:221980491-221980513 ATGGGGGCAGGGAATGAAGATGG + Intergenic
946669783 2:222090248-222090270 CCGTGGAGAGGCCATGGAGAGGG + Intergenic
948119886 2:235522226-235522248 CTGTGGACAGGGAGTCCAGATGG + Intronic
948291835 2:236831428-236831450 CCATGGAGAGGGAAGAAAGAAGG - Intergenic
948334737 2:237199133-237199155 TTTTGGAGAGGGAAAGCAGATGG + Intergenic
1168918214 20:1508874-1508896 CTGTGCACAGAGAATGAATATGG + Intergenic
1169192971 20:3669503-3669525 AGGTGGAGAGGGAAGGGAGAAGG - Intronic
1170779766 20:19414021-19414043 CTCTGAAGAGGGAATGCAAATGG + Intronic
1170829905 20:19830971-19830993 CTGTGGAATGGGAAGGAAGCAGG - Intergenic
1171002310 20:21426815-21426837 CAGTGGAGAGGGAGAGCAGAAGG - Intergenic
1171293697 20:23998072-23998094 AAGTGGAGAGGGAAGGGAGAAGG - Intergenic
1172834215 20:37862658-37862680 CAGAGGGGTGGGAATGAAGATGG - Intronic
1173854002 20:46238052-46238074 CTGTGGAGAAGGGCTGAGGATGG - Intronic
1175427885 20:58881475-58881497 GTCTGGAGAGGGAAGGAAGAAGG - Intronic
1175708238 20:61197285-61197307 CTGGGGAGAGAGAGTGCAGAGGG - Intergenic
1175921512 20:62452530-62452552 CTGAGGAGAAGGACTGAGGAGGG - Intergenic
1175998635 20:62822224-62822246 CTGGGGAGGGGGAATGGGGAGGG - Intronic
1176515906 21:7783259-7783281 CTGGAGGGAGGGAATGGAGAGGG - Intergenic
1177942626 21:27430031-27430053 CTGTGCAAAGGGAATAAATATGG - Intergenic
1177944914 21:27455938-27455960 TGGGGGAGAGGGAAGGAAGAAGG - Intergenic
1178045500 21:28689670-28689692 CTGTGAAGAGACATTGAAGATGG + Intergenic
1178178648 21:30133338-30133360 TTCTGGAGAGGAATTGAAGAGGG - Intergenic
1178434480 21:32545909-32545931 CTAGGGAAAGGGAAGGAAGAAGG - Intergenic
1178649934 21:34413271-34413293 CTGGAGGGAGGGAATGGAGAGGG - Intergenic
1179182985 21:39061356-39061378 ATCTGGAGAGGGGCTGAAGATGG - Intergenic
1179281022 21:39934410-39934432 CTGCAGAGAGGGGATGATGATGG + Intergenic
1179339117 21:40487700-40487722 CAGGGGAGAGGCAGTGAAGATGG + Intronic
1180061023 21:45385157-45385179 CTTTGGTGAGAGAATGCAGATGG - Intergenic
1180124850 21:45783810-45783832 CAGTGGTGAGGGTGTGAAGATGG + Intronic
1181037382 22:20176426-20176448 ATGTGGAGGGAGAAGGAAGAAGG - Intergenic
1181759902 22:25051111-25051133 CTGAGGAGAGGAAATCAAGCAGG - Intronic
1182074608 22:27487376-27487398 CTGGGGAGAATGATTGAAGAGGG - Intergenic
1182082450 22:27538899-27538921 ATGTGGACAGGGAAGGAGGAAGG - Intergenic
1182243206 22:28933905-28933927 CGGTGGAGATGGAATGATGGTGG + Intronic
1182630058 22:31678199-31678221 CTGTGGATAAGGAAGGAGGAGGG + Intronic
1184532404 22:45064554-45064576 CTGTGGACAGTGGATAAAGATGG + Intergenic
1184693848 22:46129233-46129255 CAGTGGAGAGGGGAAGGAGATGG + Intergenic
949337065 3:2986471-2986493 CTGATGAGAGGGTATGAAGGTGG - Intronic
949708189 3:6842834-6842856 AGCTGGAGAGGGAAGGAAGAAGG - Intronic
950616691 3:14165586-14165608 CTGTGAAGAGGAAAGGAGGAAGG + Intronic
951074496 3:18373150-18373172 CTTTAGAAAGTGAATGAAGAAGG + Intronic
