ID: 1188578780

View in Genome Browser
Species Human (GRCh38)
Location X:31685307-31685329
Sequence ATCCCAGGACATTCACATAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 110}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188578780 Original CRISPR ATCCCAGGACATTCACATAT AGG Intronic
909833237 1:80220994-80221016 CTCCCAGAGCATTCACATGTGGG + Intergenic
1062952407 10:1514743-1514765 ATCCCAGGACACTCAAATGTGGG + Intronic
1066341653 10:34540150-34540172 TTCCCAGGACATTCAATTACAGG + Intronic
1068221076 10:54046623-54046645 AACCCAGGAAATTAACATAGTGG + Intronic
1072305604 10:94103873-94103895 AGGCCAGGACATTCTCATTTCGG + Intronic
1072446580 10:95504043-95504065 ATAGCAGGCCATTCACTTATGGG + Intronic
1076843679 10:133058591-133058613 ATCCCAGGAAATTCCCAGAAAGG - Intergenic
1078628300 11:12978619-12978641 ATCCCAGGCCATTCTTAAATTGG - Intergenic
1078673661 11:13389041-13389063 CTCCCAGGACATTCGAATAAAGG + Exonic
1080451634 11:32383082-32383104 ACCCCAGGACTTTCACAATTAGG - Intergenic
1082756322 11:57080121-57080143 AACCCTGCACATTCACATAAAGG + Intergenic
1084486085 11:69449189-69449211 ATCCCAGGTTATTACCATATTGG + Intergenic
1085668877 11:78442434-78442456 TACCCAGGAGATTTACATATAGG + Intronic
1085789442 11:79484454-79484476 ATCCCAGGACATTTAGTCATTGG + Intergenic
1086099252 11:83082047-83082069 ATCCCAGGAGATTCTGATGTTGG - Intergenic
1086642752 11:89179938-89179960 TTCCCATCCCATTCACATATTGG - Intronic
1089353616 11:117835732-117835754 ACTCCAGCAGATTCACATATTGG + Intronic
1094605160 12:31943434-31943456 ATCCCAGGAAATTCATAGATGGG - Intergenic
1095811814 12:46380223-46380245 TTCCAAGGTCATTCACATGTTGG + Intergenic
1096353867 12:50923651-50923673 TTCCCAGAATATTCACATTTGGG - Exonic
1096603780 12:52749890-52749912 CTCCCAGGACATTCAAATAAAGG - Intergenic
1098110123 12:67112880-67112902 TGCCCAGGAGATTCAAATATGGG - Intergenic
1100323885 12:93522956-93522978 CTCCTAGGTCATTCACATAAAGG + Intergenic
1101490662 12:105206609-105206631 ATCCCAGCACCTTAACATCTGGG - Intronic
1109495585 13:63167547-63167569 AACCCAGGATATGCAAATATAGG + Intergenic
1110907465 13:80910419-80910441 ATCACATGACATTCAAAAATAGG + Intergenic
1111804792 13:93026606-93026628 ACTCCAGTGCATTCACATATTGG - Intergenic
1115280456 14:31655927-31655949 ATACCAGGACTTTCACAGCTAGG - Intronic
1121893938 14:97627439-97627461 ATCCAAGGTCATTCAAATAGTGG - Intergenic
1124657102 15:31517571-31517593 TTCTCAGGACATGCACATCTTGG - Intronic
1125436445 15:39650289-39650311 ATCCCAGGACAATCTTATTTGGG + Intronic
1126718625 15:51551726-51551748 ATCCCCAGCCATTCACATAGTGG - Intronic
1130444105 15:83982659-83982681 ATCCCAGGATATTCCCTCATAGG - Exonic
1131070804 15:89464536-89464558 ATCCCAGGAAATTCGCAGATGGG + Intergenic
1131654258 15:94438779-94438801 ATACCAGAAAATTTACATATAGG - Intronic
1134306699 16:13039464-13039486 ACCCCATGACATTGACACATTGG - Intronic
1134884618 16:17778790-17778812 ATCACATGAGATTCACAAATGGG - Intergenic
