ID: 1188584275

View in Genome Browser
Species Human (GRCh38)
Location X:31753156-31753178
Sequence GGGGTGTGAGGGAGGTGGCG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1484
Summary {0: 1, 1: 0, 2: 6, 3: 118, 4: 1359}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188584264_1188584275 21 Left 1188584264 X:31753112-31753134 CCCAGGGATGTGAATGAATCAGT 0: 1
1: 0
2: 0
3: 12
4: 171
Right 1188584275 X:31753156-31753178 GGGGTGTGAGGGAGGTGGCGAGG 0: 1
1: 0
2: 6
3: 118
4: 1359
1188584265_1188584275 20 Left 1188584265 X:31753113-31753135 CCAGGGATGTGAATGAATCAGTA 0: 1
1: 0
2: 0
3: 7
4: 209
Right 1188584275 X:31753156-31753178 GGGGTGTGAGGGAGGTGGCGAGG 0: 1
1: 0
2: 6
3: 118
4: 1359

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188584275 Original CRISPR GGGGTGTGAGGGAGGTGGCG AGG Intronic
900154944 1:1200207-1200229 AGGGGGAGAGGGAGGTGGGGGGG - Intergenic
900169025 1:1257386-1257408 GGGGGGGGGGGGGGGTGGCGTGG - Intronic
900172186 1:1274439-1274461 GGGGTCAGAGAGAGGTGGAGAGG - Intergenic
900174014 1:1284101-1284123 GGGGGGTGAGGGGGGTGGGGGGG + Intronic
900386897 1:2414725-2414747 GGGGTCTCAGGGAGGTGGGGCGG + Intergenic
900387615 1:2417720-2417742 GCTGTGTGGGGAAGGTGGCGTGG - Intergenic
900412818 1:2520597-2520619 TGGGCGGGAGGGGGGTGGCGAGG - Intronic
900432401 1:2609122-2609144 GGGGTGTGAGTGAGGCCGCAGGG + Intronic
900478328 1:2886652-2886674 GGGGTGGGAGGGAGCTGCCTGGG + Intergenic
900532736 1:3162713-3162735 GGAGGGTGAAGGAGGGGGCGTGG - Intronic
900833311 1:4980423-4980445 GGGGTGGCAGGAAGGTGGGGAGG + Intergenic
900954109 1:5876238-5876260 AGGGAGGGAGGGAGGTGGGGTGG + Intronic
900973754 1:6005445-6005467 GAGGGGTGAGGGTGGAGGCGGGG + Intronic
901100415 1:6715266-6715288 TGGGAGGGAGGGAGGTGGGGGGG - Intergenic
901241550 1:7697082-7697104 GCTGTGTGAGGGAGTTGGCCAGG - Intronic
901324957 1:8360444-8360466 GGGGTGGGAGGCAGGGGGCGGGG + Exonic
901325750 1:8364255-8364277 GCTGTGTGAGGGAAGTGGTGGGG + Exonic
901417935 1:9129661-9129683 GTGGTGTGAGGGCGTGGGCGGGG - Intergenic
901426813 1:9186951-9186973 GGTGTGTGTGGGGGGGGGCGGGG + Intergenic
901473500 1:9473525-9473547 GGGGTGGGAGGTAGGAGGTGTGG - Intergenic
901666145 1:10827514-10827536 GGGGAAGGAGGGAGGTGGCAGGG - Intergenic
901745503 1:11370427-11370449 GGACTGGGAAGGAGGTGGCGTGG + Intergenic
901934806 1:12619763-12619785 GGGGCGTTAGGGGGGTGGGGGGG - Intergenic
902063105 1:13661772-13661794 TGGGGGTGAGGAAGGTGGGGAGG - Intergenic
902191182 1:14764368-14764390 GGGGTGTGGGGGAGGGGGTCGGG - Intronic
902249480 1:15144601-15144623 TGGGTGTGGGGGAGGCGGAGCGG + Intergenic
902253378 1:15171108-15171130 TGGGGGTGGGGGATGTGGCGGGG - Intronic
902289847 1:15428867-15428889 GGGGTCTTATGGAGGTGGCCCGG + Exonic
902333621 1:15742807-15742829 GGGGCGGGAGGGAGGCAGCGAGG - Intronic
902394278 1:16124171-16124193 GGGGTGGGTGGGAGGTGGGCAGG - Intergenic
902416485 1:16242720-16242742 GGGGAGTGAGGGAGGGTGGGGGG + Intergenic
902598432 1:17524900-17524922 TAGGTCTGAGGGAGGTGGCCTGG + Intergenic
902619174 1:17640418-17640440 TGAGTGGGAGGGAGGTGGTGCGG + Intronic
902730241 1:18364391-18364413 GGGGGGTGAAGGAGGTGGGAGGG - Intronic
902740619 1:18435692-18435714 GGGCTATGAGGGAGGTGGATGGG - Intergenic
902799102 1:18818423-18818445 GGGAGCTGAGGGAGGTGGGGGGG + Intergenic
902801327 1:18831966-18831988 GGGGTCTGAGGGAGGAGGCATGG - Intergenic
902873451 1:19327424-19327446 GGCGTGTGGGGCAGGTGGCGGGG + Intronic
902960584 1:19960521-19960543 GGGGTGGGGGGGGGGTGGAGGGG - Intergenic
903066791 1:20704154-20704176 GGGGTGTGGTGGGGGTGGGGGGG + Intronic
903357430 1:22756567-22756589 GAGGTGTGGGGGAAGTGGCGGGG + Intronic
903435362 1:23344764-23344786 GGGGTGCGAGGGAGGACTCGGGG - Intergenic
903551330 1:24159015-24159037 GGGGTGTGCAGCAGGTGGGGAGG - Intronic
903558686 1:24211957-24211979 AGGTGGTGAGGGAGGTGGTGAGG + Intergenic
903558715 1:24212059-24212081 AGGTGGTGAGGGAGGTGGTGAGG + Intergenic
903758909 1:25684190-25684212 GGGGAGAGAGGCAGGTGGCTGGG - Intronic
903795024 1:25922429-25922451 GGTGTGAGAGGGAGTTGGCGGGG + Intergenic
903907214 1:26695957-26695979 GGGGAGGGAGGGAGGGAGCGGGG - Intergenic
904043449 1:27597144-27597166 GGGGTGGGGGGCAGGTGGCAGGG + Intronic
904086965 1:27916175-27916197 GGGGCAGGAGGGAGGTGGAGAGG - Intergenic
904115733 1:28160555-28160577 TGTGTGTGTGGGGGGTGGCGGGG - Intronic
904326108 1:29727879-29727901 GGGCTGTGGGGGAGGGGGTGAGG + Intergenic
904613410 1:31737380-31737402 GGGGTGTGAGTGGGGTGGAGGGG - Intronic
904732580 1:32606143-32606165 GGTGTGTGAGTGAGCTAGCGTGG + Intronic
904840932 1:33371404-33371426 TGGGTGTGATGGTGGTGGCCGGG - Intronic
904840943 1:33371442-33371464 TGGGTGTGATGGTGGTGGCCAGG - Intronic
904840953 1:33371480-33371502 CGGGTGTGATGGCGGTGGCCAGG - Intronic
905498694 1:38418626-38418648 GGGCTGGGAGGGAAGTGGAGCGG + Intergenic
905596968 1:39215813-39215835 GGGGTGGGAGGGAGGAGTCATGG + Intronic
905652386 1:39665208-39665230 GGGGTGTGCTGGAGCTGGCTTGG + Intronic
905892732 1:41527436-41527458 GGGGTGTGAGGGTGAGGGTGGGG - Intronic
905892803 1:41527843-41527865 GGGGTGTGAGGGTGAGGGTGGGG - Intronic
906097862 1:43236256-43236278 GGGGTGTGTGGCAGGGGGTGCGG + Intronic
906117868 1:43367736-43367758 GGGGAGGGAGGGTGCTGGCGAGG + Exonic
906140532 1:43531355-43531377 GGAGAGGGAGGGAGGCGGCGAGG - Intronic
906187247 1:43871408-43871430 GGAGTGTGAGGGAGAGGACGGGG + Intronic
906187260 1:43871465-43871487 GGGGTGTGAGGGAGAGGCTGGGG + Intronic
906187266 1:43871484-43871506 GGGGTGTGAGGGAGAGGATGGGG + Intronic
906187272 1:43871503-43871525 GGGGTGTGAGGGAGAGGATGGGG + Intronic
906187278 1:43871522-43871544 GGGGTGTGAGGGAGAGGATGGGG + Intronic
906187296 1:43871577-43871599 GGGGTGTGAGGGAGAGGATGGGG + Intronic
906187320 1:43871672-43871694 GGGGTGTGAGGGAGAGGATGGGG + Intronic
906187326 1:43871691-43871713 GGGGTGTGAGGGAGAGGCTGGGG + Intronic
906187358 1:43871802-43871824 GGGGTGTGAGGGAGAGGCTGGGG + Intronic
906238270 1:44225185-44225207 AGGGTGGGAGTGAGGTGGCAGGG + Intronic
906380012 1:45326800-45326822 AGGGTGTGGGGGAGGGGGTGGGG + Intergenic
906495803 1:46303111-46303133 GGGGTGTGGGGTAAGTCGCGGGG - Exonic
906524996 1:46488818-46488840 GGGGTGTGGGGTAGGTGGGGAGG - Intergenic
906702466 1:47869886-47869908 GGGGTATGAGGGTGGTGGAGGGG + Intronic
907372621 1:54013046-54013068 TGTGTGTGGGGGAGGCGGCGGGG + Intronic
907473568 1:54690306-54690328 AGGGTGGGAGGGAGGGGGTGTGG + Intronic
907516384 1:54995934-54995956 TGGGTGTGATGGAGGAGGTGAGG + Intergenic
907534423 1:55136764-55136786 GGGGTGGGAGTGAGGTAGTGGGG + Intronic
907866589 1:58405075-58405097 GTGGAGAGAGGGAGGTGGCGGGG - Intronic
908378188 1:63567525-63567547 GGGGAGTGAGGGAGATTGGGGGG + Intronic
908511011 1:64850127-64850149 GGGGTATCAGGGAGATGGTGCGG - Intronic
908573096 1:65429892-65429914 GGGGGATGGGGGAGATGGCGTGG - Exonic
908715507 1:67065579-67065601 GGGTGGTAAGGGAGGTGGCAGGG + Intergenic
909170009 1:72282868-72282890 GGCGAGTGAGGGAGGAGGCGCGG + Intergenic
909431064 1:75588264-75588286 GGGGAGGAAGGGAGGTGGGGAGG + Intronic
909945928 1:81663042-81663064 GGGGTGGGAGGGAGGGGTCGGGG - Intronic
911348215 1:96721997-96722019 GGGGTGTGTGCGATGGGGCGGGG - Intronic
911413443 1:97540332-97540354 GGGGGGTGGGGGTGGCGGCGGGG + Intronic
912185512 1:107270704-107270726 GGGGTGGGGGGGCGGGGGCGGGG - Intronic
912415059 1:109502467-109502489 GTGGTTTGGGGGAGGTGGTGAGG + Intronic
912459492 1:109821499-109821521 GGGGTGTGAGGGAGCAGGAGGGG + Intergenic
912542875 1:110430326-110430348 GTGGTGTTAGGCAGGTGGGGAGG - Intergenic
912712331 1:111958845-111958867 GGGTTCTGAGGGTGGTGGTGGGG + Intronic
912963440 1:114216309-114216331 GGGGAGTGACGGAGGTAGGGAGG - Intergenic
913017834 1:114757482-114757504 GGGGCGAGGGGGTGGTGGCGCGG - Intronic
913264725 1:117033280-117033302 GGAGTGGGAGGGAGGGGGCCGGG + Intronic
914255328 1:145957772-145957794 GGGCGGTGCGGGAGGCGGCGGGG + Exonic
914687207 1:149991213-149991235 GGGGTTGGTGGGAGGTGGGGAGG - Intronic
914704644 1:150160749-150160771 TGGCTGGGAGGGTGGTGGCGTGG - Intronic
915323797 1:155070334-155070356 GGGGTGTGGGGGAGACGGCGGGG + Intergenic
915557496 1:156668676-156668698 GGGGCGGGCGGGGGGTGGCGGGG - Intergenic
915631126 1:157154857-157154879 GGGAGGTGAGGGAGGGGGCTGGG - Intergenic
915722450 1:157994505-157994527 GGGAGGTGAGGGAGGTGGTTGGG + Intronic
916240226 1:162632105-162632127 GAGGTGTGGGGTAGGCGGCGGGG + Intronic
916429392 1:164712612-164712634 GGGGTCAGAGTGAGGTGGAGGGG + Intronic
916706620 1:167357352-167357374 GGGGGGTGGGGGGGGAGGCGTGG - Intronic
916706623 1:167357361-167357383 GGGGTGGGGGGGGGGTGGGGGGG - Intronic
916802971 1:168231718-168231740 GGGGAATAAGGGAGGTGGGGAGG + Intronic
917306799 1:173634829-173634851 GAGGGGTGAGGAAGGTGGCATGG - Intronic
917679684 1:177353205-177353227 GGGGTGTGAGGGCGCTGATGTGG + Intergenic
917711250 1:177687606-177687628 GGGAAGTGAGGGAGGTAGGGAGG + Intergenic
917860024 1:179135813-179135835 CGGGAGGGAGGGAGGTGGGGGGG + Intronic
917958621 1:180125346-180125368 GTGGTGGGAGGCAGGTGGCTGGG + Intergenic
918914961 1:190623079-190623101 GGGGGGTGAGGGAGGTGGGAGGG + Intergenic
919005423 1:191892850-191892872 GGGGTGTGAGGAAGTAGGTGGGG + Intergenic
919411158 1:197245203-197245225 GTGGGGTGAGGGAAGTGGGGAGG - Intergenic
919928860 1:202208454-202208476 GTGATGTGAGGGAGGTGCCAGGG + Intronic
920052434 1:203171998-203172020 TAGGTCTGACGGAGGTGGCGGGG + Exonic
920333665 1:205229547-205229569 GGGGGGGGGGGGTGGTGGCGGGG + Intronic
920336320 1:205247748-205247770 GGGGTGTGGGGGAGTGGGGGAGG - Intronic
920744820 1:208616766-208616788 GGCGTGGTGGGGAGGTGGCGTGG + Intergenic
921133886 1:212243084-212243106 GGGGTCTGGGGGAGGTGTGGGGG - Intergenic
921269128 1:213451550-213451572 TGGGTGTGGGGGAGGTCGCGTGG + Intergenic
921326378 1:213989143-213989165 GAGGAGAGAGGGAGGTGGGGGGG + Intronic
921446585 1:215254361-215254383 GGGGTGAGAGGGAGGTAGGTCGG + Intergenic
921712529 1:218387236-218387258 GGGGTGGGAGGGGAGTGGAGGGG + Intronic
922141636 1:222893912-222893934 GGAGTGTGAGCAAGGTGGAGAGG + Intronic
922155881 1:223039386-223039408 GGGAGGTGAGGGAGGTGCCAAGG - Intergenic
922455443 1:225770431-225770453 GGGGTGTGATGGGGCTGGGGAGG - Intergenic
922573222 1:226645816-226645838 ATGGTGGGAGGGAGGTGGCCAGG + Intronic
922731306 1:227949933-227949955 GGGGTGTGTGGGGGGTGGGGAGG - Intergenic
922851325 1:228735859-228735881 GGGGCGTGCGGGGGGTGCCGAGG + Exonic
923036548 1:230288551-230288573 GGGGTCTTAGGGAGGTGGGCAGG + Intergenic
923400872 1:233614556-233614578 GGGTTGTGGGCGAGGTGGCCGGG - Intronic
924042597 1:239998030-239998052 GGGCTGTGAGGGCGGCGACGAGG - Intergenic
924362216 1:243254520-243254542 GGGGTGTGAGGCGGTTGGCGAGG - Intronic
924724323 1:246654217-246654239 GGTGTATCTGGGAGGTGGCGAGG - Intronic
924862802 1:247943278-247943300 GGAGAGTGAGGGAGGAGGCAAGG + Intronic
924871496 1:248051587-248051609 GGAGAGTGAGGGAGGAGGCAAGG + Intronic
1062790518 10:301396-301418 GGGGTCTGGGGAAGGTGGAGGGG + Intronic
1063089337 10:2848440-2848462 GGGCTGTAAGGGGGGTGGAGGGG - Intergenic
1063115089 10:3067418-3067440 GGGCTGCGGGGGAGGGGGCGCGG - Intronic
1063275741 10:4565739-4565761 GGGGCGGGTGGGAGGAGGCGGGG + Intergenic
1063386655 10:5620246-5620268 AGGCTGTGGGGGAGGTGGCTGGG + Intergenic
1063428249 10:5966108-5966130 GGGGAGGGAGGAAGGTGGGGTGG + Intronic
1063562587 10:7143108-7143130 GGGGTGTGTGGGAGGCTGCTAGG - Intergenic
1063872403 10:10432429-10432451 GGGGTGTGGGGGAAGTCACGTGG + Intergenic
1064627151 10:17273171-17273193 GGGTGGTGAGGGTGGTGGGGAGG - Intergenic
1065917011 10:30360825-30360847 GGGGTGTTAGGGACATGGTGGGG + Intronic
1066155417 10:32671751-32671773 GGGGTGTGAGGGCGCTTGCTGGG + Intronic
1066195659 10:33097113-33097135 GAGCTGTGGGGGAGGTGGTGAGG + Intergenic
1067013044 10:42732371-42732393 GGGGTGTGTGTGTGGTGGGGTGG - Intergenic