951191155 3:19773049-19773071 ATGTAGGGAGGGAAAGAAGAAGG + Intergenic
951698448 3:25469926-25469948 CTGTGGAGAGGGGCTTAAAAAGG + Intronic
952007928 3:28863836-28863858 CTGGTGAGAGGGAAAGGAGAAGG - Intergenic
952077998 3:29721867-29721889 GTGTACAGAGAGAATGAAGATGG - Intronic
952364392 3:32662066-32662088 CTGAGGGGAGGGAGTGGAGAGGG + Intergenic
953620893 3:44531889-44531911 CTGTGGAGATGGAAAGAAATGGG - Intergenic
953718178 3:45333535-45333557 CTGTGCAGATGGAAGGAAGTGGG + Intergenic
954440019 3:50516680-50516702 CTGGAGAGAAGGAATGCAGAGGG - Intergenic
954982328 3:54757619-54757641 ATTTTGAGTGGGAATGAAGATGG + Intronic
955019545 3:55105992-55106014 CTGGGGAGGGGGAATGAATGAGG + Intergenic
955079027 3:55640617-55640639 CTGTGGTAAGGGCATGAGGAAGG + Intronic
955324452 3:57999207-57999229 CTGTGGTAAGAGAATGAAGGCGG - Intergenic
955462799 3:59203325-59203347 CTTGGGAGAGGGGGTGAAGAGGG - Intergenic
955474076 3:59317477-59317499 CTGTTGAGTTGGAATGAAGGTGG - Intergenic
955884813 3:63586492-63586514 CTGGGGATAGGGATGGAAGAAGG - Intronic
956014499 3:64867385-64867407 TAGTGGAGAAGGAAAGAAGAGGG + Intergenic
956349489 3:68319338-68319360 CTGGGGTGGGGGAATGATGAAGG - Intronic
956386659 3:68726309-68726331 CTGTGGAAAGTCAATGCAGATGG - Intergenic
956840539 3:73135819-73135841 CTGTGGAAAGGGAATGTAGTGGG + Intergenic
957024117 3:75160373-75160395 CTGGAGACAGGGATTGAAGAGGG - Intergenic
959549091 3:107633906-107633928 CTATGGAGAGGTTATGAAGAGGG - Intronic
959743513 3:109748896-109748918 AAGTGGAGAGGGAAAGTAGAAGG - Intergenic
959935000 3:112020117-112020139 CTGTGTAAAAGGAATAAAGATGG + Intergenic
960035129 3:113094593-113094615 CTGGGCAGAGGAAAAGAAGAAGG + Intergenic
960213900 3:115006282-115006304 CTATGGAGGGGGAATGGAGAGGG - Intronic
961345286 3:126260116-126260138 ATGTGGAGAGGGAAGGGGGAGGG - Intergenic
962205189 3:133428433-133428455 CTGTGGGGAGTGAATGCACATGG + Intronic
962412564 3:135154129-135154151 CTGTGGAGAGAGAAAGAAACAGG - Intronic
962829681 3:139129066-139129088 TTGTGGGGAGGGAATGAATGGGG + Intronic
962982933 3:140507092-140507114 CTGGGCAGAGGGAGGGAAGAGGG + Intronic
962991109 3:140578211-140578233 GTGGGGAGAGGGCAGGAAGATGG - Intergenic
963010583 3:140766483-140766505 ATGTTGGGAGGGAATGAAGTGGG - Intergenic
964666803 3:159183396-159183418 GTATAGAGAGGGCATGAAGAAGG - Intronic
965007598 3:163045029-163045051 CTAAGGAGAGGGAATGACAACGG + Intergenic
965469301 3:169071036-169071058 GGATGGAGAGGGAATGCAGAGGG - Intergenic
965961983 3:174440253-174440275 CTGAAGCGAGGGAAGGAAGAAGG - Intronic
966624850 3:182004844-182004866 CTGTGGAGCTGGCAGGAAGAAGG - Intergenic
966887948 3:184386992-184387014 CTTTGGGGAGGGAATGAGGGTGG + Intronic
966888263 3:184388564-184388586 CTGTTGAGAGGGAAAGAGAAAGG - Intronic
967719282 3:192798539-192798561 CTGTGGAGAGGGGATGCTGGTGG + Exonic
967788409 3:193521979-193522001 CTGTGGAGGGGGAAAGATGGAGG - Intronic