1135131296 16:19855792-19855814 CTTTCAAGACATTCACATATGGG + Intronic
1140871797 16:79113418-79113440 CTCTCAGGACATTCACATCCAGG + Intronic
1143437408 17:6939610-6939632 ATCCCAGGAAATTAGCAGATGGG - Intronic
1144154705 17:12488105-12488127 TTCCCAGGAGATTCTCATAAAGG - Intergenic
1146685309 17:34837466-34837488 ATGCCAGGGCTTTTACATATGGG + Intergenic
1155714990 18:28931027-28931049 ATCCCAAGACATTTACAAAATGG - Intergenic
1156686195 18:39649691-39649713 ATCTCAGGACTCTCACCTATTGG - Intergenic
1156992956 18:43432156-43432178 ATCACAGGGCATTGACATTTAGG - Intergenic
1159561409 18:69999152-69999174 ATCCCAGGAAATGCACACATGGG - Intergenic
1163142315 19:15358119-15358141 ATCCCAGGACTTTAGCATTTGGG - Intronic
1165713712 19:38030237-38030259 AAACCAGTACATTCACATAGTGG - Intronic
1167028061 19:46936459-46936481 ATCAAAGGACATTCTCATTTGGG + Intronic
927740937 2:25569089-25569111 ATCCCAGGGCATTCAGACACAGG + Intronic
930226812 2:48802438-48802460 ATCCCTGGACATAAACTTATTGG - Intergenic
930847293 2:55919426-55919448 ATCCCAGGCGATTCCCATACAGG + Intronic
933216229 2:79633525-79633547 ATCACAGCTCATTCAAATATTGG - Intronic
936107094 2:109633800-109633822 ATTCCAGGACTGTCACAGATGGG + Intergenic
939253980 2:139718949-139718971 ACCCCAGGAGATTCTAATATGGG - Intergenic
939496377 2:142932446-142932468 AACCCCAGACAATCACATATCGG - Intronic
941154115 2:161954404-161954426 ATCACAGGAAATGGACATATGGG - Intronic
943570079 2:189564016-189564038 AGCCCAGGACAGTCATATAAAGG + Exonic
943944346 2:194039983-194040005 TTCCCAGGAAATTCACCTAGAGG - Intergenic
944909348 2:204294080-204294102 CTCCCAGGAGATTCATATGTCGG - Intergenic
947303468 2:228716345-228716367 ATCTCATGTCTTTCACATATTGG + Intergenic
1169008834 20:2232723-2232745 ATCTTAGGACATTCAGATAGAGG - Intergenic
1172811428 20:37650927-37650949 ATCCCAGGGCAAACACAGATTGG + Intergenic
1178916271 21:36707255-36707277 ATCCCAGGACCTTCACATTTTGG + Intronic
1184890424 22:47375747-47375769 ATCCTAAGACACTCACAGATGGG + Intergenic
953429652 3:42828588-42828610 TTCCCAGAACATTCACAGACAGG - Intronic
958091662 3:88884610-88884632 ATCCTAGAATATTCACAAATAGG + Intergenic
958845447 3:99259936-99259958 ATCCCAGGAAATTCACAGATGGG - Intergenic
961089451 3:124097509-124097531 ATCCCAGGAAATTGAAATAATGG + Intronic
961877263 3:130032861-130032883 ATCACAGGACGTACACACATGGG - Intergenic
962808271 3:138941928-138941950 TACCCAGGACATTCAGAAATTGG + Intergenic
965401793 3:168221087-168221109 ACACCAGGACTTTCAAATATAGG - Intergenic
965616478 3:170598182-170598204 ATCCCAGGACAGTGTCATGTGGG + Intronic
970723884 4:19019947-19019969 ATGCCAGAACATTCATATATTGG - Intergenic
972256266 4:37358976-37358998 TTCCCAGGACACTCCCATAGTGG - Intronic
972527253 4:39926972-39926994 ATCCCAAGACATTCATCTAAAGG - Intronic
974596221 4:64016959-64016981 TTCCCAGCACATTCTCAAATTGG + Intergenic
976498844 4:85762658-85762680 ATCCCAGCTCATTCACTCATGGG - Intronic
982665825 4:158261594-158261616 AACCCAGGAAAATCACATAAAGG - Intergenic