1067024980 10:42836925-42836947 CGGGTCCGAGGGAGGTGGGGGGG - Intergenic
1067048234 10:42997842-42997864 GGGGTGTGAAGGACGTGCCCAGG + Intergenic
1067049076 10:43001624-43001646 GGAGCCTGTGGGAGGTGGCGTGG - Intergenic
1067052428 10:43029659-43029681 GGAGTGTGAGGGAGAGGGAGGGG - Intergenic
1067216612 10:44309435-44309457 AGGGAGGGAAGGAGGTGGCGGGG + Intergenic
1067716287 10:48693261-48693283 GGGGTGGATGGGAGGTGGAGGGG + Intronic
1068466642 10:57401370-57401392 GGGGTTTGAGGAAGATGGGGTGG + Intergenic
1069048203 10:63765026-63765048 GGGTTGGGGGGGAGGTGGCAAGG - Intergenic
1070111414 10:73490729-73490751 GGGGTGAGAGGGAGAGGGAGAGG - Intronic
1070444191 10:76478898-76478920 GGGGTGTGGGGGAGGGGGGAGGG + Intronic
1070544641 10:77442776-77442798 TGGGTGTGAAGGAGGAGGAGGGG - Intronic
1070567176 10:77612791-77612813 GGTGTGTCAGGGAGGTGAGGAGG - Intronic
1070655122 10:78266231-78266253 GTGATGTGAGGGAGGTGGGAAGG + Intergenic
1070712938 10:78696685-78696707 GGGGTGGGAAGGGGGTGGGGTGG + Intergenic
1070814687 10:79315278-79315300 AGGGTGTGAGGGAGGTGCAGAGG + Exonic
1071499585 10:86193828-86193850 AGGGAGGGAGGGAGGTGGTGAGG - Intronic
1071710083 10:88041472-88041494 GTGGTGAGAGGGAGGAGGGGTGG + Intergenic
1072313057 10:94175696-94175718 GGGGAGTGAGGGAGGAAGTGGGG - Intronic
1073107544 10:101040959-101040981 GGGGTGGGAGGGTGGAGGTGGGG - Exonic
1073192151 10:101659204-101659226 GGGGAGTGAGGGAGGTGCTGGGG - Intronic
1073329626 10:102661642-102661664 GGGGTGGGAGGCAGGAGACGAGG + Intergenic
1073539227 10:104304842-104304864 GGGGTGAGAGGGAGGAGGACGGG - Intronic
1074154068 10:110783050-110783072 GAGGTGGGAGGTAGGTGGTGGGG + Intronic
1074388853 10:113039694-113039716 GGGGAGTGGGAGAGGTGGGGAGG - Intronic
1074502990 10:114043521-114043543 GGGGGCTGAGGGAGGGGACGGGG + Intergenic
1074526221 10:114265598-114265620 GGGGTGTGGGAGAGGGAGCGTGG - Intronic
1074807251 10:117065867-117065889 AGGGAGGGAGGGAGGTGGGGAGG + Intronic
1075125431 10:119695238-119695260 GGAGGGTGAGTGAGGTGGAGAGG + Intergenic
1075136977 10:119794799-119794821 TGGGAGGGAGGGAGGTGGGGGGG - Intronic
1075137106 10:119795080-119795102 CGGGAGGGAGGGAGGTGGGGGGG - Intronic
1075242030 10:120787905-120787927 GGGGTGTGGGGGGGATGGGGAGG - Intergenic
1075741488 10:124698942-124698964 GTGGTGTGAGTGAGGAGGGGAGG - Intronic
1075885717 10:125897114-125897136 GGGGTGTGGGGCGGGGGGCGGGG - Intronic
1076329606 10:129654694-129654716 GAGGTATGAGGAAGGTGGCCGGG + Intronic
1076722551 10:132399045-132399067 GGGAGATGAGGGAGGGGGCGGGG - Intronic
1076762191 10:132611362-132611384 GGAGGGTGAGGGAGGTGAGGTGG + Intronic
1076762247 10:132611541-132611563 GGAGGGTGAGGGAGGTGAGGTGG + Intronic
1076762280 10:132611631-132611653 GGAGGGTGAGGGAGGTGAGGTGG + Intronic
1076762297 10:132611676-132611698 GGAGGGTGAGGGAGGTGAGGTGG + Intronic
1076771882 10:132670361-132670383 GGGGTGTGAGGTCGGGGGGGTGG - Intronic
1076888252 10:133272314-133272336 GGGGTGGGAGGGAAGTGGGGAGG - Intronic
1076895681 10:133310129-133310151 GGGGTCAGAGGGAGGTGACACGG + Intronic
1077052936 11:575912-575934 GGGCTGCGAGGGTGGGGGCGGGG + Intergenic
1077052952 11:575959-575981 GGGCTGCGAGGGAGGGGGCGGGG + Intergenic
1077079703 11:719802-719824 GGCGGGTGAGGATGGTGGCGCGG + Intronic
1077105197 11:839167-839189 GAGGTGTCAGGCAGGTGGGGTGG + Intronic
1077108609 11:852519-852541 GGGGTCTAAGGGTGGGGGCGGGG + Intronic
1077159939 11:1108058-1108080 TGGGTGAGAGGGAGGAGGGGAGG + Intergenic
1077204710 11:1336783-1336805 GGGGCGTGGGGGCGGGGGCGGGG + Intergenic
1077375972 11:2205316-2205338 TGGGAGGGAGGGAGGTGGGGAGG - Intergenic
1077375985 11:2205347-2205369 TGGGAGGGAGGGAGGTGGGGAGG - Intergenic
1077405965 11:2382671-2382693 GGGCTGTGAGGGACCTGGCCTGG - Intronic
1078170341 11:8924769-8924791 GCTGTGTGAAGGAGGTGGCCTGG - Intronic
1078335390 11:10459184-10459206 GGAGTGGGAGGGAGCTGGTGGGG - Intronic
1078417622 11:11178727-11178749 GGGGTGGGGGGGGGGGGGCGGGG + Intergenic
1078737132 11:14030465-14030487 GGATTGTGGGGGAGGTGACGTGG - Intronic
1079035197 11:17014426-17014448 GGGGTGGGGGGGAGGGGGCGGGG + Intronic
1079110270 11:17601483-17601505 GGGGAGTGGGGGAGGTGGGCAGG + Intronic
1079248958 11:18773322-18773344 GGGGTGTGAGGAAGGGGAGGGGG + Intronic
1079346102 11:19653879-19653901 GGGGAGTGTGGGAGGTGGAGTGG - Intronic
1080409296 11:32008769-32008791 GGGGAGTGTGGGAAGTGGTGAGG + Intronic
1080861485 11:36153986-36154008 GGGGTGTGGGGGAGTTGGAGAGG + Intronic
1081905398 11:46666186-46666208 GGGATGTCAGGAAGCTGGCGTGG + Intronic
1082848634 11:57745776-57745798 GGGGTGTGAGGGTGGTGGCTGGG + Exonic
1082966253 11:58968700-58968722 GGGATGTCAGGGAGGTGACTGGG + Intronic
1083198816 11:61107135-61107157 GGGGTGTGAGGTACCTGGGGAGG + Intronic
1083234960 11:61345387-61345409 GGGCTGACAGGGAGGTGGCTGGG + Intronic
1083544404 11:63538043-63538065 GGGGTTTGAGGGAGGGGAAGAGG + Intronic
1083593057 11:63906484-63906506 GGGGTGAGAGGGAGTGGGGGTGG - Intronic
1083595622 11:63917251-63917273 GGGGTGGGAGGGAGGGCCCGGGG + Intergenic
1083603842 11:63965173-63965195 GAGGTGTGAGTCAGGTGGTGGGG - Intergenic
1083898285 11:65631216-65631238 GGGGTGGGAGGGGGTTGGTGAGG + Intronic
1083970265 11:66070248-66070270 GGCGTGTCCGGGAGGGGGCGGGG - Intergenic
1084009223 11:66338469-66338491 GGGGTGGGAGGGTGGCGGGGAGG - Intronic
1084263340 11:67992359-67992381 GGGAAGGGAGGGAGGGGGCGCGG - Intronic
1084507121 11:69575142-69575164 GGGGTGTGAGGCAGTGGGTGCGG + Intergenic
1084661964 11:70551312-70551334 GCGGTGGGAGGGAGGGGGAGGGG - Intronic
1084685916 11:70695146-70695168 AGAGTCTGAGGGAGGTGGAGCGG + Intronic
1084686183 11:70697100-70697122 GGAGTCTGAGGGAGGTAGAGTGG + Intronic
1084810067 11:71606768-71606790 GGGAAGGGAGGGAGGGGGCGCGG + Intergenic
1084933212 11:72573445-72573467 GGGGTGAGGGGGACGCGGCGGGG - Intergenic
1084952331 11:72673695-72673717 TGTGTGTGAAGGAGGTGGGGAGG - Intronic
1085470143 11:76752546-76752568 GGTGTGTGGAGGAGGTGGGGTGG + Intergenic
1085508981 11:77075817-77075839 GGGGTGTGAGAGAGCTTGTGGGG - Intronic
1085514659 11:77105280-77105302 GGGGAGTGTGGGAAGTGGCCAGG - Intronic
1085561250 11:77474184-77474206 GGGGAGTGGGGGAGGGGGAGGGG - Intronic
1085642393 11:78200644-78200666 GGGATGTGAGGGAGGAGCTGTGG - Exonic
1085681020 11:78574908-78574930 GAGGCGTGCGGGAGGGGGCGGGG + Intergenic
1085780499 11:79403806-79403828 GGGGGTTGAGGGGGGTGGTGGGG + Intronic
1086242393 11:84711403-84711425 GGGGGGTGGGGGAGGGGGTGGGG - Intronic
1087117099 11:94537248-94537270 GGGGAGGGAGGGAGGGGGAGAGG - Intergenic
1087176328 11:95099427-95099449 GGGGTGGGAAGGAGGTGCCCAGG + Intronic
1087230174 11:95652371-95652393 GGGGTGTGCGGGTGGTGGTCAGG - Intergenic
1087542769 11:99542310-99542332 AGGGTGTAAGGGAGGAGGCATGG - Intronic
1088315181 11:108499273-108499295 GGGCTGTGAGGGAGGGCGGGGGG - Intergenic
1088371466 11:109092981-109093003 TGAGTATGAGGGAGGTGGCGGGG + Intergenic
1088601870 11:111486973-111486995 GGCCTGTCAGGGAGGAGGCGGGG - Intronic
1088630623 11:111770832-111770854 GGTGTGTGTGGGAAGTGGAGAGG - Intergenic
1088723186 11:112612412-112612434 GGGGTGGGAGGGGGGAGGGGAGG + Intergenic
1089193401 11:116672701-116672723 GTGGGGTGAGGGAAGTGGGGAGG + Intergenic
1089470307 11:118715266-118715288 GGGGTGGGAGGGTGAGGGCGTGG + Intergenic
1089528955 11:119114174-119114196 TGGGTCTGAGGGAGGTGAAGAGG - Exonic
1089706834 11:120284239-120284261 GGGGTGATAGGCAGGTGGAGAGG - Intronic
1090074477 11:123571349-123571371 GGGGGGTGAGGGTGGGGGCAGGG + Intronic
1090076113 11:123581027-123581049 GGGGTGTGGAGGAGGTAGGGGGG - Intronic
1090251239 11:125253420-125253442 TGGGTGTGAGTGAGGAGGAGAGG + Intronic
1090372803 11:126268592-126268614 GGGGAGGGTGGGAGGAGGCGCGG + Intronic
1090488004 11:127132164-127132186 GGGGAGTGAGGGAGGGAGGGAGG - Intergenic
1090551685 11:127826783-127826805 GGAGTGGGAGGGAGGTGGAATGG - Intergenic
1091093516 11:132794567-132794589 GGGGTTAGAGGGAGATGGGGAGG - Intronic
1091138588 11:133215996-133216018 GGGGTGGGAGGCAGGTGGGCAGG + Intronic
1091240769 11:134050729-134050751 GGGGTGGGCAGGAGGCGGCGCGG + Intergenic
1091277544 11:134362689-134362711 GGCGTGTGTGGCAGGTGGAGGGG - Intronic
1091436107 12:474332-474354 GTGTTGTGAGGGAGGGGACGGGG - Intronic
1091590550 12:1840445-1840467 GGGGTGGGTGGGGGGCGGCGGGG + Intronic
1091704020 12:2681611-2681633 GGGAGGGGAGGGAGGTGGAGTGG - Intronic
1091710693 12:2738087-2738109 GGGAGGGGAGGGAGGTGGAGTGG - Intergenic
1091713547 12:2760152-2760174 GGGAGGGGAGGGAGGTGGAGTGG - Intergenic
1091835949 12:3585881-3585903 GGGTAGTGAGGGAGCTGGGGAGG + Intronic
1091908082 12:4205551-4205573 GAGGGGTGAGGGAGCTGGGGCGG + Intergenic
1091949406 12:4580536-4580558 TGGGAGGGAGGGAGGTGGCTGGG - Intronic
1092015053 12:5151688-5151710 GGGGTGGGATGACGGTGGCGGGG - Intergenic
1092124432 12:6065588-6065610 GAGCTGTGAGGGAGGAGGGGAGG - Intronic
1092124561 12:6066126-6066148 GGGGCGTGGGGGAGATGGTGTGG - Intronic
1092144298 12:6203908-6203930 AGGGGCTGAGGGAGGTGGGGAGG - Intronic
1092203817 12:6603543-6603565 TGGGTTTGAGAGAGGTGGGGTGG + Intronic
1092263374 12:6963831-6963853 GGGGTGCGTGGGAAGTGGGGAGG - Intergenic
1092286297 12:7130773-7130795 GGGGTGGGAAGGAGGTGTCGAGG + Intronic
1093038333 12:14354034-14354056 GGGGAGGGAGGGAGGGGGAGAGG - Intergenic
1093642304 12:21541843-21541865 GGGGAGTGGGGGAAGGGGCGTGG - Intronic
1094042577 12:26133294-26133316 GGGGAGTGAGGGAGATGAAGGGG - Intronic
1094121840 12:26983226-26983248 GGAGTGGGGGGGAGGTGGTGGGG + Intronic
1094218896 12:27972901-27972923 GGGGGGGGAGGGAGGTGGTAGGG - Intergenic
1094682537 12:32679182-32679204 GCGCTGCGAGGGAGGTGGAGAGG - Intronic
1094724704 12:33102423-33102445 GGGGGGTGGGGGAGTTGGGGAGG - Intergenic
1094839023 12:34335283-34335305 GGGGTGGCATGGGGGTGGCGAGG - Intergenic
1095440951 12:42238272-42238294 GAGGAGGGAGGGAGGGGGCGGGG + Intronic
1095968101 12:47882943-47882965 GGGGTGTGGGGGTGGCGGCTGGG + Intronic
1096124598 12:49110225-49110247 GGGGTGGGAGGGAGGGGCAGGGG + Intronic
1096205929 12:49721824-49721846 GGGGTGGGAGGGAAGGGGCAAGG - Intronic
1096214062 12:49789673-49789695 GGGGGATGGGGGAGGTGGCCTGG + Intergenic
1096273659 12:50187243-50187265 GGTGTGTGTGGGAGGTAGGGGGG + Intronic
1096499516 12:52056324-52056346 GGATTGTGAGGGTGGTGGCAGGG + Intronic
1096524362 12:52201718-52201740 GTGGTGTGAGGGAGATGGAAGGG + Intergenic
1096626105 12:52897135-52897157 GGGGTGGGAGGGAGGTGGTCAGG - Intergenic
1096632896 12:52940564-52940586 GGGGTGTCGGGGAGGAGGTGTGG + Intronic
1096773679 12:53951556-53951578 AAGGTGTGAGAGAGGCGGCGGGG + Intergenic
1096829081 12:54300716-54300738 GGGGGGTGAAGGAGGTGAGGGGG - Intronic
1097108016 12:56636420-56636442 GTGGAGAGAGGGAGGAGGCGAGG + Intronic
1097166418 12:57088853-57088875 GGGGTGTGGAGCAGGAGGCGGGG - Intergenic
1097938491 12:65278894-65278916 GGGGTGGGAGGGGTGAGGCGAGG - Intronic
1098034428 12:66287748-66287770 GAGGTCTGAGGGATGTGGCAAGG + Intergenic
1098784782 12:74738473-74738495 GGAGTGTGAGGGGGCTGGTGAGG - Intergenic
1099141394 12:78980916-78980938 GGGGGGAGAGGGAGATGGAGGGG + Intronic
1099255395 12:80307872-80307894 CGGGAGGGAGGGAGGTGGGGGGG - Intronic
1100457580 12:94767407-94767429 GGGGTGGGACAGGGGTGGCGGGG + Intergenic
1100470460 12:94888373-94888395 GGGGGGTGGGGGGGTTGGCGGGG - Intergenic
1100474356 12:94922037-94922059 CAGGGGTGAGGTAGGTGGCGGGG - Intronic
1100611735 12:96195877-96195899 AGGGTGGGAGGGGGCTGGCGGGG - Intronic
1101141430 12:101799865-101799887 GGGGTGGGAGGGAAGAGGAGGGG + Intronic
1101661164 12:106766678-106766700 GGGGTGAGAGGGCGGCGGCGGGG - Intronic
1101860003 12:108475175-108475197 GGGGTGGGGGGGGGGTGGTGGGG + Intergenic
1102020327 12:109677808-109677830 GGGGGGTGAAGGGGGTGGTGAGG + Intergenic
1102201336 12:111059796-111059818 GGGCAGTGAGGGAGGTGTTGGGG + Intronic