970335347 4:15033870-15033892 GTGTGGAGAGGGAAATAGGAAGG + Intronic
970525067 4:16923907-16923929 CAGTGGAAAGGGAATGAACTTGG + Intergenic
973095353 4:46191132-46191154 CAGTGGAGAGGGACTGATGAGGG + Intergenic
973145390 4:46819280-46819302 CTCTGTAGAGGGAATGAATGAGG - Intronic
973236800 4:47914393-47914415 CTTTGGAGATGGACCGAAGAGGG + Exonic
974812151 4:66958321-66958343 CTGTAGAAAGGTAATGAATAAGG - Intergenic
974996828 4:69171110-69171132 CTGTGAAGAGGAAAGGAACACGG + Intronic
975394189 4:73855786-73855808 ATGGGGAGAGAGAATGAACAAGG + Intergenic
975712940 4:77178660-77178682 CTGTGGAAGGAGAAGGAAGAGGG + Intronic
976902531 4:90196588-90196610 ATGGGGAAAGGGAATAAAGAAGG - Intronic
978721179 4:111911457-111911479 CTGCGGAGAGAGAAGGGAGATGG + Intergenic
979514365 4:121590130-121590152 TTTTAAAGAGGGAATGAAGAGGG - Intergenic
979532136 4:121780141-121780163 TTGTGGAGAGTGAATGAACAAGG - Intergenic
981329807 4:143495518-143495540 CTGAGGAGAGGGAATTAAAAAGG + Intergenic
981715109 4:147744916-147744938 CTGCCGAGAGAGAATGTAGAGGG + Intronic
984105568 4:175541278-175541300 CGGTGGAGAGGAAAAGTAGATGG - Intergenic
984782875 4:183541839-183541861 CTGTGCAAGGGGAATGCAGAAGG - Intergenic
985073348 4:186190426-186190448 CTATGGAGTGGGAATGAAGATGG - Intergenic
985380057 4:189384038-189384060 CTGTGAAGAGAGAGTAAAGATGG - Intergenic
985960306 5:3297415-3297437 CTGTGGAGAAGGAAAGGATAGGG - Intergenic
985986874 5:3523314-3523336 CTATGGAGATGGCAGGAAGATGG - Intergenic
986703674 5:10436819-10436841 CTCTGGAGAAACAATGAAGATGG + Exonic
987190881 5:15477135-15477157 CTCTGCTGAGAGAATGAAGAAGG + Intergenic
988377436 5:30455432-30455454 GTGTGTAGAGGGAAAGAACAAGG + Intergenic
988987728 5:36637110-36637132 TGGTGGAGAGGCAATCAAGATGG - Intronic
989338135 5:40342845-40342867 TTGAGGGGAGGGAATGCAGAAGG + Intergenic
989530205 5:42499199-42499221 CTTTGGTAAGGGCATGAAGAGGG + Intronic
989612800 5:43311815-43311837 CTGTGGGGAGGGAGTGTAAAAGG - Intronic
989998148 5:50860220-50860242 CTCTGAAGAGAGAAAGAAGATGG - Intergenic
990194163 5:53294243-53294265 CTGGGGAGGGAGAATGAAAAAGG + Intergenic
990689170 5:58343469-58343491 GTGTGGAGAGAGTAGGAAGAGGG + Intergenic
990809941 5:59712235-59712257 CTATGGAAAGGTAATGAATATGG - Intronic
991611254 5:68451600-68451622 CTGTGGAGAGTGATTGATGTTGG + Intergenic
991998004 5:72407439-72407461 CTGTGGAGACAGAATAAAGTAGG + Intergenic
992006683 5:72485394-72485416 CTGGGAAGAGGTAATAAAGAAGG - Intronic
992735115 5:79711935-79711957 ATGCGAAGAGGGAGTGAAGATGG - Intronic
993023596 5:82621628-82621650 TTTTGGAAAGGGAATAAAGAAGG - Intergenic
993596238 5:89859473-89859495 TTGTGGAGAGCTAATGAAGCTGG - Intergenic
994140536 5:96336020-96336042 CTCTGGAGAGAGAATGGAGTGGG - Intergenic
995999050 5:118336016-118336038 CTTTGGAGAGTGAATTAGGAAGG - Intergenic
996179673 5:120403815-120403837 CTGTGGAGAGGCAATAGATATGG + Intergenic