984519762 4:180787684-180787706 ACTCCAGTGCATTCACATATTGG + Intergenic
987556813 5:19462932-19462954 ATGTCAGGATTTTCACATATGGG - Intergenic
987841677 5:23230742-23230764 ATACCAGGATGCTCACATATAGG + Intergenic
988212648 5:28225910-28225932 CAACCAGGACATTCATATATTGG + Intergenic
989223598 5:38998601-38998623 AACACAGGTGATTCACATATTGG + Intronic
992883719 5:81136587-81136609 ATACCAAGACAATCACATCTAGG - Intronic
998920007 5:147057499-147057521 ATCCCAGTGCATTCACTTAATGG + Intronic
1000096356 5:157974150-157974172 ATTCCATGAGATTCCCATATAGG + Intergenic
1003451595 6:6239521-6239543 ACCAAAGGACATTCATATATCGG - Intronic
1004184534 6:13410751-13410773 ATCCCAGGACAGACCAATATAGG + Intronic
1004644115 6:17543122-17543144 CTCCCAGGACATTCAAATCCAGG + Exonic
1004854219 6:19732999-19733021 ATCCTAGGACATACATAGATGGG - Intergenic
1010021741 6:71168183-71168205 ATGCCAGCACTTTCACATAAGGG + Intergenic
1013086148 6:106859567-106859589 CTCCCAGGAACTACACATATTGG + Intergenic
1014100183 6:117502819-117502841 ATCCAAGGACATGCACAACTGGG - Intronic
1018678281 6:166241912-166241934 AGCCCAGGACAGTCAGAAATGGG - Intergenic
1022881338 7:34591136-34591158 ATACCAGGACATTGTCATAAAGG - Intergenic
1026637245 7:72094945-72094967 AAGCCAAAACATTCACATATAGG + Intronic
1031644478 7:124207058-124207080 AGCACAGGACAATCACATTTAGG + Intergenic
1037291094 8:17350142-17350164 ATCCCAGGACACTTCCATGTGGG - Intronic
1037727955 8:21498888-21498910 ATTCCAGAACATGCACACATCGG - Intergenic
1038397417 8:27257396-27257418 TTCCCAGGGCATTCAGATAAGGG + Intronic
1042351176 8:67779200-67779222 AGCCGAGGACATGCACATTTAGG + Intergenic
1049040506 8:140109243-140109265 ATTCCAGGACATTCTGAGATGGG + Intronic
1049775070 8:144400338-144400360 CTCCCAGGACACACACCTATGGG + Exonic
1051864983 9:21669970-21669992 ATCCCAGGTCATGCAGATGTTGG + Intergenic
1054924814 9:70578812-70578834 ATCTCAGCACATTGACATTTTGG + Intronic
1057967179 9:99515573-99515595 ATCCCAGGACACTGACATTTTGG + Intergenic
1058068599 9:100577973-100577995 ATTGCAGAACAGTCACATATGGG + Intergenic
1058544907 9:106050916-106050938 ATCCCAGGAAATTCCAATAGGGG - Intergenic
1059906788 9:118995446-118995468 ATCCCATAACATTCATATAAGGG - Intergenic
1061649302 9:132033829-132033851 ATCCAAGGACATTCATAACTTGG + Intronic
1188535752 X:31194953-31194975 ATGCCTGGAGATTCACATTTAGG - Intronic
1188578780 X:31685307-31685329 ATCCCAGGACATTCACATATAGG + Intronic
1189932992 X:46034454-46034476 ATCCCTGGAAATTCACAGAAAGG + Intergenic
1193536735 X:82726475-82726497 ATCCTAACAAATTCACATATTGG + Intergenic
1195225326 X:102786402-102786424 ACTCCATGACATTCACATACAGG + Intergenic
1195521278 X:105832529-105832551 ATCACAGGTCCTCCACATATAGG + Intronic
1197397008 X:125939756-125939778 ATCACAAGACATTCACCTCTGGG - Intergenic
1197437988 X:126456107-126456129 ATACCAGCACAGCCACATATGGG + Intergenic
1197767076 X:130066323-130066345 ATACAGGGATATTCACATATAGG + Exonic