1102444294 12:112989877-112989899 GGGCTGTGAGTGAGGAGGTGGGG - Intronic
1102473851 12:113175978-113176000 GGGATGTGGGGGAAGTGGGGAGG - Intronic
1102473862 12:113176001-113176023 GGGTTGTGGGGGAAGTGGGGAGG - Intronic
1102851192 12:116246792-116246814 GGGAGGGGAGGGAGGTGGGGAGG + Intronic
1103251069 12:119500511-119500533 GGGCGGTGAGGGAGGAAGCGAGG - Intronic
1103320783 12:120091786-120091808 TGGGTGGGAGGGAGGAGGAGTGG + Intronic
1103425473 12:120830323-120830345 GGGGTGGGGGGGAGGTGGAAAGG + Intronic
1103730901 12:123027157-123027179 GGGCTGGGTGGGAGGTGGTGAGG - Intronic
1103789068 12:123456498-123456520 TGGGTGTTAGGAAGATGGCGAGG - Intergenic
1103856427 12:123973432-123973454 GGGGTGGGAAGGAGGTGGAGTGG + Exonic
1103937835 12:124485949-124485971 GGAGTGGGAGGGAGGTGGGGTGG - Intronic
1103938868 12:124491068-124491090 AGGGTGTAAGGGAGTGGGCGTGG - Intronic
1103953422 12:124564513-124564535 GGGGTGGGGGTGGGGTGGCGGGG - Intronic
1104001476 12:124863401-124863423 GGGCGGTGAGGGTGGTGGGGAGG + Intronic
1104038345 12:125114035-125114057 GGGGTGAGGGGGATGTGGTGGGG - Intronic
1104058298 12:125246907-125246929 GGTTTGTGGGGGAGGTGGTGGGG + Intronic
1104559938 12:129834433-129834455 GGTATGGGAGGGAGGGGGCGGGG - Intronic
1104595048 12:130115248-130115270 GGGGCTTGCGGGAGGCGGCGTGG - Intergenic
1104626273 12:130358206-130358228 TGGGTGTGTGGGAGGTGCAGAGG + Intronic
1104657196 12:130582111-130582133 GAGGAGGGAGGGAGGTGGAGGGG - Intronic
1104665676 12:130646042-130646064 AGGTGGTGAGGGAGGTGGAGAGG - Intronic
1104665694 12:130646102-130646124 AGGTGGTGAGGGAGGTGGAGAGG - Intronic
1104665701 12:130646126-130646148 AGGTGGTGAGGGAGGTGGAGAGG - Intronic
1104665708 12:130646150-130646172 AGGTGGTGAGGGAGGTGGAGAGG - Intronic
1104665726 12:130646210-130646232 AGGTGGTGAGGGAGGTGGAGAGG - Intronic
1104665743 12:130646270-130646292 AGGTGGTGAGGGAGGTGGTGAGG - Intronic
1104665760 12:130646330-130646352 AGGTGGTGAGGGAGGTGGTGAGG - Intronic
1104665764 12:130646342-130646364 AGGTGGTGAGGGAGGTGGTGAGG - Intronic
1104665768 12:130646354-130646376 AGGTGGTGAGGGAGGTGGTGAGG - Intronic
1104665772 12:130646366-130646388 AGGTGGTGAGGGAGGTGGTGAGG - Intronic
1104665776 12:130646378-130646400 AGGTGGTGAGGGAGGTGGTGAGG - Intronic
1104665798 12:130646450-130646472 AGGTAGCGAGGGAGGTGGCGAGG - Intronic
1104678071 12:130729281-130729303 TGGGTGTGACGGGGGTGGGGAGG + Intergenic
1104750504 12:131235319-131235341 GGGCTGTCAGGCAGGTGGCCAGG - Intergenic
1104782196 12:131429067-131429089 GGGCTGTCAGGCAGGTGGCCAGG + Intergenic
1104782216 12:131429143-131429165 GGGCTGTCAGGCAGGTGGCCAGG + Intergenic
1104878872 12:132055522-132055544 GGGGTGTGTGTGAGGTGTAGGGG + Intronic
1104878880 12:132055563-132055585 GGGGTGTGTGTGAGGTGTAGGGG + Intronic
1104878888 12:132055599-132055621 GGGGTGTGTGTGAGGTGTAGGGG + Intronic
1104878896 12:132055640-132055662 GGGGTGTGTGTGAGGTGTAGGGG + Intronic
1104895833 12:132163198-132163220 GGACAGTGAGGGAGGTGACGCGG - Intergenic
1104913025 12:132249043-132249065 TGGGTGTCTGGAAGGTGGCGGGG + Intronic
1105411861 13:20177537-20177559 CGCGAGTGAGGGAGGCGGCGCGG - Intergenic
1105474840 13:20720855-20720877 GGGTTGGGAGGGAGGTGGTCTGG - Intronic
1105532059 13:21229289-21229311 GGGGTGGGAGGGTTGTGGGGGGG - Intergenic
1105555759 13:21447202-21447224 GGGCTGTGAGAGAGGGAGCGTGG + Intronic
1105673122 13:22642415-22642437 AGGGTGTGGGGGAGGTGGGCAGG + Intergenic
1105779882 13:23696472-23696494 GGGGTGTGAGGGAGCTCCCGTGG - Intergenic
1106177409 13:27343002-27343024 GAGGAGGGAGGGAGGGGGCGAGG - Intergenic
1106308668 13:28534605-28534627 GGGTTGTGGGGGAAGTGGTGGGG - Intergenic
1106462462 13:29983943-29983965 AGGGAGGGAGGGAGGTGGCAAGG - Intergenic
1107106990 13:36654662-36654684 GGGGTGTGGGGGACTTGGGGAGG - Intergenic
1107217176 13:37935057-37935079 GGGGAGTGGGGGCGGTGGGGGGG + Intergenic
1107552578 13:41491077-41491099 GTGGAGTGGGGGAGGGGGCGCGG + Intergenic
1108243677 13:48493521-48493543 GGCGTGTGTGGGAGGAGGCAGGG - Intronic
1108327608 13:49348907-49348929 GGAGGGTGAGGGACGGGGCGTGG - Intronic
1108430192 13:50345834-50345856 GGGGAGTGAGGGAGGGAGGGAGG - Intronic
1109078799 13:57871193-57871215 GGGGTGGGAGGGCGGGGGGGAGG + Intergenic
1109370835 13:61417096-61417118 GGGGTGGGGAGGAGGTGGAGTGG - Intronic
1111445840 13:88345446-88345468 GGGGGAGGGGGGAGGTGGCGGGG + Intergenic
1111543706 13:89701559-89701581 GGGGGTGGAGGGGGGTGGCGGGG - Intergenic
1111856255 13:93641225-93641247 GGGGTGTGTGGGATGAGGAGTGG - Intronic
1111981863 13:95025201-95025223 GGGGTGTGTGGGGGGTGTGGGGG - Intronic
1112881648 13:104114073-104114095 AGGCTTTGAGGGAGGAGGCGAGG + Intergenic
1113269636 13:108659498-108659520 GGGGGGCAAGGGAGGTGGCAGGG - Intronic
1113655858 13:112067578-112067600 GGGGTGGGAGGGAGACGGAGAGG - Intergenic
1113761959 13:112854544-112854566 GGAGTGTGGGGGTGGGGGCGGGG - Intronic
1113804714 13:113106378-113106400 GGGGTGTGGGGGATGGGCCGTGG + Intronic
1113804750 13:113106467-113106489 GGGGTGTGGGGGATGGGGCATGG + Intronic
1113804790 13:113106569-113106591 GGGGTGTGGGGGATGGGGCATGG + Intronic
1113811101 13:113143172-113143194 GGGGTGTGGGGGAGCAGGAGAGG - Intronic
1113909820 13:113836571-113836593 GAGGGGTGAGGGAGGGGGTGGGG + Intronic
1113909832 13:113836593-113836615 GAGGGGTGAGGGAGGGGGTGGGG + Intronic
1113948466 13:114058112-114058134 GGGGTGTGAGGACAGGGGCGAGG + Intronic
1113966236 13:114155357-114155379 GGGGTGTGAGGGTGAGGGTGGGG + Intergenic
1114320564 14:21543903-21543925 GTGGTGGCAGGGAGTTGGCGGGG + Intergenic
1114551434 14:23534828-23534850 GAGGTGTGAGGGGGGTGGGTAGG + Exonic
1114626885 14:24136111-24136133 GGGGTCGGATGGAGGAGGCGGGG - Intergenic
1115046405 14:29000299-29000321 GGGCAGGGAGGGAGGTGGCAAGG + Intergenic
1115761548 14:36582185-36582207 GGGGTGGGAGGTAGGAGGCGTGG - Intronic
1116426568 14:44798863-44798885 GGGGGGCGGGGGAGGTGGGGAGG - Intergenic
1116614634 14:47119170-47119192 GGGGTGGGGGGGGGGGGGCGGGG - Intronic
1117548859 14:56814029-56814051 GGGGAGTGGGGGAGGGGGAGGGG + Intergenic
1117755875 14:58973554-58973576 GGGGTGGGAGGGGGGTGGGAGGG + Intergenic
1117890573 14:60417667-60417689 GGGCTGGGAGAGAGGTGGCATGG - Intronic
1117920637 14:60723062-60723084 GGGGAGCGAGGTAGGGGGCGGGG + Intronic
1118125706 14:62901365-62901387 GGGGAGAGAGGGAGGGGGCAAGG - Intronic
1118452867 14:65919676-65919698 GAGGTGGGAGGGAGATGGGGAGG - Intergenic
1118480174 14:66156816-66156838 GGGGTGGGAGGGGGGTGGGGGGG - Intergenic
1118489925 14:66249040-66249062 AGGGTGAGGGGGAGGTGGGGAGG + Intergenic
1118503407 14:66385471-66385493 TGGGTGTGGGGGCGGTGGAGTGG - Intergenic
1118764232 14:68899413-68899435 GGGGTGTGGGGAATGTGGTGTGG - Intronic
1118826898 14:69391786-69391808 GGGGTTTGGGGGTGGTGGCAGGG + Intronic
1118870863 14:69740207-69740229 GGGGTGCGAGGGACGGGGTGGGG - Intronic
1119024792 14:71144054-71144076 GGAGTGGGAGGGCGGGGGCGGGG - Intergenic
1119377160 14:74204053-74204075 GGGTGGTGGGGCAGGTGGCGGGG + Intergenic
1119456715 14:74762472-74762494 TGGGTGTGTGGGGGGGGGCGGGG - Intergenic
1119635411 14:76269363-76269385 GGGGTGTGAGGGAGTGAGAGCGG + Intergenic
1119704661 14:76776293-76776315 AGGGGGCGAGGGAGGGGGCGAGG - Intronic
1119735041 14:76976345-76976367 GGTGTGTGTGGGAGGTGGGAGGG - Intergenic
1120033452 14:79668694-79668716 GGTGTGTAAGGAAGGGGGCGGGG + Intronic
1120526706 14:85584914-85584936 GGGGTGGGAGGTGGGTGGCAGGG + Intronic
1120995701 14:90417177-90417199 CGGGTTTGGGGGAGGTGGGGAGG + Intergenic
1121109591 14:91303415-91303437 GGGGTCTGGGGGAGGTGGGTAGG - Intronic
1121132839 14:91464319-91464341 GGGGGGTGAGGGAGGGGGGTGGG - Intronic
1121332562 14:93058530-93058552 GGGGTGTGAGTCACGAGGCGGGG + Intronic
1121415894 14:93779186-93779208 GAGGAGTCTGGGAGGTGGCGGGG + Exonic
1121438139 14:93932335-93932357 GGGGTGAGTGGGAGGTGTAGGGG - Intergenic
1121779677 14:96614233-96614255 GGTGTGTGGGGGATGTGGAGAGG - Intergenic
1121787149 14:96670656-96670678 TGGGTGTGAGGGGGGCGGTGGGG - Intergenic
1121958913 14:98240626-98240648 GGGGTGAGAGGCAGGAGGTGAGG - Intergenic
1122239060 14:100349797-100349819 TGAGTGGGAGGGAGGTGGTGAGG - Intronic
1122271166 14:100568989-100569011 GGGCGGTGGGGGAGGCGGCGTGG - Intronic
1122405380 14:101497686-101497708 GGGGTGGGAGGGTGGGGGTGGGG - Intergenic
1122448231 14:101783151-101783173 GGGGAGAGAGGGAGGGGGAGGGG - Intronic
1122606232 14:102948660-102948682 GGGGGGTGAGGGAGTGGGGGTGG + Intronic
1122675106 14:103406216-103406238 GGGGGGTTAGGGGGGTGTCGGGG + Intronic
1122713585 14:103679218-103679240 AGGGGGTGAGGGTGGAGGCGGGG - Intronic
1122835260 14:104427647-104427669 GGGGAGTGAGGAAGGTGCCCTGG - Intergenic
1122970122 14:105149130-105149152 GGGTGGTGGGGGAGGTGGTGGGG - Intronic
1122970363 14:105149899-105149921 GGGGTGGTAGGGAGGTGGGTGGG + Intronic
1122970389 14:105149951-105149973 GGGGTGGTAGGGAGGTGGGTGGG + Intronic
1123121397 14:105918588-105918610 GGGGTGTGCGGGGGGCGGTGGGG + Intronic
1123172928 14:106391027-106391049 GGGGTGTGTGTGAGGTGACTTGG - Intergenic
1123998108 15:25733156-25733178 GTGGTGTGAAGGAGGTTACGGGG + Intronic
1124055116 15:26235126-26235148 GTGGTGGGAGGGAGGCGGGGTGG - Intergenic
1124247546 15:28084030-28084052 GGGGTCTCAGGGAGGTGACTGGG + Intronic
1124720862 15:32109859-32109881 GGGGTGTGCGGGGTGTGGGGAGG + Intronic
1124900338 15:33816829-33816851 GGGGTGAGAGGGAGGTCAAGAGG - Intronic
1125016986 15:34946743-34946765 CGGGAGGGAGGGAGGTGGGGGGG + Intronic
1125127230 15:36238513-36238535 GGGGTGTGGGTGAGGGAGCGGGG - Intergenic
1125200981 15:37100569-37100591 GGGGGGTGGGGGAGGCGGGGGGG + Intronic
1125395259 15:39240529-39240551 GGAGTGAGAGGGAGGTGAGGTGG + Intergenic
1125529058 15:40399631-40399653 GGGGTTGGGGGGTGGTGGCGGGG - Intergenic
1125677784 15:41511846-41511868 GCGCTGGGCGGGAGGTGGCGGGG - Exonic
1125887672 15:43240731-43240753 GGGGTGTGGAGGAGGTGAAGGGG + Intronic
1126319818 15:47409893-47409915 GGGTTGTGGGGGGGGTGGGGAGG + Intronic
1126469330 15:48990841-48990863 TGTGTGTGAGGGGGGTGGGGGGG + Exonic
1126500639 15:49340399-49340421 GGGGGGGGAGGGGGGGGGCGGGG - Intronic
1126615436 15:50574055-50574077 TGGGGGTGGGGGAGGGGGCGGGG + Intronic
1126891140 15:53205650-53205672 GGGGCCTGATGGGGGTGGCGGGG - Intergenic
1127103282 15:55588387-55588409 GGCGGGCGAGGGACGTGGCGCGG + Intronic
1127381639 15:58435473-58435495 GGGGTGGGAGTGGGGTGGGGAGG + Intronic
1127390404 15:58500734-58500756 GGGGGGAGAGGGGGGTGGTGGGG - Intronic
1127481683 15:59383661-59383683 TGGGTGTGAGAGTGGTGGCAGGG + Intronic
1127526025 15:59792473-59792495 GGGCGGGGAGGGAGGTGTCGGGG + Intergenic
1128028629 15:64460722-64460744 GGGGTGGGGGGGAGGGGCCGCGG + Intronic
1128137474 15:65274654-65274676 TGGGGGTGAAGCAGGTGGCGTGG - Intronic
1128240685 15:66099173-66099195 GGGGTGGGAGGGATGGGGAGTGG - Intronic
1128253430 15:66179803-66179825 GGGGTGGGGGGGTGGTGGCAGGG - Intronic
1128319238 15:66681289-66681311 GGGGTGGGAGTGAGGTAGGGTGG + Intronic
1128374468 15:67065518-67065540 GGGGCGCGGGGGAGGAGGCGGGG + Intronic
1129064463 15:72889463-72889485 GAGGTATGGGGGAGGGGGCGCGG - Intergenic
1129465376 15:75721737-75721759 GGGGTGGGTGGCAGGTGGCGAGG + Intergenic
1129703758 15:77782955-77782977 GGGGAGTGAGGGAGAGAGCGGGG - Intronic
1129760051 15:78124073-78124095 GGGATGACAGGGAGGTGGCTGGG + Intronic
1129885030 15:79031657-79031679 GGAGGGAGAGAGAGGTGGCGAGG + Intronic
1130393220 15:83478047-83478069 GGTGGGTGAGGGAGATGGCATGG + Intronic
1130574753 15:85081959-85081981 GGGATGTGAGGGCTGTGGAGGGG - Intronic
1130960358 15:88654898-88654920 GGGGTGTGTGAAAGGTGGTGTGG - Intronic
1131229015 15:90646978-90647000 GGGGTGTGCAGGAGGAGGAGAGG - Intergenic
1131393573 15:92069103-92069125 GGGGGGAGTGGGGGGTGGCGGGG - Intronic
1131457258 15:92591422-92591444 GGGGTGTGGGGGAGGGGGTTAGG - Intergenic