996551273 5:124732942-124732964 CTGTATAGAGGGAGGGAAGAAGG - Intronic
997443506 5:133925410-133925432 CTCGGCAGAGGGAATGGAGAGGG - Intergenic
997958041 5:138295714-138295736 CCATGGAGAGATAATGAAGATGG + Intronic
998788054 5:145733974-145733996 CTATGGGGAAGGACTGAAGATGG + Intronic
1000421438 5:161042519-161042541 GTAGGAAGAGGGAATGAAGAAGG + Intergenic
1001162722 5:169335762-169335784 TTGGGGAGAGGGCAAGAAGAAGG + Intergenic
1002606435 5:180385499-180385521 TTGGGGAGAGGGAGTGGAGAGGG + Intergenic
1003269154 6:4591976-4591998 CTGGGGAGTGGGGATGAAGTTGG - Intergenic
1003334929 6:5161792-5161814 CTGAGGAGAAGGAAAGACGAAGG + Intronic
1003783424 6:9455919-9455941 ATGTAGAGAGGGATGGAAGAGGG + Intergenic
1003791672 6:9553264-9553286 CAGTGGAGAGGGGATGAAGATGG + Intergenic
1003974134 6:11326775-11326797 GAGTGGAGGGGGAAGGAAGATGG - Intronic
1004478918 6:16000459-16000481 CTGTGGAGTTGGAATAAAAATGG + Intergenic
1004485498 6:16062670-16062692 CTGTGGAGAGGGATTGCTGGTGG - Intergenic
1005332614 6:24764410-24764432 CTGTGGAGAAGGAGGTAAGAGGG - Intergenic
1006657547 6:35608734-35608756 GTGAGGATAGGAAATGAAGAGGG - Intronic
1006824097 6:36921447-36921469 CTGTGGAGATGGAGGGGAGAGGG + Intronic
1007308652 6:40927252-40927274 CTGGGGAAAGTGACTGAAGAGGG + Intergenic
1010049020 6:71481751-71481773 GTGTGGAGAATGAATTAAGAGGG - Intergenic
1010495005 6:76523415-76523437 CTGTGGAGTCAGAATGTAGAGGG - Intergenic
1010892460 6:81330668-81330690 CTTTGGAGGGCCAATGAAGAAGG + Intergenic
1011569497 6:88719165-88719187 CTAGGCAGAGGGATTGAAGAAGG - Intronic
1012135666 6:95552782-95552804 CTATGGAGAAGGAATGAGGCAGG - Intergenic
1012685542 6:102243487-102243509 GTGTGGAAAGAGAATGGAGAAGG - Intergenic
1012692829 6:102336399-102336421 CTTTGAAGATGGAAGGAAGAGGG - Intergenic
1013556623 6:111262803-111262825 CCCTGGATTGGGAATGAAGAGGG + Intronic
1013778790 6:113707627-113707649 TTTTTGAGGGGGAATGAAGATGG + Intergenic
1014813041 6:125906666-125906688 CTGGGGAGAGAGGAGGAAGAGGG + Intronic
1014854802 6:126386698-126386720 CAGTGGAGGGGGAATAAAAAAGG - Intergenic
1015445469 6:133299034-133299056 CTGTGGTGGGGGAATGAAGCAGG + Intronic
1017027207 6:150191918-150191940 GTGTAGATAGGGAAAGAAGAGGG + Intronic
1017453447 6:154576067-154576089 ATGAGCAGAGGGACTGAAGAGGG + Intergenic
1017608548 6:156159100-156159122 CTCTGCAGGAGGAATGAAGAGGG - Intergenic
1017638844 6:156470748-156470770 TTGTGGGGAAGGAATGAAGAGGG + Intergenic
1018236315 6:161727300-161727322 CTCTGCAGAGGGACAGAAGAGGG + Intronic
1018299848 6:162389524-162389546 CTGGGTAGAGGGAATGCAAATGG - Intronic
1018596102 6:165482344-165482366 CTGGGGATAGAGAAGGAAGAGGG + Intronic
1018617013 6:165696103-165696125 TTGGGGAGGGGGAAGGAAGATGG + Intronic
1018712560 6:166507142-166507164 CTGGGAAGAGGGAGGGAAGAGGG - Intronic
1018721224 6:166574043-166574065 CTGTAGAGAGAGAATGACCACGG - Intronic
1021205676 7:17777021-17777043 CTGGGGATAGGGAATGAGGAGGG - Intergenic