1131511306 15:93050932-93050954 GGGCCGTGGGGGAGGTGGCTGGG + Intronic
1131785411 15:95906595-95906617 GGAGGGTGAGGGAGGAGGGGAGG + Intergenic
1131828749 15:96341151-96341173 GGGGGGCGAGGGCGGGGGCGGGG + Intergenic
1132117101 15:99145545-99145567 GGGGATGGAGGGAGGTGGTGGGG + Intronic
1132321088 15:100926253-100926275 GGTGTGAGATCGAGGTGGCGTGG + Intronic
1132346275 15:101111021-101111043 GGACTGTGAGGGAGGTGCCGGGG + Intergenic
1132434017 15:101781994-101782016 GGGTGGGGAGGGAGGTGGGGTGG + Intergenic
1132533835 16:467499-467521 GGGGCGTCAGGGAGGAGGTGCGG + Intronic
1132629987 16:912651-912673 GGGGCGTGAGCGAGGTGGAGGGG - Intronic
1133018813 16:2956951-2956973 GGGGTGTGGGGAATGTGGTGGGG + Intergenic
1133020786 16:2966114-2966136 CGGGTGGGAGGGAGGTGGTGGGG - Intronic
1133164708 16:3938491-3938513 AGGCAGTGAGGGAGGTGGAGAGG - Intergenic
1133180921 16:4053967-4053989 TGGGGGTGAGGGATGTGGGGTGG - Intronic
1133597090 16:7303813-7303835 GGGGTGGGACGGAGGTAGAGAGG - Intronic
1134663042 16:15998472-15998494 GGGCTGTGATGGAGGTGATGTGG + Intronic
1135130216 16:19847458-19847480 GGGGCATGAGGGAGCTGGCTGGG - Intronic
1135166382 16:20142827-20142849 AGGGAGCGAGGGAGGTGGAGAGG + Intergenic
1135187371 16:20326963-20326985 GGGGGTTGGGGGCGGTGGCGAGG + Intronic
1135536962 16:23302181-23302203 GGGAGGCGAGGGAGGTGGCCAGG + Intronic
1135840426 16:25871162-25871184 GCGGGGTGATGGAGGTGGCAGGG + Intronic
1135901633 16:26465156-26465178 GGGGTGTGGGGGAGGTGGGGGGG - Intergenic
1135927693 16:26709840-26709862 GGGGAGGGAGGGAGGGGGAGGGG + Intergenic
1136034786 16:27531004-27531026 GGGATGGGAAGAAGGTGGCGAGG - Intronic
1136091704 16:27925386-27925408 GTGGTGGGAGGGAGGAGGGGTGG + Intronic
1136537800 16:30910564-30910586 TGGCTGGGAGGGAGGGGGCGAGG + Intergenic
1136569201 16:31086714-31086736 GGGGTGTGTGGGTCGTGGGGTGG + Exonic
1136913087 16:34159897-34159919 GCGGTGGGAGGGGGGTGGTGGGG - Intergenic
1137728221 16:50671072-50671094 GGGGTGTTGGGGGGGTGGGGCGG - Intronic
1137787224 16:51149874-51149896 GGGGTGTGAAGGAGGGAGCTGGG - Intronic
1138144243 16:54594938-54594960 GGGGAGGGGGGGAGGTGGCGGGG - Intergenic
1138180963 16:54939779-54939801 GGGCTGTGTGGGAGGAGGCCAGG + Intergenic
1138360262 16:56422445-56422467 CGGGGGTGAAGGAGGTGGGGAGG - Intronic
1138445441 16:57060345-57060367 GTGGTGTGGGGGAGGTGGGAAGG - Intronic
1138567156 16:57841875-57841897 GGGGTGTGTGGGGGGTGGATGGG - Intronic
1138738401 16:59279564-59279586 GGGATGTGAGGCAGCTGGCTCGG + Intergenic
1139006239 16:62574839-62574861 GGTGTGAGAGGGAGGAGGTGTGG - Intergenic
1139428928 16:66900784-66900806 GGGGTGGGAGAGTGGGGGCGTGG - Intergenic
1139946440 16:70645434-70645456 GGGGAGACAGGGAGGAGGCGAGG + Intronic
1140103543 16:71938823-71938845 GGAGGGTGAGAGAGGTGGAGAGG - Intronic
1140205277 16:72928119-72928141 GGGGAGAGAGGGAGGGGGAGGGG + Intronic
1140205286 16:72928138-72928160 GGGGAGAGAGGGAGGGGGAGGGG + Intronic
1140205295 16:72928157-72928179 GGGGAGAGAGGGAGGGGGAGGGG + Intronic
1140205304 16:72928176-72928198 GGGGAGAGAGGGAGGGGGAGGGG + Intronic
1140358238 16:74323833-74323855 GAGGTGTCAGGCAGGTGGAGTGG + Intergenic
1140393254 16:74606648-74606670 AGGATGTGAGGGAGGTGAGGAGG - Exonic
1140442543 16:74998975-74998997 GGGGGGAGGGGGAGGGGGCGCGG + Intronic
1140692862 16:77501083-77501105 GGCCTGTCAGGGAGGTGGGGAGG - Intergenic
1140722622 16:77785020-77785042 GGTGTGTGTGGGGGGTGGGGGGG - Intergenic
1140808331 16:78553707-78553729 GGTCTGTGAGGGAGGAGGCCTGG + Intronic
1140870524 16:79102071-79102093 GGGGTGTGGGGAGGGTGGGGCGG + Intronic
1140983073 16:80129257-80129279 GGGGAGGTAGGGAGGTGGGGAGG + Intergenic
1141054446 16:80803527-80803549 GGGGGGTGAGGGAGGTGGCCCGG + Intronic
1141128037 16:81415132-81415154 GGGGAGGCAGGGAAGTGGCGGGG + Intergenic
1141181223 16:81754362-81754384 GGGGTGGGGAGGAGGTGGGGAGG - Intronic
1141181245 16:81754404-81754426 GGGGTGGGGAGGAGGTGGGGAGG - Intronic
1141186495 16:81791251-81791273 TGGATGTGGGGGAGGTGGTGAGG + Intronic
1141266148 16:82499156-82499178 GGGGTGGGGGGGAGGGGGAGGGG - Intergenic
1141419049 16:83899740-83899762 GGGGTGTGTGGGACTTGGAGGGG - Intronic
1141490677 16:84370489-84370511 GAGGAGGGAGGGAGGTGGGGAGG + Intronic
1141526335 16:84614349-84614371 GGGGTGGGAGGGAACTGGCCTGG + Intronic
1141682836 16:85554300-85554322 GGTGTGAAAGGGAGGCGGCGTGG + Intergenic
1141982530 16:87559339-87559361 GGGGTGTGTGTGTGGTGGGGCGG + Intergenic
1142228705 16:88889402-88889424 GGGGCGGGAGGGAGGGAGCGAGG + Intronic
1142240356 16:88941854-88941876 GGGGTGTGGGGGGGGTGGGGAGG + Intronic
1142267416 16:89070931-89070953 GGGGGGTGAGGGCGGCGGTGGGG - Intergenic
1142359701 16:89620252-89620274 AGGGAGTCAGGGAGGTGGCTGGG + Intronic
1203083680 16_KI270728v1_random:1165895-1165917 GGGGTATGTGTGAGGTGACGTGG + Intergenic
1142474393 17:180803-180825 GGGCTGGCAGGGAGGGGGCGCGG + Intronic
1142548213 17:720515-720537 AGGCTGTGAGGGAGGTGGGGAGG + Intronic
1142548234 17:720609-720631 AGGCTGTGAGGGAGGTGGAGAGG + Intronic
1142744467 17:1948751-1948773 GGGGTGTGAGGGGGAGGGCGTGG + Intronic
1142759539 17:2034776-2034798 GGGGAGTGGGGGAGGAGGGGAGG - Intronic
1142762151 17:2049050-2049072 GGGGAGTGAAGGAGGGGGTGGGG + Intergenic
1142810821 17:2394855-2394877 GGGGTGAGTGGGGTGTGGCGGGG - Exonic
1143109419 17:4545004-4545026 GGTGAGTGGGGGAGGTGGAGGGG - Exonic
1143125444 17:4638809-4638831 TGGGTGAGAGGGAGGTGTCCTGG - Intronic
1143403024 17:6658003-6658025 TGGGTGAGAGGGAGGTGTCCTGG + Intergenic
1143444343 17:6998615-6998637 GGGGTGGGACAGTGGTGGCGGGG - Intronic
1143448071 17:7020259-7020281 GGAGTGTGGGTGAGATGGCGGGG - Intergenic
1143473502 17:7190602-7190624 GGGGTGGGAGGGAGGCCGGGGGG + Exonic
1143490209 17:7281686-7281708 GGGGCAGGAGCGAGGTGGCGGGG + Exonic
1143539107 17:7558979-7559001 GGGGTAGCAAGGAGGTGGCGGGG - Exonic
1143723476 17:8829877-8829899 GGGGTCTTAGAGAGGTGGCAGGG + Intronic
1143783184 17:9240075-9240097 GTGGGGGGAGGGAGGGGGCGGGG + Exonic
1143863692 17:9908935-9908957 GGGGTATGGAGAAGGTGGCGGGG + Intergenic
1144407618 17:14967343-14967365 GGGGAAAGAGGGAGGGGGCGAGG - Intergenic
1144426262 17:15145101-15145123 TGTGTGTGGGGGAGGGGGCGTGG - Intergenic
1144447694 17:15346132-15346154 GGGGTGGGGGGGCGGTGGGGTGG - Intergenic
1144572415 17:16407923-16407945 GGGGTGGGAGGCAGGTTGGGGGG + Intergenic
1144647825 17:16987450-16987472 AGGGAGGGAGGGAGGTGGAGAGG + Intergenic
1144653094 17:17019206-17019228 GGGGAGTGGGGAAGGTGGCTTGG + Intergenic
1144736990 17:17560828-17560850 GGGGTGAGGTGGAGGTGGGGAGG - Intronic
1145255152 17:21318284-21318306 GGGCTGTGCGGGAGGTGGTCTGG + Intergenic
1145321454 17:21769671-21769693 GGGCTGTGCGGGAGGTGGTCTGG - Intergenic
1145985893 17:29045972-29045994 GAGGTGGGAGGGAGGTGGGATGG - Intronic
1146008897 17:29179252-29179274 GGGGGGTGGGGGAGATGGGGAGG - Intronic
1146034085 17:29390819-29390841 GGGGGGTGGGGGGGGGGGCGAGG - Exonic
1146630151 17:34463808-34463830 GTGCTGTGACGGAGGTGGCGGGG - Intergenic
1146928787 17:36763581-36763603 GGAGTGTGAGGGTGGGGGCGGGG - Intergenic
1147018520 17:37511914-37511936 GGGGTGGGGGGGGGGTGGCTGGG - Intronic
1147190465 17:38735351-38735373 GGGGAGTGGGGGAGGTAGGGTGG + Exonic
1147211471 17:38874765-38874787 GGCCTGTGAGGGAGGTGGGAAGG + Intronic
1147258236 17:39194740-39194762 GGGGTGTCAGGGTGATGGGGTGG + Intronic
1147417973 17:40307384-40307406 GGGGTGAGAGGGTGGAGGTGGGG - Intergenic
1147497167 17:40927794-40927816 GGGGTTTGAGGGGGGTAGCCTGG + Intronic
1147650695 17:42060196-42060218 GGGGTGTGTGGGGGGTGCCACGG - Intronic
1147772546 17:42877897-42877919 GGGGTGGGAGTAAGGTGGGGAGG + Intergenic
1148206734 17:45784258-45784280 GGACCGTGGGGGAGGTGGCGGGG + Intronic
1148509839 17:48159034-48159056 GAGGTGAGATGGAGGTGGCAGGG - Intronic
1148586269 17:48783127-48783149 TGTGTGTGTGGGAGGTGGGGCGG + Intronic
1148615782 17:48998489-48998511 GGGGCGTGAGCGGGGTGGCGCGG + Intronic
1148751672 17:49948898-49948920 GGAGTGGGAGGGAGGTGGGAGGG + Intergenic
1148857070 17:50584610-50584632 GGGGTGACAGGGGGGCGGCGGGG + Intronic
1149431254 17:56596713-56596735 GAGGTGGCAGGGAGGTGGGGAGG - Intergenic
1149431699 17:56599332-56599354 GGGGTGTGGGGGAGGAAGTGGGG - Intergenic
1149992048 17:61388795-61388817 GGTGTGTGTGGGAAGTGGAGGGG - Intronic
1150455473 17:65303697-65303719 GGGGTGGGAGGGAGGGAGGGAGG + Intergenic
1150559562 17:66282859-66282881 GGGATGAGAGGGAGGTGGGAAGG - Intergenic
1150640331 17:66945369-66945391 GGGGTGGGATGGGGGTGGAGGGG + Intergenic
1150660581 17:67072656-67072678 GGGGTGAGAGTGAGGAGGGGTGG + Exonic
1150872596 17:68929972-68929994 GGGGGGTGGGGGCGGTGGGGGGG + Intronic
1151155821 17:72122479-72122501 GGGAGGGGAGGGAGGGGGCGGGG + Intronic
1151191397 17:72400513-72400535 GGGGGGTGGGGGCGGTGTCGGGG + Intergenic
1151383875 17:73743456-73743478 GCTGTGTGAGGGAGGAGGTGGGG - Intergenic
1151401354 17:73857947-73857969 GGGGTGTGGGGAGGGTGGCTGGG + Intergenic
1151491028 17:74432429-74432451 GGGGTGGGAGGGACGCGGCGCGG - Intronic
1151560742 17:74868191-74868213 GGGGCTTGAGGGAGGTGGTTTGG - Intronic
1151850044 17:76684782-76684804 GGGGTGTGGAGGGGGTGGGGGGG + Intronic
1152077682 17:78169099-78169121 GTGGGGTAAGGGAGGGGGCGGGG + Intronic
1152111615 17:78360203-78360225 GGAGGGTGAGGGAGGGGCCGCGG + Intergenic
1152141826 17:78541110-78541132 GGGGGGTGAGCGGGGTGGGGGGG + Intronic
1152141835 17:78541127-78541149 GGGGGGTGAGCGGGGTGGGGGGG + Intronic
1152233347 17:79125765-79125787 TGGGAGTGAGGCTGGTGGCGAGG + Intronic
1152293633 17:79454420-79454442 GGTGGATGAGAGAGGTGGCGGGG - Intronic
1152315414 17:79577765-79577787 GGGGAGGGAGAGAGGTGGAGGGG + Intergenic
1152462163 17:80447150-80447172 GGGCTGTGAGGCAGCTGGGGAGG - Intergenic
1152462173 17:80447195-80447217 GGGCTGTGAGGCAGCTGGGGAGG - Intergenic
1152462183 17:80447240-80447262 GGGTTGTGAGGCAGCTGGGGAGG - Intergenic
1152527390 17:80896375-80896397 GGGGTGTCAGCGAGGCCGCGTGG - Intronic
1152540169 17:80970775-80970797 TGGCTGTGAGGTAGGTGGCATGG - Intergenic
1152577527 17:81149410-81149432 GGGGTGTGAGGGTGGGGGAAGGG - Intronic
1152640043 17:81445521-81445543 GTGGGGTGGGGGAGCTGGCGGGG - Exonic
1152803034 17:82340416-82340438 TGGGTGTGAGGAAGCTGGGGAGG - Intergenic
1152945637 17:83196073-83196095 GGGGTCTGGGGGAGGAGGCTGGG - Intergenic
1153428596 18:4991577-4991599 AGGGAGGGAGGGAGGTGGGGGGG + Intergenic
1153715205 18:7840072-7840094 GGGGTGGGGTGGAGGTGGGGGGG + Intronic
1153881074 18:9422230-9422252 GGGGCGGGTGGGAGGTGGGGAGG + Intergenic
1154097310 18:11430311-11430333 GGGGTGAGGGGGAGGCGGGGAGG + Intergenic
1154282270 18:13015128-13015150 GTCAGGTGAGGGAGGTGGCGTGG + Intronic
1154485864 18:14871033-14871055 GGGGTGTGTGGGTGGGGGTGTGG - Intergenic
1155355091 18:24944188-24944210 GGGGGTTGAGGGAGGTGGAGAGG + Intergenic
1155356642 18:24960115-24960137 GGGGGGTGGGGGGGGTGGTGTGG - Intergenic
1155407008 18:25500132-25500154 GGGGTGGGATGGAGGGGGTGGGG + Intergenic
1155509491 18:26562429-26562451 GGGGTGGGGGGGTGGGGGCGGGG + Intronic
1156036836 18:32773574-32773596 GGGGTGGGGGGGAGGTGTGGGGG - Exonic
1156316313 18:35972340-35972362 GGGCTGTCAGAGAGGAGGCGAGG + Exonic
1157334967 18:46731472-46731494 GGGGCGAGAGGGAGGTGAAGGGG - Intronic
1157570199 18:48707105-48707127 GGGGAGTGCAGGAGGTGGAGGGG + Intronic
1157705315 18:49800257-49800279 CGGGAGGGAGGGAGGTGGGGGGG + Intronic
1158413548 18:57229851-57229873 GGGGAGTGGGGGAGCTGGAGAGG + Intergenic
1158546674 18:58403515-58403537 GAGCTGTGAGGGAGGGGGCCTGG - Intergenic
1158851078 18:61496163-61496185 GGGGGGAGAGGGAGGGGGAGAGG - Intronic
1159215937 18:65390648-65390670 GGGGCCTGTGGGAGGTGGAGGGG + Intergenic
1159999753 18:75005692-75005714 GGTGGGTGGGGGGGGTGGCGGGG - Intronic
1160158251 18:76450334-76450356 GGGGAGTGGGGGAGGGGGAGGGG - Intronic
1160217085 18:76941481-76941503 TGGGTGGGAGGGAGAGGGCGTGG - Intronic
1160220448 18:76973667-76973689 ATGCTGCGAGGGAGGTGGCGTGG + Intergenic
1160269654 18:77372921-77372943 GGGGTGTGAGGTGGGGAGCGGGG - Intergenic
1160269671 18:77372971-77372993 GGGGTGTGAGGTGGGGAGCGGGG - Intergenic
1160269702 18:77373071-77373093 GGGGTGTGAGGTGGGGAGCGGGG - Intergenic
1160341748 18:78095179-78095201 GGGGTGGGAGGCGGGTGGTGTGG + Intergenic
1160375774 18:78410468-78410490 GTGGTGTGAGGTGGGTGGAGAGG - Intergenic
1160394910 18:78564055-78564077 GGGGGGTGTGGGAGGTGAGGGGG - Intergenic
1160400073 18:78603769-78603791 GAGGTCTGAGGGAGGTGCAGCGG - Intergenic
1160665870 19:327896-327918 GGAGAGTGAGGGTGGTGACGTGG - Exonic
1160710451 19:548862-548884 GGGGTGAGAGTGCGGGGGCGGGG - Intronic
1160904090 19:1444364-1444386 GGGGTGTCCAGGAGGTGGGGTGG + Intergenic
1161136163 19:2621082-2621104 GGGGTGTGCAGGAAGGGGCGAGG - Intronic
1161231433 19:3176886-3176908 GGGGTCCAAGGGAGGAGGCGAGG - Intronic
1161258627 19:3323391-3323413 GGGGTGTGGGGCGGGGGGCGGGG - Intergenic
1161262338 19:3344968-3344990 AGGGAGAGAGGGAGGAGGCGAGG + Intergenic
1161277470 19:3426680-3426702 GGGGAGAGAGGGAGGAGGGGAGG - Intronic
1161317514 19:3624620-3624642 TGGGGGAGAGGGAGGAGGCGCGG + Intronic
1161321862 19:3645165-3645187 GGGGTTGCAGGGAGGTGGCAGGG - Intronic
1161447477 19:4326768-4326790 TGTGTGTGGGGGAGGGGGCGGGG - Intronic
1161488300 19:4547793-4547815 GGGGAGTGAGGGAGGAGGGGAGG - Intronic
1161490386 19:4557953-4557975 GGGGAGAGAGAGAGGAGGCGAGG - Intronic
1161499143 19:4603688-4603710 GGGGTGAGAGGGTGGTGGGTGGG + Intergenic
1161537860 19:4831222-4831244 GGGGTGTGAGGTAGGAAGCTTGG + Intronic
1161642487 19:5432905-5432927 GGGGAGGGTGGGAGGTGTCGAGG + Intergenic
1161642866 19:5435340-5435362 GGGTTGTGGGGGAGGTGGATCGG - Intergenic
1161752862 19:6110335-6110357 GGGGAGTGTGGGGGGCGGCGGGG - Intronic
1161846931 19:6717068-6717090 GGGGAGAGAGGGAGGAGGGGAGG + Intronic
1162000837 19:7744010-7744032 AGGGTGTCAGGGAGTTGGGGAGG + Intronic
1162085612 19:8247250-8247272 GGGGAGAGAGGGAGGAGGGGAGG - Intronic
1162110369 19:8396716-8396738 GGGGCGGGAGGGAGGAGGGGAGG + Intronic
1162156390 19:8680945-8680967 GGGGAGAGAGGGAGGAGGCGAGG + Intergenic
1162504960 19:11078221-11078243 GGGGCGTGGGGGCGGTGGTGGGG - Intergenic
1162523811 19:11196540-11196562 GGAGTCTGAGGGTGGTGGCTTGG - Intronic
1162549370 19:11350073-11350095 GGGGTGGGAGGAAGGAGGGGAGG - Intronic
1162964902 19:14151047-14151069 GGGGGGTGCGGGAGGGGGTGGGG + Exonic
1163035693 19:14567656-14567678 TGGGTCTGAGGGAGGCGGTGGGG - Intronic
1163110778 19:15160007-15160029 GTGAAGTGAGGGAGGTGGGGTGG + Exonic
1163202405 19:15778417-15778439 GGGGAGTGAGTGAGGAGGGGAGG + Intergenic
1163425029 19:17236291-17236313 GGGGTGGGGGGCAGGTGGGGGGG + Intronic
1163453311 19:17391720-17391742 GGGGTGTAAGGGAGTGGGCAGGG - Intergenic
1163553516 19:17979529-17979551 GGGGGGTGGGGGAGGGGGCGTGG + Intronic
1163607455 19:18282707-18282729 GGGGTGTGAGGGAGGAGAGATGG + Intergenic
1163635019 19:18433653-18433675 GGGGTGGCGGGGAGGGGGCGGGG + Intronic
1163838614 19:19592051-19592073 GGTGGGTGAGGGAGGTGGGGGGG + Intronic
1164157088 19:22603483-22603505 GGGGTGGGAGGGACATGGGGGGG - Intergenic
1164479799 19:28602608-28602630 GGAGTGGGAGGGAGGTGGGCTGG - Intergenic
1164635925 19:29791519-29791541 GGACTGTGAGGGAGGAGGAGGGG - Intergenic
1164673009 19:30083443-30083465 GGTGGGTGAGGGAGCCGGCGTGG + Intergenic
1164845924 19:31432540-31432562 GGGGTGTGAAGGAAGTGCTGTGG - Intergenic
1165078965 19:33296905-33296927 GGGGCGTGGGGGAGGGGGAGAGG + Intergenic
1165172886 19:33906222-33906244 GGGGGGGGAGGGTGGTGGGGTGG - Intergenic
1165326578 19:35117663-35117685 GGGGGTTGGGGGAGCTGGCGTGG - Intronic
1165443018 19:35841684-35841706 GGGCTGTGAGGGTGTTGGGGAGG - Intronic
1165796473 19:38522990-38523012 GGGAGGTGAGGGAGGGGGTGGGG - Intronic
1165873972 19:38992683-38992705 GAGGGGTGAGGGAGGAGGAGAGG + Intronic
1165925250 19:39322045-39322067 GGGGTTTGAGGGAAGGGGTGGGG - Intergenic
1165940670 19:39413408-39413430 GGGAGGTGAGGGGGGAGGCGAGG + Exonic
1165993213 19:39827472-39827494 GGGGTGTGCTGGAGGTGGAGGGG - Intronic
1166301435 19:41913899-41913921 GGGGTGTGAGGGTGGCAGTGAGG - Intronic
1166306444 19:41939031-41939053 TGGGTCTGAGGGAGGAGACGCGG - Intergenic
1166313529 19:41976206-41976228 TGGGTCTGAGGGAGGGGGCCTGG - Intronic
1166536949 19:43580498-43580520 GGGGTGGGCGGGGGTTGGCGGGG + Intronic
1166676773 19:44745886-44745908 AGGGTCTGAGGGAGGAGGTGAGG - Intergenic
1166676794 19:44745986-44746008 GGGGTCTGAGGGAGGAGGTGAGG - Intergenic
1166676895 19:44746401-44746423 AGGGTCTGAGGGTGGAGGCGAGG - Intergenic
1166943549 19:46383567-46383589 GGGGTGTGAGGGAGAGAGGGAGG - Intronic
1166995794 19:46719190-46719212 GATGTGTGAGGGTGGTGGCGAGG - Intergenic
1167249322 19:48392141-48392163 TGGGTCTGAGGGAGGAGGCTGGG - Intergenic
1167249335 19:48392176-48392198 TGGGTCTGAGGGAGGAGGCTGGG - Intergenic
1167264807 19:48478207-48478229 TGGGGCTGAGGGAGGTGGGGTGG + Intronic
1167276688 19:48544035-48544057 TGGGTCTGAGGGAGGAGGCTGGG - Intergenic
1167276739 19:48544181-48544203 TGGGTCTGAGGGAGGAGGCTGGG - Intergenic
1167314360 19:48755221-48755243 TGGGTCTGAGGGAGGAGGGGTGG - Intronic
1167322981 19:48807643-48807665 TGGGTCTGAGGGAGGAGGGGTGG - Intronic
1167386840 19:49168469-49168491 TGGGTCTGAGGGAGGAGGAGGGG + Intronic
1167441680 19:49512839-49512861 TGGGTCTGAGGGAGGAGGGGTGG + Intronic
1167505898 19:49870956-49870978 GGGCTTTGAGGGAGGAGGCCTGG - Intronic
1167709339 19:51100243-51100265 GGGGTGTGAGGGCAGAGGCAAGG + Intronic
1167741037 19:51325233-51325255 TGGGTCTGAGGGAGGAGGAGGGG + Intronic
1168128398 19:54300043-54300065 GGGGAGTGAGGGAGGGAGGGAGG - Intergenic
1168149200 19:54435886-54435908 TGGGTCTGAGGGAGGAGGGGCGG + Intronic
1168174027 19:54609693-54609715 GTGGTGTTAGCAAGGTGGCGGGG - Intronic
1168238228 19:55076512-55076534 CGGGTGTGGGTGAGGAGGCGAGG - Intronic
1168291728 19:55360564-55360586 TGGGTCTGAGGGAGGAGGGGTGG - Intronic
1168350079 19:55670657-55670679 GGTGAGTGAGCGAGGTGGTGGGG + Intronic
1168558320 19:57362269-57362291 GGGGTGGGGGGCAGGGGGCGCGG - Intergenic
924979691 2:208151-208173 GGGGTGTTGAGGAGGTGACGAGG + Intergenic
924985311 2:264611-264633 GGTGTGTGTGTGTGGTGGCGGGG - Intronic
925294761 2:2769241-2769263 GGGGTGTTCTGGAGGTGGGGAGG - Intergenic
925296760 2:2782159-2782181 GGGCTGTGATGGAGTTGGGGTGG - Intergenic
925594326 2:5540026-5540048 AGGCGGTGAGGGAGGTGGAGGGG + Intergenic
925875882 2:8310750-8310772 AGGGTGTGTGGGAGGAGGGGAGG + Intergenic
925904177 2:8529494-8529516 AGGGTGAGGGGGAGGTGGCATGG - Intergenic
927486969 2:23495276-23495298 GGGCTGTCAGGCAGGTGGCAGGG + Intronic
927713976 2:25341291-25341313 GGGGAGCGGGGGAGGGGGCGGGG - Intronic
927845901 2:26472845-26472867 CCGGTGGGAGGGAGGTGGCGGGG + Intronic
927873642 2:26640114-26640136 AGGGAGGGAGGGAGGTGGAGAGG + Intronic
927904292 2:26846559-26846581 TGGGCTTCAGGGAGGTGGCGTGG - Intergenic
928135988 2:28687866-28687888 GGGGTGTGAGGCTGGAGACGGGG - Intergenic
928602561 2:32916343-32916365 GGGGTGAGAGGGGGGGGGGGGGG + Intergenic
929055517 2:37873176-37873198 GGAGTCTGATGGAGGTGGTGGGG - Intergenic
929520656 2:42647520-42647542 GGGGTGGGAGGCAGGTGGGGTGG - Intronic
929556972 2:42931688-42931710 GAGGTGGGAGAGAGGTGGCATGG + Intergenic
929561915 2:42961446-42961468 GGGGAGAGAGGGAGGGGACGGGG - Intergenic
929564708 2:42977074-42977096 GGGGTGGGTGGGAGGTTGTGTGG + Intergenic
929594773 2:43169291-43169313 GTGGTGGGAGGGAGGTTTCGGGG + Intergenic
929811636 2:45193640-45193662 GGGATGGGAGGGAGGTGGTAGGG + Intergenic
929874668 2:45786643-45786665 GGGGTGGGAGTGAGGGGGCAAGG + Intronic
929934848 2:46286867-46286889 TGGGTGTGGGGCAGGTGGGGAGG + Intergenic
930007084 2:46906592-46906614 GGGGTGGGAGGGTAGTGGGGAGG - Intronic
930056039 2:47252744-47252766 GTGGTGTTAGGGTGGTGGTGGGG + Intergenic
930189186 2:48440764-48440786 GGGGTGGGAGGAAGGTGGAGTGG - Intronic
930402402 2:50906962-50906984 GGGGTGTGAGAGAGGAGGGCAGG - Intronic
931165672 2:59745001-59745023 TGGGGGTGGGTGAGGTGGCGGGG - Intergenic
931225373 2:60324796-60324818 GGGGTGGAAGGTAGGTGGGGAGG - Intergenic
931241974 2:60461796-60461818 GGGCTGGGAGGGAGGAGGGGCGG + Exonic
931515845 2:63050455-63050477 GGAGTGGCAGGGAGGAGGCGAGG - Intronic
931924239 2:67054040-67054062 GGTGGGTGAGGCAGGTGGGGCGG - Intergenic
931970057 2:67576129-67576151 GGGGTGTGAGGAGGTTGGTGAGG + Intergenic
932430985 2:71673377-71673399 CTGGTCTGAGGGAGGTGGGGTGG + Intronic
932448643 2:71795780-71795802 GGGGTGAGAAGCAGGTGGCAAGG + Intergenic
932495610 2:72144522-72144544 GGGGTGTGGGGGTGGGGGTGGGG - Intronic
932573331 2:72949816-72949838 GGGGTGAGAGGGAGGTGTTGAGG + Intronic
933206502 2:79513252-79513274 AGGATGGGAGGGAGGTGGGGAGG - Intronic
933215964 2:79630174-79630196 GGTGAGTGAAGGAGGTGGCAAGG - Intronic
933695722 2:85215771-85215793 GGGGGGTGAGGGGGGTGGTGAGG + Intronic
933748133 2:85585390-85585412 GAGGTGTGATGGATGTGGCCTGG + Intronic
933886028 2:86720114-86720136 GGCGTGCGAGGGAGAGGGCGAGG - Intronic
933924152 2:87076592-87076614 GGCGTGCGAGGGAGAGGGCGAGG + Intergenic
934262735 2:91490127-91490149 GGGGTGGGGGGTGGGTGGCGGGG + Intergenic
934475982 2:94593816-94593838 GGAGTTTGGGGAAGGTGGCGGGG - Intronic
934750921 2:96793573-96793595 GGGGTCTCAGAGAGGAGGCGGGG + Intronic
934793461 2:97082142-97082164 GAGGTGGTAGGGAGGTGGTGGGG + Intergenic
934979292 2:98826890-98826912 GGGGAGTGAGGCAGGTTGGGGGG + Intronic
935049914 2:99516614-99516636 GGGGTGGGAGAGAGGTGGATGGG - Intergenic
935563651 2:104584317-104584339 GGGGTGGGGGGGGGGCGGCGGGG + Intergenic
935713178 2:105917286-105917308 GCAGTGAGAGGGAGGTGGGGAGG - Intergenic
935926782 2:108078205-108078227 GGGATGAGAGGGAGGGGGAGGGG + Intergenic
936117672 2:109714966-109714988 GGGGGGTGGGGGTGGGGGCGGGG + Intergenic
936996287 2:118417442-118417464 GGGGTGGGAGGGAGCTTGCCAGG - Intergenic
937439827 2:121906303-121906325 GGGGGGTGGGGGCGGTGGCGCGG - Intergenic
937978649 2:127597421-127597443 CAGGTGTGAGGGAGGGGGCGTGG - Intronic
938097134 2:128471360-128471382 GTGGTGTGTGGGAGGAGGCTGGG + Intergenic
938097141 2:128471394-128471416 GTGGTGTGTGGGAGGAGGCTGGG + Intergenic
938097219 2:128471688-128471710 GTGGTGTGTGGGAGGAGGCTGGG + Intergenic
938374896 2:130798701-130798723 TGGGTGGGAGGGTGGTGGCGCGG - Intergenic
938537101 2:132256306-132256328 GTGGTGGGAGGGGGGTGGTGGGG + Intronic
938739645 2:134219094-134219116 GAGGTGTGAGTGCGGTGGAGTGG + Intronic
939509598 2:143089694-143089716 GGGGTGTGGGGGGAGTGGTGCGG + Intergenic
939630743 2:144524181-144524203 GGGGTGTGTGGGGGGGGGAGTGG - Intronic
942151024 2:173076029-173076051 GGGCGGGGAGGGAGGGGGCGAGG + Intronic
942629937 2:177944727-177944749 GGGCTGTGAGAGAGGGAGCGTGG + Intronic
943090960 2:183374511-183374533 GGGGTGTGTGGGGGGGGGTGGGG + Intergenic
943105758 2:183544040-183544062 GGGGTGGGGGGGTGGTGGAGAGG + Intergenic
943702913 2:191005851-191005873 GGGGTGTGAGGGAAGTTTCTGGG - Intronic
944070123 2:195658011-195658033 CGGGTGGGCCGGAGGTGGCGCGG + Intronic
944255384 2:197618992-197619014 CGGGAGGGAGGGAGGTGGGGGGG + Intronic
944680664 2:202073806-202073828 GTGTTGTTAGTGAGGTGGCGGGG + Intronic
944905270 2:204255981-204256003 GGGGTGTGAGGCAGGGAGTGAGG - Intergenic
945111879 2:206367707-206367729 GGGGTGGCAGGGGGGTGGTGTGG + Intergenic
945247179 2:207729264-207729286 GGGGGGTGGGGGGGGTGGGGTGG - Intronic
945275302 2:207982216-207982238 GGGGAGTGAGGGAGGGAGGGAGG - Intronic
945829186 2:214762877-214762899 GTGGTGGGAGGGGGGTGGGGTGG - Intronic
945913698 2:215680311-215680333 GGGGTCTGACGGCGGGGGCGGGG + Intergenic
945988366 2:216372210-216372232 GTGCTGGAAGGGAGGTGGCGGGG + Intergenic
946108593 2:217393883-217393905 GGGGTGTGAGGGCAGAGGGGTGG - Intronic
946195918 2:218033055-218033077 TGGCTGTGTGGGAGGTGGGGAGG + Intergenic