1021667400 7:22998649-22998671 CTGTGGAGATGGAGAGCAGATGG - Intronic
1022275877 7:28854705-28854727 CTGTGGATAGGTAAAGAATAGGG - Intergenic
1022547238 7:31200756-31200778 CTGTGGGAAGACAATGAAGATGG + Intergenic
1022548893 7:31217651-31217673 CTGAGGAGAGGGAGAGATGAGGG + Intergenic
1022571969 7:31463153-31463175 CTTTGGAGAGGGTAAGAGGAAGG + Intergenic
1022825942 7:34013959-34013981 AAGTGGTGAGGGAAAGAAGATGG - Intronic
1023460760 7:40393747-40393769 CTGAAGGAAGGGAATGAAGATGG + Intronic
1023599882 7:41871735-41871757 TATTGGAGCGGGAATGAAGAAGG + Intergenic
1023882652 7:44329292-44329314 GTGTGTTTAGGGAATGAAGACGG + Intronic
1024009629 7:45256813-45256835 CTGTGAAGTGGGTATGAACAGGG - Intergenic
1026225785 7:68439238-68439260 AGGTGGGGAGGGAATGGAGATGG + Intergenic
1026792071 7:73340615-73340637 CTGTGGAGAGGGAAGGCAGATGG - Intronic
1027005987 7:74693503-74693525 CTGAGGAAAGGGAATGATGGGGG - Intronic
1027459108 7:78430008-78430030 CTCTGGAGCATGAATGAAGAAGG - Intronic
1027563697 7:79764640-79764662 TTGTGGAGAGGGAATTAAGAGGG - Intergenic
1027634179 7:80648890-80648912 CAGTGAAGATGGAAGGAAGAAGG + Intronic
1028193696 7:87880206-87880228 CTGTGGAGATAGAAGAAAGAAGG - Intronic
1029128672 7:98313201-98313223 CTGTGGAGTTGGGATGAAGCAGG - Intronic
1029449650 7:100633592-100633614 CGGAGGAGAGGGAGGGAAGAGGG + Intronic
1029540727 7:101180478-101180500 CTGGGGAGTGGGACTGAGGATGG + Intergenic
1029882409 7:103829336-103829358 CTGGGGGAAGGGAAAGAAGAAGG - Intronic
1030124116 7:106138532-106138554 CTGTGGAGAGGGAGATGAGAGGG + Intergenic
1030681503 7:112439185-112439207 CTGTGGAGGCGGAATGAAGTGGG + Intronic
1031378450 7:121056514-121056536 ATGTGGAGAGAGAATGGAAAAGG - Intronic
1031543477 7:123024475-123024497 CGGTGAAGTGGGAATGAGGAGGG - Intergenic
1031656710 7:124364979-124365001 CTGAGGAGAGGGAAGGACCAAGG + Intergenic
1031907711 7:127479359-127479381 CTTTGAAGAGGAAATAAAGATGG + Intergenic
1031964945 7:128020960-128020982 ATGAGGAGAGGGGATGCAGAGGG - Intronic
1032441703 7:131947268-131947290 CTCTGGAGAAGGAAAGAAGGAGG + Intergenic
1032478107 7:132226025-132226047 CAGAGGAGAGGGAGTGAAGGAGG + Intronic
1032644995 7:133813836-133813858 GTGTGGTGGGGGGATGAAGATGG - Intronic
1033970956 7:147038971-147038993 GTGTGAAGAAGGAATGAACAGGG - Intronic
1033982813 7:147187118-147187140 CTGGGGAGAAAGAATGAACATGG + Intronic
1034559717 7:151872233-151872255 CTGTGATGAGAGAATGCAGAAGG - Intronic
1034828923 7:154292009-154292031 ATGAGGAGAGGAAAGGAAGAAGG + Intronic
1035343144 7:158177536-158177558 CTGTGGACAGGGATGGGAGAGGG - Intronic
1035373206 7:158392134-158392156 CCGTGGGGAGGGAATGAGGGTGG + Intronic
1035671950 8:1424869-1424891 CTGGGGAGGGAGAATGAGGAGGG + Intergenic
1036224957 8:6949791-6949813 CTGGGGAAAGGGAATGAACCAGG - Intergenic
1036234558 8:7026989-7027011 CTGCGGAAAGGGAATGAACCAGG - Intergenic