946200360 2:218067873-218067895 TGGCTGTGTGGGAGGTGGGGAGG + Intronic
946230588 2:218288784-218288806 GGGGTGGAAGGGAGTTGGGGTGG + Intronic
946248437 2:218399915-218399937 GGAGGGGGAGGGAGGGGGCGCGG - Exonic
946371695 2:219285203-219285225 GGGGTGTCAGGGCAGTGGAGGGG + Exonic
946372839 2:219290938-219290960 GGGGAGGGACGGAGGAGGCGAGG + Intronic
946405138 2:219488426-219488448 GGGGAGTGAGTGAGGGGGCCTGG + Intronic
946471966 2:219968993-219969015 GGGGCGTGTGGGAGGTGAGGGGG - Intergenic
946485319 2:220095680-220095702 GGGGAGTGAGGGGTGTGGGGCGG - Intergenic
946865760 2:224039586-224039608 TGGGGGTGTGTGAGGTGGCGGGG + Intergenic
947309540 2:228785621-228785643 GGGGTGTCAGAGAAGTGGTGAGG - Intergenic
947402466 2:229743191-229743213 CGTCTGGGAGGGAGGTGGCGGGG + Intergenic
947535810 2:230939929-230939951 GGGGTGTGTTGGCGGGGGCGGGG + Intronic
947703725 2:232257491-232257513 AGGGTGGGAGGGAGGTGGAGTGG - Intronic
947798017 2:232906329-232906351 CGTGTGGGAGGGAGGTGGGGGGG + Intronic
947798095 2:232906505-232906527 CGTGTGGGAGGGAGGTGGGGGGG + Intronic
948467346 2:238158813-238158835 GGGGAGTGGGGGAGGGGGCACGG - Intergenic
948815333 2:240507503-240507525 GGGGTTTGAGGGTGGTGGGGTGG - Intronic
948843591 2:240672396-240672418 GGGTGGTGAAGGAGGTGTCGCGG - Intergenic
949050805 2:241896462-241896484 GGAGTGTCAGGGAGATGGCGGGG + Intronic
1169309457 20:4522472-4522494 GGTGTGTGAGGGAGCGAGCGCGG - Intergenic
1169404766 20:5314389-5314411 GTGGTGTGAGGGAGGTGCGAGGG + Intergenic
1169432613 20:5552250-5552272 AGGGTTTCAGGGAGGTGGCCAGG - Intronic
1169530336 20:6478214-6478236 GGGGCGTGATGGGGGGGGCGGGG - Intergenic
1170027199 20:11902041-11902063 GGGGTGGGAGGTTGGTGGGGTGG - Intronic
1170028009 20:11912017-11912039 GGGGTGAGCGGGGGGTGGGGAGG - Intronic
1170578128 20:17680221-17680243 GGAGTGTGAGGAGGGAGGCGGGG + Intronic
1170732802 20:18988954-18988976 GAGGCGGGAGGGAGGGGGCGAGG + Intergenic
1171018667 20:21564303-21564325 TGGATGGGTGGGAGGTGGCGGGG + Intergenic
1171022123 20:21595152-21595174 TGGGGGTGAGGGAGGTGACAAGG - Intergenic
1171364692 20:24615821-24615843 GGCGGGTGGGGGAGGTGGGGCGG - Intronic
1171866014 20:30488085-30488107 GTGGTGGGAGGGGGGTGGTGGGG + Intergenic
1171869374 20:30513386-30513408 GGCGTGTGGGGGAGGAGGGGTGG - Intergenic
1172059240 20:32176578-32176600 GGTCTGGGAGGGAGGTGGGGGGG + Intergenic
1172059544 20:32177282-32177304 GGTCTGGGAGGGAGGTGGGGGGG + Intergenic
1172100755 20:32483179-32483201 CGGGGCTGAGGGAGGGGGCGCGG - Intronic
1172118149 20:32583797-32583819 GTGGCGTGGGGGAGGGGGCGGGG - Intronic
1172292183 20:33784263-33784285 GGAGGGTGAGGGAGATGGGGGGG - Intronic
1172295919 20:33811291-33811313 GGGGCCTGTGGGAGGTGGCGCGG + Exonic
1172443247 20:34979957-34979979 GGGCTGTGAGCGATGAGGCGGGG + Intronic
1172624050 20:36337332-36337354 GGGATGGGAGGGAAGTGGTGGGG + Intronic
1172658107 20:36549251-36549273 GGGGTGTCAGGGGGCTGGGGTGG - Exonic
1172794240 20:37526274-37526296 GGGGGGTGGGGGCGGTGGGGGGG - Intronic
1172913887 20:38429652-38429674 GTGGTGGGAGGGAGGAGGTGTGG + Intergenic
1173165252 20:40683238-40683260 GGGGTGTGCGGGAGGCTGTGCGG - Intergenic
1174063619 20:47849365-47849387 GGGGTGAGGAGGAGGTGGGGAGG + Intergenic
1174691408 20:52510254-52510276 GGGGTGTGGGGGTGGTGAGGAGG - Intergenic
1174741068 20:53014813-53014835 GGGGCTTCAGGGAGGTGGAGGGG - Intronic
1175190171 20:57206486-57206508 GGTGAGTGAAGGAGGTGGCAGGG - Intronic
1175224845 20:57439156-57439178 AGGGGGTTAGGGAGGTGGGGGGG - Intergenic
1175224938 20:57439359-57439381 GGGGTGGGAGGGTGGGGGAGTGG - Intergenic
1175409200 20:58754832-58754854 GGGTTGTGGGGGAGGGGGGGGGG + Intergenic
1175415648 20:58799056-58799078 GGGGGGTGGGGGCGGTGGGGAGG + Intergenic
1175491701 20:59384425-59384447 AGGATGTGGGGGAGGTGGGGGGG + Intergenic
1175631629 20:60543867-60543889 GGGGTGGGAGTGGGGTGGGGTGG - Intergenic
1175825871 20:61936365-61936387 GGGGTGTGGGGGAAGGGGAGGGG - Intronic
1175825880 20:61936379-61936401 GGGGTGTGGGGGAGGGGGTGTGG - Intronic
1175828786 20:61951003-61951025 AGGGTGGGAGGGAGGTGCCCAGG - Intergenic
1175960468 20:62634037-62634059 GGGCTGTGAGGCGGGGGGCGGGG + Intergenic
1176040483 20:63062926-63062948 GGGGGCTGGGGGAGGAGGCGTGG - Intergenic
1176041383 20:63067718-63067740 GAGGTGGGAGGGAGGAGGGGTGG + Intergenic
1176096749 20:63347789-63347811 GGGATGGGAGGGATGTGCCGCGG + Intronic
1176103728 20:63376046-63376068 GGGGTGTGGGGGTGGTGGGGTGG - Intronic
1176125539 20:63472996-63473018 GGGGAGTGGGGGAGGGGGAGGGG + Intergenic
1176151804 20:63595279-63595301 GGGGTGGGAGGGAGGGGGCCGGG + Intronic
1176285016 21:5014786-5014808 GGTGTGCAAGGGAGGTGGGGAGG - Intergenic
1177993240 21:28063906-28063928 GGAGTGCGAAGGAGGTGGCACGG - Intergenic
1178631662 21:34266402-34266424 GGGCAGGGAGGGAGGTGGGGTGG - Intergenic
1179008850 21:37537652-37537674 GGGTTCTGAGGCAGGTGGCAAGG + Intergenic
1179161834 21:38905676-38905698 GGGGTGTGCGGGAGGTGGGAGGG - Intergenic
1179330427 21:40395900-40395922 GGGCTGTGAGGGCCGTGGCAGGG - Intronic
1179403083 21:41102386-41102408 GGTGGGGGAGGGAGGTTGCGGGG + Intergenic
1179411505 21:41167211-41167233 GGGGTGGGGGGAAGGTGGCTGGG + Intergenic
1179452194 21:41474573-41474595 GAGGGGTGAGTGAGGGGGCGAGG + Intronic
1179452202 21:41474593-41474615 AGGGGGTGAGTGAGGGGGCGAGG + Intronic
1179452224 21:41474647-41474669 GAGGGGTGAGTGAGGGGGCGAGG + Intronic
1179452545 21:41475670-41475692 AGGGGGTGAGTGAGGGGGCGAGG + Intronic
1179872165 21:44248689-44248711 GGTGTGCAAGGGAGGTGGGGAGG + Intronic
1179901393 21:44396312-44396334 GGGGTGTGGAGGATGTGGAGGGG + Intronic
1179915374 21:44474264-44474286 CAGCTGTGAGGGAGGAGGCGAGG + Intergenic
1180025981 21:45162373-45162395 GGTGTGTGAGTGAGTGGGCGTGG - Intronic
1180037368 21:45256741-45256763 GGGGTGCCAGGGAGGTGGAGTGG - Intergenic
1180049395 21:45324418-45324440 GGAGTGGGAGGGAGGTGAGGGGG + Intergenic
1180081576 21:45489959-45489981 AGGGTGTGGGGGAGGAGGTGTGG - Intronic
1180081595 21:45490000-45490022 AGGGTGTGGGGGAGGAGGTGTGG - Intronic
1180081614 21:45490041-45490063 GGGGAGTGGGGGAGGAGGTGTGG - Intronic
1180312723 22:11252959-11252981 GTGGTGGGAGGGGGGTGGTGGGG + Intergenic
1180341716 22:11625784-11625806 GGGGTGTGGGCGGGGTGGGGGGG - Intergenic
1180599668 22:17007859-17007881 GGGGCGTGGGGGAGGCGGCCTGG - Intronic
1180791639 22:18578143-18578165 GGGGTGCGCGGGAGGAGACGGGG + Intergenic
1180870646 22:19144869-19144891 GGGGTGCTGTGGAGGTGGCGGGG + Intergenic
1180880806 22:19202409-19202431 GGGTGGTGCGGGAGGTGCCGTGG - Intronic
1180880818 22:19202445-19202467 GGGTGGTGCGGGAGGTGCCGTGG - Intronic
1181022356 22:20110100-20110122 GACGTGTGAGGGAGGTGGCACGG + Exonic
1181166890 22:20988764-20988786 GGAGTGTGAGGGAAGAGGGGAGG - Intronic
1181230099 22:21417166-21417188 GGGGTGCGCGGGAGGAGCCGGGG - Intergenic
1181248550 22:21517700-21517722 GGGGTGCGCGGGAGGAGCCGGGG + Intergenic
1181272914 22:21670857-21670879 GGTGAGAGAGGGAGGTGGCCAGG + Intronic
1181487214 22:23238872-23238894 GGGGTGGGGGGCAGGTGGCGGGG + Intronic
1181538685 22:23561307-23561329 GGCTTTTGAGGGAGGTGGGGGGG - Intergenic
1181737797 22:24895307-24895329 GGAGTGGGTGGGAGGGGGCGAGG - Intronic
1181792507 22:25278662-25278684 GGGGTGAGGGGGAGGGGGAGAGG + Intergenic
1182109094 22:27710371-27710393 GGGGTGTGAGGGAGGTCTGAAGG + Intergenic
1182532151 22:30969016-30969038 GGGGAGTGTGCGAGGTGGCCGGG - Intergenic
1182567906 22:31213255-31213277 GGGTGGTGTGTGAGGTGGCGGGG - Intronic
1183035721 22:35139593-35139615 GGGGTGTGAGGGAGTTGGGCTGG - Intergenic
1183284747 22:36954806-36954828 GAGGTGTGACGGAAGTGGAGAGG - Intergenic
1183349096 22:37324836-37324858 GCGGTGCGGGGGAGGGGGCGTGG - Intergenic
1183356244 22:37361374-37361396 GGGGTGGGAGGAAGGTGGGATGG - Intergenic
1183380338 22:37487485-37487507 GGGCTGGGAAGGAGGCGGCGAGG - Intergenic
1183385469 22:37511647-37511669 GGGGTGTGAGGGGAGAGGAGAGG + Intronic
1183590387 22:38776328-38776350 GGGGTGAGATGGGGGTGGGGAGG - Intronic
1183639339 22:39083640-39083662 GGGGTGCAAGGGAGGAAGCGTGG + Intronic
1183697546 22:39431679-39431701 GGGGAGTGAGGGAGTGAGCGAGG - Exonic
1183865081 22:40697983-40698005 AGACTGTGAGGGAGGTGACGGGG + Intergenic
1183934927 22:41256656-41256678 GGGGTCTGTGGGTGGTGGGGCGG - Intronic
1183990492 22:41594340-41594362 GGGGGGTGGGGGAGGCGGTGGGG + Intergenic
1183990504 22:41594360-41594382 GGGGGGTGGGGGAGGCGGTGGGG + Intergenic
1183990518 22:41594380-41594402 GGGGGGTGGGGGTGGGGGCGGGG + Intergenic
1184230631 22:43156535-43156557 GGGGTGGGAGGGAGGGGGAGGGG + Intronic
1184301242 22:43562508-43562530 GGGGTGGGAGGGAGGCAGCCCGG + Intronic
1184301284 22:43562613-43562635 GGGGTGGGAGGGAGGCAGCCTGG + Intronic
1184301294 22:43562639-43562661 GGGGTGGGAGGGAGGCAGCCCGG + Intronic
1184301317 22:43562692-43562714 GGGGTGGGAGGGAGGCAGCCTGG + Intronic
1184301327 22:43562718-43562740 GGGGTGGGAGGGAGGCAGCCCGG + Intronic
1184301350 22:43562771-43562793 GGGGTGGGAGGGAGGCAGCCTGG + Intronic
1184301360 22:43562797-43562819 GGGGTGGGAGGGAGGCAGCCCGG + Intronic
1184403684 22:44287922-44287944 GGGGGCTGAGGGAGGAGACGGGG + Intronic
1184561631 22:45267240-45267262 GGGGTGGGATGGGGGTGGGGTGG + Intergenic
1184561876 22:45268459-45268481 GGGGTGAGCGGGTGGAGGCGGGG - Intergenic
1184614596 22:45629629-45629651 GAGGTGGCAGGGAGGGGGCGGGG - Intergenic
1184888652 22:47366216-47366238 GGGGTGTGGGGAAGGCGGTGGGG + Intergenic
1184935688 22:47718718-47718740 AGGGTGGGAGGGAGGAGGCTGGG - Intergenic
1184980067 22:48089604-48089626 GGGGTGGGAGGCAGGCGGGGTGG + Intergenic
1185166130 22:49263450-49263472 GGGGTGGGAGGGCGGCGGTGCGG - Intergenic
1185246850 22:49777255-49777277 GGGGTGTCAGGCAGGATGCGTGG - Intronic
1185276450 22:49952009-49952031 TGGGTGGGAGGGAGGTGGGCTGG - Intergenic
1185369955 22:50456449-50456471 GGGGGGTGAGGGTGGGGGCTCGG - Intronic
949090894 3:27798-27820 GGGGTGGGAGGGTGGTGGTGAGG - Intergenic
949561909 3:5210881-5210903 AGGGTGTGGGCGTGGTGGCGGGG - Intronic
950012061 3:9731225-9731247 GGGGCTTGTGGGAGGGGGCGGGG - Intergenic
950129446 3:10531983-10532005 GGGGTGCCAGGGTGGTGGGGCGG - Intronic
950264591 3:11564665-11564687 GGTGAGGGAGGGAGGTGGTGAGG - Intronic
950264597 3:11564681-11564703 GGTGAGGGAGGGAGGTGGTGAGG - Intronic
950454204 3:13082994-13083016 CGACTGTGAGGGAGCTGGCGGGG - Intergenic
950509863 3:13419780-13419802 GGGTTGTGCGGGAGGAGGGGTGG - Intronic
950643951 3:14366095-14366117 CGGGGGTGAGGGTGCTGGCGTGG + Intergenic
950689295 3:14642927-14642949 GGGATGTGAGGTAGGAGGGGTGG - Intergenic
950729812 3:14947719-14947741 GAGGTGGGAGCGGGGTGGCGGGG - Intronic
950773128 3:15328134-15328156 AGGGTGTGAGGGGGGTGGCCAGG - Intronic
950896442 3:16455952-16455974 GCGGTGGGAGGGAGGTGTCGGGG - Intronic
951096317 3:18635156-18635178 GGGTGGGGAGGGAGGAGGCGAGG + Intergenic
951473427 3:23080020-23080042 AGAGTGTGGGGGAGGAGGCGTGG + Intergenic
951867653 3:27325626-27325648 GGAGTGTGAGTGGGGTGGGGTGG - Intronic
952211254 3:31231284-31231306 GGGGTGGGGGGGAGGCGGGGCGG + Intergenic
952430454 3:33218662-33218684 TGAGTGTGCGGGAGGCGGCGGGG - Intronic
952788335 3:37176919-37176941 GAGGTGTGGGGGGGGGGGCGGGG + Intronic
952839322 3:37630831-37630853 GGGGAGTGAGGGAGGACACGTGG + Intronic
952849049 3:37712817-37712839 GGGTTGGGAGTGAGGTGGAGTGG + Intronic
952867024 3:37861521-37861543 GGGGTGTGAGAGATGTGGGGAGG - Intergenic
953003686 3:38957992-38958014 GAGGAGGGAGGGAGGTGGCCTGG + Intergenic
953193781 3:40713325-40713347 GGGGTATGAGGGAGGCTGCATGG - Intergenic
953397095 3:42581991-42582013 GGGGTAGGGGGGAGGTGGGGTGG - Intronic
953922150 3:46959699-46959721 GGGGGGACAGGGAGGTGGCAAGG + Intronic
954133717 3:48572572-48572594 GGGGTGGCAGGGTGGGGGCGGGG - Intronic
954268614 3:49489889-49489911 GGGGTTTGAGGTAAGTGGGGTGG + Intronic