1037452907 8:19034886-19034908 GTGAGGAGAGGGGATGCAGAGGG - Intronic
1037680678 8:21095036-21095058 AGGTGGAGAGGGAAAGATGAAGG + Intergenic
1037681026 8:21097587-21097609 AGGTGGAGAGGGAAAGATGAAGG + Intergenic
1037745915 8:21643966-21643988 CTGTGGCCAGGGAATAAAGTGGG + Intergenic
1037848465 8:22305904-22305926 CTTTGAAGAGAGAACGAAGAGGG - Intronic
1038109470 8:24479532-24479554 CAGTGGAGTGGGCCTGAAGAAGG - Intronic
1038539987 8:28384357-28384379 CTGTGAGGTGGGAATGAACATGG - Intronic
1039177013 8:34820148-34820170 CTTTGGAGAGGGGAGGAGGAAGG + Intergenic
1039539823 8:38356042-38356064 CTGGGGAGTGGGAGTGGAGAAGG - Intronic
1039652632 8:39358715-39358737 CTGTGGAGAGGGAAAGACAGGGG - Intergenic
1039919281 8:41882051-41882073 CTTTGGAGAGGGACTGTTGAAGG + Intronic
1041124648 8:54622860-54622882 CTTTGGATAGGGGAGGAAGAGGG + Intronic
1042047687 8:64672428-64672450 AGGAGGAGAGGGAATTAAGAAGG - Intronic
1042486067 8:69346966-69346988 CTAGGCAGAGGCAATGAAGATGG + Intergenic
1044869602 8:96606050-96606072 CTGTGGAGTCCTAATGAAGATGG + Intronic
1045063998 8:98429272-98429294 CTTTGGAGATGGAATGAAGGAGG + Exonic
1045617731 8:103938121-103938143 ATGTGGAGAATGATTGAAGAGGG + Intronic
1046093312 8:109528624-109528646 ATGTAGAGTGGGAAGGAAGAAGG - Intronic
1046314237 8:112478977-112478999 CAGTGGAGAGGGGATGCAGGAGG - Intronic
1047306069 8:123654071-123654093 CTGTGGAGAGTCACTGAAGATGG + Intergenic
1048190204 8:132281580-132281602 AGGTGGAGATGGAATGAAGTAGG - Intronic
1048277830 8:133080588-133080610 CTGTGGGAAAGGGATGAAGATGG - Intronic
1048435329 8:134411277-134411299 GTGTGGAGAGTGAATGGTGATGG - Intergenic
1048457064 8:134587782-134587804 CTATGGAGAAGGAATTCAGAAGG - Intronic
1049040352 8:140108094-140108116 CTGTGGAGGATGAATGGAGAAGG + Intronic
1049372940 8:142276327-142276349 AGGAGGAGAGGGAAGGAAGATGG + Intronic
1049938991 9:526684-526706 CTGAGGAGAGGGAATCAGGTGGG - Intronic
1050537896 9:6645830-6645852 CTGGGAAGAGGGTAGGAAGAGGG - Intergenic
1050749113 9:8916237-8916259 AGGTAGAGAGGGAAGGAAGAAGG + Intronic
1051235971 9:14999543-14999565 CTGTGAATAGAGAAGGAAGATGG + Intergenic
1051282825 9:15460185-15460207 CTCTGGACAGAGAATGAATAGGG - Exonic
1051907985 9:22118334-22118356 CTGTTGAGAGGGAGTGGAGTGGG - Intergenic
1052249901 9:26385964-26385986 CTCTGGAGAGAGAATAAACATGG + Intergenic
1053917598 9:42954848-42954870 ATGTGGAGAGGCCATGGAGAAGG - Intergenic
1055760458 9:79601679-79601701 CTGAGGAGAGGGAAAGAAGGGGG - Intronic
1058069273 9:100585192-100585214 ATTGGTAGAGGGAATGAAGAAGG + Intronic
1058458841 9:105163808-105163830 CTCTGGAGAGGGGATGGGGAAGG - Intergenic
1059171654 9:112130468-112130490 CAGAGGAGAGGGAAAGGAGAGGG + Intronic
1059687405 9:116650838-116650860 CTGTGGAAGGGGAAAGAACAGGG - Intronic
1059779435 9:117510622-117510644 CTGTGGAGGGGGAATAACAAAGG - Intergenic
1059940040 9:119349770-119349792 CTGTGGAGGGGAAGTGCAGAGGG + Intronic
1060031597 9:120219035-120219057 CTGATGAGAGGGAAGGAAGCAGG + Intergenic
1060809636 9:126604074-126604096 CTAGGAAGAGGGAGTGAAGAGGG + Intergenic
1062000142 9:134211806-134211828 CTGTGGAGAAAGAAGGCAGAGGG + Intergenic
1203776435 EBV:75693-75715 CTGTGGTGAGGGATAGAAGGGGG + Intergenic
1185656587 X:1690446-1690468 CTGTGGGAGGGGAATGAGGAGGG - Intergenic
1185689004 X:2137626-2137648 ATGGGGGGAGGTAATGAAGATGG - Intergenic
1185689027 X:2137854-2137876 GAGGGGAGAGGTAATGAAGATGG - Intergenic
1185895131 X:3851664-3851686 CAGAGGAGAGGGGATGGAGAAGG - Intergenic
1185900249 X:3890089-3890111 CAGAGGAGAGGGGATGGAGAAGG - Intergenic
1185905365 X:3928520-3928542 CAGAGGAGAGGGGATGGAGAAGG - Intergenic
1186051920 X:5605386-5605408 CTGTCAACAGGGAATGAACAAGG + Intergenic
1186416234 X:9385182-9385204 CTGTGGAACGGGACTGAAGCAGG + Intergenic
1186589601 X:10916084-10916106 CTTTGGAGGGGGGATGGAGAGGG + Intergenic
1187132222 X:16514086-16514108 ATGTGGAGAAGGAAGGAAGAAGG + Intergenic
1187207278 X:17195145-17195167 CTGAAGAGAGAGCATGAAGAAGG - Intergenic
1188575090 X:31639259-31639281 CTGTGGAGAGGGAATGAAGATGG + Intronic
1189194924 X:39144840-39144862 GTGTGGAGAGGGGATGGAGTGGG + Intergenic
1190930784 X:54948252-54948274 CATCGGAGATGGAATGAAGAAGG - Intronic
1192050776 X:67722072-67722094 ATGGGGAGGGGGAATGAAGAAGG - Intronic
1192090120 X:68145643-68145665 CTCTGGAGAGGGAAGGATGTGGG - Intronic
1192224713 X:69220398-69220420 CTATGCTGAGGGAAAGAAGAAGG - Intergenic
1193974774 X:88103681-88103703 GTGAAGAGAGCGAATGAAGAAGG + Intergenic
1194302832 X:92208933-92208955 TTAGGGAGAGGGAGTGAAGAAGG + Intronic
1195007873 X:100704482-100704504 CTGAGCAGAGAGGATGAAGAAGG + Intronic
1195283167 X:103356933-103356955 CTGTGGAGAGGGGGTGAACTAGG + Intronic
1196576603 X:117325747-117325769 CCATGGAAAGGGAAGGAAGAGGG - Intergenic
1197300547 X:124774862-124774884 CTGTGAAGAGGGAGATAAGAGGG - Intronic
1197374720 X:125668262-125668284 CTGTGGAAAGAGAATAAAGTTGG + Intergenic
1197494303 X:127158647-127158669 CTGGGGAGAGGGAGAAAAGATGG + Intergenic
1197899011 X:131348428-131348450 TTGTGGGGAAGGGATGAAGATGG - Intronic
1197910625 X:131479455-131479477 CTTGGGAGAGGGCATGAATATGG + Intergenic
1197982673 X:132234040-132234062 ATATGATGAGGGAATGAAGAGGG - Intergenic
1198096137 X:133381580-133381602 CTGTGGACAGGGAAGTCAGAAGG - Intronic
1198405033 X:136303836-136303858 AAAGGGAGAGGGAATGAAGATGG + Intronic
1198736003 X:139785910-139785932 CTGAGTAGAGGGAATGAGCACGG + Intronic
1198788837 X:140320082-140320104 CTCTGGAGAAAGAATGGAGATGG + Intergenic
1198924451 X:141772066-141772088 GTGTGGAGGGGGAAGGAAGAAGG + Intergenic
1199848227 X:151706931-151706953 CTGGGGAGAGGGCAAGGAGAGGG - Intergenic
1200058899 X:153475287-153475309 CAGTGGAGGGGGACTGCAGAGGG - Intronic
1201516497 Y:14824082-14824104 GTGGAGAGAGAGAATGAAGAAGG + Intronic
1201744806 Y:17360214-17360236 CTTTGGAGATGGAATCTAGAAGG - Intergenic