954329330 3:49881136-49881158 GGGGTGGGAGGGAGGTGGCAAGG + Intergenic
954414658 3:50387337-50387359 GCAGTGTGAGGCAGGTGGTGAGG - Intronic
954592452 3:51794469-51794491 GGGGTGGGGGAGTGGTGGCGGGG - Intergenic
954938966 3:54353579-54353601 TGGGTGGCAGGGAGGGGGCGCGG - Intronic
955060697 3:55489431-55489453 GGGGTGTGGGGGTGGAGGTGGGG - Intronic
955081362 3:55660465-55660487 GGGGTGGGGCGGGGGTGGCGTGG + Intronic
955238974 3:57163794-57163816 GGGGGGGGAAGGGGGTGGCGGGG + Intronic
955746546 3:62146413-62146435 GGGGTCTGAAGCAGGTGGCCTGG - Intronic
956172427 3:66443334-66443356 GGGGGATGAGTGAGGGGGCGGGG + Intronic
956321946 3:68007597-68007619 GGGGAGGGAGGGAGGTGGGGTGG - Intronic
957078773 3:75620301-75620323 GGGGAGGGAGGGAGGGGGAGCGG - Intergenic
957084461 3:75667718-75667740 GGGGAGGAAGGGAGGTGGGGGGG + Intergenic
957997215 3:87705868-87705890 GGAGTGAGAGTGAGGTGGGGAGG - Intergenic
958019419 3:87979062-87979084 GGGGAGGGAGGGAGGGGGGGAGG + Intergenic
958154926 3:89744393-89744415 GGGGTGTGAGGAAAATGGGGAGG - Intergenic
958699979 3:97576393-97576415 GGGATGTAAGGGAGGTGGCAAGG - Intronic
958933818 3:100236517-100236539 GGGGTATGAGGGAGATGTCTGGG + Intergenic
959358840 3:105366182-105366204 CGGGTGTGAGGGGAGTGGTGGGG + Intergenic
959358986 3:105366839-105366861 CGGGAGGGAGGGAGGAGGCGGGG + Intergenic
959993437 3:112654221-112654243 TGGGTGTGAGGGAGGGAGAGGGG + Intergenic
960266214 3:115624033-115624055 GGGGTGTGGGGGAGATGATGTGG + Intronic
960784593 3:121358241-121358263 GGGGGGTTAGGGAGGTGTTGCGG - Intronic
960993780 3:123328264-123328286 GAGGGGTGAGGAAGGTGGGGTGG - Intronic
961378591 3:126482850-126482872 GGGGAATGGGGGAGGAGGCGTGG - Intronic
961462736 3:127062984-127063006 GTGGTGTGGGGGTGGTGGTGGGG + Intergenic
961865951 3:129953685-129953707 GGAGTTTGAGGCAGGTGTCGTGG - Intergenic
962148840 3:132870892-132870914 GGGGGCTGAGGGAGGGGGTGAGG + Intergenic
962204457 3:133423547-133423569 GGGTGGTGGGGGAGGCGGCGGGG + Intronic
962736271 3:138328341-138328363 GGGGTGGGAGGGGTGTGGGGTGG - Intronic
962791072 3:138812193-138812215 AGGGTGGGAGGGAGGTGACTGGG + Intronic
962964001 3:140336921-140336943 GTGGTGTGGGGAAGGTGGGGCGG - Intronic
962991000 3:140577522-140577544 GGGATGTGAGGCTGGTGGCATGG + Intergenic
963451156 3:145482928-145482950 GGGGGCTGAGGGAAGTGGGGGGG - Intergenic
963522531 3:146373161-146373183 GGGTTGTGTGGGAGGGGGTGAGG - Intergenic
963692885 3:148526653-148526675 GGGCTGTGAGGGAAGTGGGTTGG + Intergenic
963906067 3:150774457-150774479 GGAGGGTGAGGAAGGTGGAGAGG + Intergenic
964289831 3:155165451-155165473 AGGGTATGATGGAGGTGGAGAGG + Intronic
964783453 3:160366901-160366923 GGGTTGTGAGGGAGGTGGGGTGG - Intronic
965765534 3:172126250-172126272 AGGGTGTGCGGGAGGAGGGGCGG + Intronic
966059149 3:175734079-175734101 GGGGTCTGAGGACGGTGGCGTGG + Intronic
966738868 3:183212950-183212972 GGGGGGTGGGGGGGGTGGGGGGG + Intronic
966905929 3:184525817-184525839 GGCGGGTGAGGGAGCTGGGGAGG + Intronic
967033636 3:185631459-185631481 GGGGAGGGAGGGAGGGGGAGGGG - Exonic
967191460 3:186988561-186988583 GGGGTGGGGGGGTGGTGGTGGGG + Intronic
967899984 3:194440062-194440084 AGGGAGGGAGGGAGGTGGGGAGG + Intronic
968084794 3:195869439-195869461 GGAGTGAGAGAGAGGGGGCGGGG + Intronic
968090929 3:195897811-195897833 GGGGTGGGGGGGGGGTGGGGGGG - Intronic
968382608 4:108796-108818 TGGGTGTGAGAGAGGAGGTGAGG - Intergenic
968403316 4:317094-317116 TGGGTGTGAGAGAGGAGGTGAGG + Intergenic
968452344 4:681504-681526 GGGGTCTGGGGGAGGTGCGGGGG - Intronic
968512923 4:1003239-1003261 GGTGTGGGTGGGAGGTGGAGCGG + Intronic
968521526 4:1036687-1036709 GGGGTGTGAAGGAAGGGGTGAGG - Intergenic
968613843 4:1568677-1568699 GGGGTGGGTGGGAGGCGGCGCGG - Intergenic
968613854 4:1568702-1568724 GGGGTGGGTGGGAGGCGGCGCGG - Intergenic
968862124 4:3180826-3180848 GGGGTGTGGTGGAGTTGGGGAGG + Intronic
968930003 4:3573694-3573716 GGGGTGTGAGGTGGGGGGAGGGG + Intergenic
968975974 4:3822235-3822257 GGGGCGTGTAGGAGGTTGCGGGG - Intergenic
969021853 4:4144269-4144291 GGGAAGGGAGGGAGGGGGCGCGG - Intergenic
969049694 4:4363924-4363946 GAGGAGTGGGGGAGGTGACGAGG - Intronic
969355229 4:6621121-6621143 GGGGTGAGAGGGAGGCTGGGAGG + Intronic
969469427 4:7378769-7378791 GTGGTCTGAGGGAGGTGGGCAGG - Intronic
969607777 4:8211135-8211157 GGGGGGAGAGGGAGGTAGAGGGG - Intronic
969632518 4:8346772-8346794 GGAGGGTGAGGTAGGTGGGGAGG + Intergenic
969732014 4:8963146-8963168 GGGAAGGGAGGGAGGGGGCGCGG + Intergenic
970171427 4:13294993-13295015 AGGGTGAGAGGGAGGAGGGGAGG - Intergenic
970223804 4:13836661-13836683 GGGGTGAGAGGCAGATGGAGGGG + Intergenic
970445010 4:16116133-16116155 GGGGAGTGAGGGAGCTGTGGAGG - Intergenic
970548367 4:17153471-17153493 AGGTTGTGGGGTAGGTGGCGGGG + Intergenic
971111672 4:23592358-23592380 GGGGAGGGAGGGAGGGGGAGGGG - Intergenic
971368479 4:25995996-25996018 CAGGTGTAAGGGAGGAGGCGAGG - Intergenic
972973106 4:44601860-44601882 GGTGTGTGTGGGTGGTGGGGAGG - Intergenic
974003207 4:56531028-56531050 CGGGTGTGGCGGAGCTGGCGGGG - Exonic
974767974 4:66372640-66372662 GGGGTGTGTGGGGGGTGGGGCGG - Intergenic
975779156 4:77820294-77820316 GGGGTGAGGGGAAGGAGGCGGGG + Intergenic
975934858 4:79566770-79566792 GGGGTTTGAGGATGGTGGGGAGG + Intergenic
977481160 4:97577583-97577605 GGGGAGTGAGGGAGGTGGTAAGG + Intronic
978457020 4:108905854-108905876 GGGGGGTGCGGGGGGAGGCGTGG + Intronic
979956688 4:126961864-126961886 TGGGTGTGAGGAAAGTGGTGAGG - Intergenic
980328420 4:131379357-131379379 GAGGTGTGGAGGAGGAGGCGCGG + Intergenic
980447743 4:132932831-132932853 GGGTTGTGGGGGAGGTGGGATGG + Intergenic
981171027 4:141623602-141623624 GGGGTGGGGGGTAGGTGGGGAGG - Intergenic
981937338 4:150251145-150251167 GGGGTGTGGGGGATGTGTGGGGG - Intronic
981937378 4:150251236-150251258 GGGGTGTGGGGGATGTGTGGGGG - Intronic
982722927 4:158877931-158877953 GGGGGGTGGGGGAGGAGACGGGG - Intronic
983376195 4:166931322-166931344 GGTGTGTGTGGGGGGTGGGGGGG + Intronic
983535841 4:168855991-168856013 GGGGAGAGAAGGAGGTGGGGAGG - Intronic
983998476 4:174213857-174213879 GGGGTGTGAGGACGGTGACCGGG - Intergenic
984786756 4:183574273-183574295 TGGGTGTGAGGGAGGTCAGGAGG + Intergenic
984825809 4:183923797-183923819 GGGCTGTGAGGGGTGTGGCATGG + Intronic
985578151 5:683219-683241 CGGGTGCGAGGGAGATGGGGAGG - Intronic
985965400 5:3335693-3335715 GGGGTGTGTGGGAGGGTGGGAGG - Intergenic
986298047 5:6455822-6455844 GGAGTGTGAGCCAGGTGGGGTGG - Intronic
986338883 5:6773896-6773918 GGGGTGTGAGGGAGCGGCGGGGG - Intergenic
986338891 5:6773916-6773938 GGGGTGTGAGGGAGCGGCGGGGG - Intergenic
986338912 5:6773978-6774000 GGGGTGTGAGGGAGCGGCGGGGG - Intergenic
986338959 5:6774102-6774124 GGGGTGTGAGGGAGCGGCGGGGG - Intergenic
986338967 5:6774122-6774144 GGGGTGTGAGGGAGCGGCGGGGG - Intergenic
986339038 5:6774315-6774337 GGGGTGTGAGGGAGCGGCGGGGG - Intergenic
986516991 5:8574588-8574610 GGGGAGTCAGGGAGGAGGGGTGG + Intergenic
986624709 5:9712917-9712939 GTGGTGTGAGGAAGGTGGGAGGG - Intergenic
986731167 5:10636044-10636066 GGGATGGGAGAGAGGTGGCAAGG - Intronic
987075726 5:14380266-14380288 GGGGCGCGAAGGAGGAGGCGGGG - Intronic
987075732 5:14380285-14380307 GGGGCGCGAAGGAGGAGGCGGGG - Intronic
987075738 5:14380304-14380326 GGGGCGCGAAGGAGGAGGCGGGG - Intronic
987374095 5:17218048-17218070 GAGGGGTGAGGGGGGCGGCGAGG + Intronic
988421870 5:31015564-31015586 GGGGTGGGGGGGCGGGGGCGAGG + Intergenic
989673117 5:43942911-43942933 GGGGTGTGGGGGAAGAGGTGAGG + Intergenic
989717553 5:44482086-44482108 GGTGTCTGTGGGAGGTGGTGGGG + Intergenic
989963246 5:50440707-50440729 GGGGTGTGTGGGTGGTTGCAGGG - Intronic
990174369 5:53090766-53090788 GGGGGGTGGGGGAGGTGCGGGGG + Exonic
990255689 5:53966330-53966352 GAGGTATGAGGGAAGGGGCGTGG - Intronic
990485901 5:56258846-56258868 GGGGAGAGAGGGAGGGGGAGGGG + Intergenic
991396261 5:66208221-66208243 GGAGGGTGAGGCAGGTGGGGAGG + Intergenic
991932332 5:71765966-71765988 GCGGTGAGAAGGAGGTGGTGTGG + Intergenic
992215132 5:74518388-74518410 GGGTTGGGAGGGGGGTGGTGTGG + Intergenic
992558639 5:77928471-77928493 GGGGGGAGAGGGAGGTAGAGAGG + Intergenic
992567212 5:78009775-78009797 GGGGGGTGGGGGAGGGGGAGAGG + Intronic
992636068 5:78726999-78727021 GGGGGGTGAGGGAGGAGTGGTGG + Intronic
992674516 5:79092329-79092351 GGGGATTGAGGGAGGTGGGGAGG - Intronic
992801846 5:80301567-80301589 GGGCCGGGAGGGAGGTGGGGCGG + Intergenic
992814825 5:80426438-80426460 GGGGTGGGGGGGTGGTGGTGAGG - Intronic
993022862 5:82612590-82612612 GGGGTGGGAGGGTGGTGGAGAGG + Intergenic
993457376 5:88141750-88141772 GGGGGGTGGGGGCGGGGGCGGGG - Intergenic
993851466 5:93015362-93015384 GGGGTGGGGGGGCCGTGGCGGGG + Intergenic
993901140 5:93584908-93584930 GGGGGGAGGGGGAGGGGGCGGGG - Exonic
995151992 5:108859340-108859362 GGGGGGTGAGGCAGGGGTCGGGG - Intronic
995735405 5:115295715-115295737 GGGGTGCGAGGGAGGGTGAGGGG + Intronic
995991207 5:118241857-118241879 GGGGTGTGTGGCAGGGGGCAAGG - Intergenic
996132007 5:119793075-119793097 GGGGAGTTATGGAGGTGGAGGGG + Intergenic
997108586 5:131048849-131048871 GGGGTGTGTCGGGGGTGGAGAGG + Intergenic
997874737 5:137537756-137537778 CGTCTGGGAGGGAGGTGGCGGGG - Intronic
997874785 5:137537883-137537905 CGGGAGGGAGGGAGGTGGGGGGG - Intronic
998077229 5:139246599-139246621 TGAAAGTGAGGGAGGTGGCGGGG - Intronic
998375000 5:141684678-141684700 GGGGTCTGAGGGAGGAAGCCAGG - Intergenic
998531956 5:142893261-142893283 GGGGTGGGAGTCAGGTGCCGTGG - Intronic
998822457 5:146068992-146069014 TGGTTGTGAGGGAGGTTGTGGGG - Intronic
999129836 5:149273802-149273824 GGGGAGTGGGGGTGGTGGAGAGG - Intronic
999279448 5:150355460-150355482 GGGGCGGGTGGTAGGTGGCGGGG - Intergenic
999652169 5:153778121-153778143 TGGGAGTGAGGGAGGTTGGGAGG + Intronic
1000073208 5:157760735-157760757 GGGGTGGGAGAGAGGAGGCAGGG + Intergenic
1000570854 5:162912204-162912226 GGGGATTGAGGGAGGAGGAGAGG - Intergenic
1001091637 5:168746326-168746348 GGTGTGTGAGTGTGGTGGTGTGG + Intronic
1001091644 5:168746365-168746387 GGTGTGTGAGTGTGGTGGTGTGG + Intronic
1001091669 5:168746502-168746524 GGTGTGTGAGTGTGGTGGCGTGG + Intronic
1001091686 5:168746583-168746605 GGTGTGTGAGTGTGGTGGTGTGG + Intronic
1001091725 5:168746776-168746798 GGTGTGTGAGTGTGGTGGTGTGG + Intronic
1001091732 5:168746813-168746835 GGTGTGTGAGTGTGGTGGTGTGG + Intronic
1001091739 5:168746850-168746872 GGTGTGTGAGTGTGGTGGTGTGG + Intronic
1001091748 5:168746897-168746919 GGTGTGTGAGTGTGGTGGTGTGG + Intronic
1001091755 5:168746934-168746956 GGTGTGTGAGTGTGGTGGTGTGG + Intronic
1001342590 5:170861822-170861844 GGGCTGGGAGGGACGGGGCGGGG - Intergenic
1001342600 5:170861842-170861864 GGGCTGGGAGGGACGGGGCGGGG - Intergenic
1001897201 5:175392683-175392705 GTGCTGTGATGGAGGTGGGGTGG - Intergenic
1001897213 5:175392716-175392738 GTGCTGTGATGGAGGTGGGGTGG - Intergenic
1001897225 5:175392749-175392771 GTGCTGTGATGGAGGTGGGGTGG - Intergenic
1001897237 5:175392782-175392804 GTGCTGTGATGGAGGTGGGGTGG - Intergenic
1001897249 5:175392815-175392837 GTGCTGTGATGGAGGTGGGGTGG - Intergenic
1001897261 5:175392848-175392870 GTGCTGTGATGGAGGTGGGGTGG - Intergenic
1001897273 5:175392881-175392903 GTGCTGTGATGGAGGTGGGGTGG - Intergenic
1001897285 5:175392914-175392936 GTGCTGTGATGGAGGTGGGGTGG - Intergenic
1001897297 5:175392947-175392969 GTGCTGTGATGGAGGTGGGGTGG - Intergenic
1001897309 5:175392980-175393002 GTGCTGTGATGGAGGTGGGGTGG - Intergenic
1001897321 5:175393013-175393035 GTGCTGTGATGGAGGTGGGGTGG - Intergenic
1001897333 5:175393046-175393068 GTGCTGTGATGGAGGTGGGGTGG - Intergenic
1001897345 5:175393079-175393101 GTGCTGTGATGGAGGTGGGGTGG - Intergenic
1001897357 5:175393112-175393134 GTGCTGTGATGGAGGTGGGGTGG - Intergenic
1001897369 5:175393145-175393167 GTGCTGTGATGGAGGTGGGGTGG - Intergenic
1001897379 5:175393178-175393200 GTGCTGTGATGGAGGTGGGGTGG - Intergenic
1001897393 5:175393213-175393235 GTGCTGTGATGGAGGTGGGGTGG - Intergenic
1001897404 5:175393247-175393269 GTGCTGTGATGGAGGTGGGGTGG - Intergenic
1001960684 5:175878875-175878897 GGGGTGGGAAGGAGAGGGCGGGG - Intronic
1002060310 5:176621728-176621750 GGGATGAGTGGAAGGTGGCGGGG - Intronic
1002375173 5:178783648-178783670 AGAGTGTGAGGGGGGTGGCAAGG + Intergenic
1002415096 5:179116253-179116275 GGGGTGGGGGGGGGGTGCCGTGG - Intronic
1002569306 5:180130978-180131000 GGGGCATGAGGGAGAGGGCGGGG - Intronic
1002782652 6:379380-379402 GGGGTGTGCGGGTGGAGGGGCGG - Intergenic
1002930552 6:1631643-1631665 GGGGAGTGAGGGAGGGAGGGAGG - Intronic
1003146825 6:3516682-3516704 GGGGAGTGGGGGAGATGACGGGG - Intergenic
1003146899 6:3516920-3516942 GGGGAGTGGGGGAGATGACGGGG - Intergenic
1003147002 6:3517239-3517261 GGGGAGTGGGGGAGATGACGGGG - Intergenic
1003153747 6:3573995-3574017 AGGGTGTGAAGGAGGTGACGAGG + Intergenic
1003175895 6:3751969-3751991 GGGCCGCGAGGGAGGAGGCGCGG - Exonic
1003181830 6:3798694-3798716 GGGGTGGGAAGGAAGTGGCCTGG - Intergenic
1003197245 6:3925970-3925992 GGGGTGGGAGGGAGAAGGAGAGG + Intergenic
1004020849 6:11774625-11774647 GGGGTGTCAGGGGCGTGGGGAGG + Intronic
1004193728 6:13486601-13486623 GGGGTGGGACGGAGGATGCGGGG + Intronic
1004278229 6:14256899-14256921 GAGGTGTGCGGGAAGGGGCGTGG + Intergenic
1004356621 6:14934797-14934819 GGGGTTTGTGGGAGGTGTGGTGG - Intergenic
1004367145 6:15022006-15022028 GGGGTGAGAGGGAGAGGGAGGGG - Intergenic
1004819170 6:19348098-19348120 GGGGTGGAGGGGAGGTGGGGTGG - Intergenic
1004864364 6:19838234-19838256 GGGATGGGAGGTTGGTGGCGTGG + Intronic
1005048968 6:21666355-21666377 GCGGGGAGAGGGAGGGGGCGGGG + Intergenic
1005063384 6:21797066-21797088 GGGGAGAGAGGGAGATGGGGGGG - Intergenic
1005063457 6:21797246-21797268 CGGGAGAGAGGGAGGTGGGGGGG - Intergenic
1005840633 6:29742656-29742678 TGGGTGTGAGGGCAGTGGCCTGG - Intergenic
1005854922 6:29853296-29853318 GGGCTGTGAGGGCAGTGGCTTGG - Intergenic
1005923174 6:30418371-30418393 GGGCTGTGAGGGCAGTGGCCTGG + Intergenic
1006104751 6:31709981-31710003 GGGATGGGAGGGAGGTAGTGAGG - Intronic
1006131194 6:31870512-31870534 GGGGTGCTAGAGAGGTGGCAGGG - Intronic
1006187027 6:32187254-32187276 GGGGTGTCGGGGAGCTGGTGCGG + Exonic
1006334786 6:33414910-33414932 GGGGTGTCCGGGAGGGGGCTGGG + Intronic
1006376234 6:33673148-33673170 GGCCTGTGAGGGAGGAGGAGAGG - Intronic
1006461816 6:34163730-34163752 GTGGTTGGAGGGAGGAGGCGCGG - Intergenic
1006466408 6:34197165-34197187 GGCGTGTCGGGGAGGTGGGGGGG - Intergenic
1006925719 6:37654235-37654257 GGGGTGGGAGGGAAGTTGTGAGG - Intronic
1007210181 6:40187399-40187421 GGGGTGAGGGGGTGGTGGTGGGG + Intergenic
1007231301 6:40349298-40349320 GCGGGGTGTGGGAGGTGCCGGGG - Intergenic
1007521644 6:42454644-42454666 GTGCTGGGAGGGAGGTGGAGGGG - Intergenic
1007697793 6:43744640-43744662 GGGGTGTGAGGGAGGAAGGCCGG + Intergenic
1007752200 6:44077271-44077293 GGGGTGTGGGGGTGGGGGCACGG - Intergenic
1007837247 6:44683154-44683176 GGGGAGAGATGGAAGTGGCGAGG - Intergenic
1008427756 6:51379389-51379411 AGGGAGGGAGGGAGGGGGCGGGG + Intergenic
1009000479 6:57707043-57707065 GGGGGGTGAGGGAGAAGGCATGG - Intergenic
1009166201 6:60344858-60344880 GTGGGGTGAGGGAAGTGGGGAGG - Intergenic
1009522799 6:64705828-64705850 GGGGTGGGAGGGAGGGGGGAGGG + Intronic
1010134915 6:72540416-72540438 GGGGTGGGGGGGTGGGGGCGGGG - Intergenic
1010196480 6:73244675-73244697 GGGGTTTGGGGGAGGTGGGCGGG + Intronic
1011698610 6:89935086-89935108 CGGGTGTGTGGGAGACGGCGTGG + Intronic
1012428383 6:99139812-99139834 TGGGTGTGAGAGAGGCGGGGGGG - Intergenic
1012498794 6:99865272-99865294 TTGGTGTGAGGGATGGGGCGGGG + Intergenic
1013219352 6:108063678-108063700 GTGGTGTGTGGCAGGCGGCGGGG - Intronic
1013239400 6:108229422-108229444 GGGGAGGGAGGGAGGGGGAGAGG - Intronic
1013363966 6:109421131-109421153 GGTGTGGGAGGGAGGGGGCAAGG - Intronic
1013369310 6:109455776-109455798 CGGGTGGGAGGGCGGGGGCGGGG + Exonic
1013610356 6:111788870-111788892 TGGGTGGGAGGGAGGTGGGAGGG + Intronic
1013692452 6:112661895-112661917 GGAGTGTGGGTGTGGTGGCGGGG + Intergenic
1013793016 6:113857590-113857612 GGGGGGTGGGGGTGGTGGAGAGG - Exonic
1013836437 6:114341638-114341660 GGGCTGTGAGGGGTGTGGGGGGG + Intronic
1014551876 6:122798464-122798486 GGGCTGGGAGGGAGGTGTGGTGG - Intronic
1014771279 6:125460014-125460036 GGAGTGAGAGTGAGGTGGGGAGG + Intergenic
1014935458 6:127380436-127380458 TGGGTGTGGGGGAGGGGGTGGGG - Intergenic
1015126692 6:129763148-129763170 AGGGTGTGGGGGAGATGGGGAGG - Intergenic
1015199952 6:130568170-130568192 GGGTAGTGAGGTAGGTGGGGTGG - Intergenic
1016163255 6:140907803-140907825 GGAGGGTGAGTGAGGTGGAGAGG + Intergenic
1016554619 6:145322670-145322692 GTGGGGTGAGGGAGGTGGGAGGG - Intergenic
1016756290 6:147690996-147691018 GGGGTGTGGGGGTGGTGGGATGG + Intronic
1016923393 6:149317641-149317663 GGGGGCAGAGGGAGGTGGGGAGG + Intronic
1016940735 6:149481190-149481212 GGGGAGGGATGGAGGTGGCTGGG - Intronic
1017048982 6:150372697-150372719 GGGGTGTGTTGGGGGTGGTGAGG + Intronic
1017071643 6:150580333-150580355 GGGGTGGGTGGGAGCTGGGGAGG - Intergenic
1017087780 6:150730335-150730357 GGGGTGTGGGGGTGGGGGAGTGG + Intronic
1017289248 6:152716046-152716068 GGGGTGTGAGGGATATGGCAAGG + Intronic
1017824478 6:158071382-158071404 GGGGTGTGGGGGAGATGTCCAGG + Intronic
1018030018 6:159834334-159834356 GGGGGGTGAGGGAGGGGTGGGGG - Intergenic
1018091253 6:160348309-160348331 GGCGAGTGAGGCGGGTGGCGCGG + Exonic
1018123488 6:160659562-160659584 GAGGTGTCAGGGAAGTGGCCAGG + Intronic
1018298275 6:162372562-162372584 GGGGAGTGAGGGAGGAGGGAGGG + Intronic
1018651530 6:165995762-165995784 GGGGTGGGAGGGAGATGGAGTGG - Intergenic
1019196585 6:170286772-170286794 GGGGTGTGTGTGAGGAGGTGGGG - Intronic
1019313949 7:376113-376135 GGGGTGTGAGGACGGAGGAGAGG + Intergenic
1019413138 7:915321-915343 TGGGTGTGAGGATGGTGGGGAGG - Intronic
1019718673 7:2555096-2555118 GGGGGGAGAGGGGGGCGGCGGGG + Intronic
1020014069 7:4820865-4820887 GTGGTGAGAGGGAGGTGGCGGGG - Intronic
1020235681 7:6353530-6353552 GAGGTGGGAGGGAGGGAGCGAGG + Intergenic
1020309274 7:6856299-6856321 GGGAAGGGAGGGAGGGGGCGCGG - Intergenic
1020331118 7:7017823-7017845 GGGTTGTGGGGGAGGTGGGGTGG - Intergenic
1020816930 7:12917199-12917221 GGTGAGGGAGGGAGGTGGTGAGG - Intergenic
1021006073 7:15396616-15396638 GATGTGTGGGGGAGGGGGCGGGG - Intronic
1021983606 7:26078476-26078498 GAGATGTGGGGGAGGTGGGGAGG - Intergenic
1022020676 7:26397616-26397638 AGGGGGTGAGGGAGGGGGTGAGG + Intergenic
1022020682 7:26397628-26397650 AGGGGGTGAGGGAGGGGGTGAGG + Intergenic
1022020688 7:26397640-26397662 AGGGGGTGAGGGAGGGGGTGAGG + Intergenic
1022020696 7:26397652-26397674 AGGGGGTGAGGGTGGGGGCGGGG + Intergenic
1022133516 7:27425608-27425630 GGGGTCTGAGGGATGTGGATGGG + Intergenic
1022338258 7:29443741-29443763 GGGGTGAGAGAGAGATGGCAGGG + Intronic
1022343339 7:29488682-29488704 GGGGTCAGGGGGAGGTGGGGGGG - Intronic
1022487264 7:30789254-30789276 GTGGTGTGAGGGAGATGGCTTGG + Intronic
1022517264 7:30983986-30984008 GGGGTCTGGGGCAGGGGGCGGGG - Intronic
1022815048 7:33905439-33905461 GGGGTGTGAGGGAGGGCGGGGGG - Intronic
1023038653 7:36153787-36153809 GGAGCGTGGGGGAGGTGGAGTGG + Intronic
1023160615 7:37292774-37292796 TGGGAGGGAGGGAGGTGGGGGGG + Intronic
1024257546 7:47549917-47549939 GGGGTGGGAGGGCGGGGACGTGG - Intronic
1024291425 7:47807374-47807396 GGGGTGAGAGGGAGGTTGTGGGG + Intronic
1024458234 7:49632781-49632803 GGTGGGTGAGGGAGGTGGGTGGG - Intergenic
1024744859 7:52394292-52394314 GGGGAAAGAGGGAGGGGGCGAGG - Intergenic
1024872612 7:53983526-53983548 GGGGGGTGGGGGAGGGGGTGTGG + Intergenic
1024905269 7:54372135-54372157 GGGGTGCTAGGCAGGTGACGGGG - Intergenic
1026360697 7:69599071-69599093 GGCGTGTGTGAGAGGCGGCGGGG + Intronic
1026621530 7:71953852-71953874 GGGGGGTGAGGGAGGCAGCTAGG + Intronic
1026738803 7:72965734-72965756 GGGGAGTGAGGGTGCAGGCGGGG - Intronic
1026995382 7:74612584-74612606 GGTGAGTGGGGGAGGTGGCCTGG - Intergenic
1027025790 7:74851164-74851186 GAGGTGTGAGGGTGGGGGCGGGG - Intronic
1027061971 7:75092955-75092977 GAGGTGTGAGGGTGGGGGCGGGG + Intronic
1027104931 7:75399335-75399357 GGGGAGTGAGGGTGCAGGCGGGG + Intronic
1027318318 7:76997692-76997714 GGGGTGTGTGGGGGGTGTGGAGG + Intergenic
1027370905 7:77508472-77508494 GGGCTGTGAGAGAGGGAGCGTGG + Intergenic
1028243780 7:88451922-88451944 GGGGAGGGAGGGAGGTGGGAGGG - Intergenic
1028290357 7:89057637-89057659 GGGGTGTGAGGGATGAAGAGAGG + Intronic
1028485564 7:91353663-91353685 GCGGGGTGGGGGAGGTGGAGGGG + Intergenic
1028567333 7:92246812-92246834 GGGGTGGGGGGGAGGCTGCGAGG - Intronic
1028883741 7:95909228-95909250 AGGGTGGGAGGGGGGTGGGGGGG + Intronic
1029526938 7:101100487-101100509 CGGGTCTGAGGGAGGAGGCTTGG - Intergenic
1029629939 7:101743879-101743901 GGGCTTTGGGGGAGGTGGCCTGG - Intergenic
1029665531 7:101992777-101992799 GGGGTTGGAGGGGGGCGGCGGGG - Intronic
1030059655 7:105612606-105612628 GGGGTGTGAGGGAGGGGGGCTGG - Intronic
1030123434 7:106133047-106133069 GGGGGGTTGGGGGGGTGGCGGGG + Intergenic
1030435184 7:109508941-109508963 GGGGTGGGGTGGAGGTGGTGGGG - Intergenic
1030706522 7:112698077-112698099 GGGGGGTGAGGGAGAGGGAGAGG + Intergenic
1031005663 7:116468104-116468126 TGGGTGGGAGAGAGGTGGCTGGG + Intronic
1031010784 7:116524554-116524576 GGGGGGTGGGGGAGGTGGGAAGG + Intergenic
1031101583 7:117486875-117486897 GGGGTGGGGGGGAGGGGGCGGGG + Intronic
1031171899 7:118302761-118302783 GGGGTGTGGGGGAGGGGGGAGGG - Intergenic
1031560408 7:123231398-123231420 GAGTTGTGGGGGAGGTGGGGGGG - Intergenic
1031797108 7:126188550-126188572 GGGGTGAGAGGGAAATGGGGAGG - Intergenic
1031830449 7:126619373-126619395 GTGGGGTGAGGGAAGTGGGGAGG + Intronic
1031972121 7:128072671-128072693 AGGGGCTGGGGGAGGTGGCGGGG - Intronic
1032409946 7:131687588-131687610 GGGTTGTGGGCGAGGTGGCAAGG - Intergenic
1032607050 7:133367006-133367028 TGGGTATGAGGGAGGAGGGGAGG + Intronic
1032728268 7:134612493-134612515 GGGGTCTTTGGGAGGTAGCGAGG + Intergenic
1033112553 7:138594358-138594380 GGTGTGAGAGGGAGATGGTGGGG - Intronic
1033220376 7:139523600-139523622 GGGCGGAGAGGGAGGAGGCGCGG - Intergenic
1034216088 7:149406851-149406873 GGGCTGGCAGGGAGGAGGCGGGG - Intergenic
1034402807 7:150876978-150877000 GGGGTGGTGGGGAGGAGGCGGGG - Intergenic
1034549141 7:151809266-151809288 GGGGTGTGTGGGAAGGGGCCGGG - Intronic
1034818193 7:154192808-154192830 GGTGTTTGAAGCAGGTGGCGGGG + Intronic
1034935017 7:155193429-155193451 GGGGTGGGAGGGATGAGGCTGGG - Intergenic
1035049357 7:155989764-155989786 GGGTTATGAGGGAGGGGGTGAGG + Intergenic
1035263105 7:157674168-157674190 GGGGAGGGAAGGAGGAGGCGGGG + Intronic
1035295106 7:157862802-157862824 GTGGTGTGCGGGAAGCGGCGAGG + Intronic
1035295114 7:157862840-157862862 GAGGTGTGCGGGAAGCGGCGAGG + Intronic
1035634488 8:1133998-1134020 GGGGCCTGTGGGAGGTGGAGGGG - Intergenic
1035683788 8:1508326-1508348 GGGGTTTGCGGGGGGTGGTGAGG - Intronic
1035743861 8:1947656-1947678 GGGGTGTGAGGATGGGGGCAGGG - Intronic
1035816293 8:2544790-2544812 GGCGTGTGTGGTACGTGGCGTGG + Intergenic
1036143252 8:6227526-6227548 GGGGTGTGAGGGGGGCAGCAGGG - Intergenic
1036165606 8:6429847-6429869 CAGGTGTGAGGGAGGGGTCGTGG - Intronic
1036756900 8:11476974-11476996 GGGGTGCCAGGGAGGAGGCAGGG + Intergenic
1037301116 8:17452973-17452995 GGGAAGTCAGGGAGGTGGGGAGG + Intergenic
1037448939 8:18997416-18997438 GGTGAGTGAGGGTGGTGGCTTGG - Intronic
1037674756 8:21043392-21043414 AAGGTGTGGGGGAGGTGGGGTGG - Intergenic
1037815166 8:22108218-22108240 GGGAGGTGAAGGAGGAGGCGGGG - Exonic
1037901855 8:22693221-22693243 GGCGTGTGCGGGGGGTGGGGTGG + Exonic
1037930610 8:22878059-22878081 GGGGGGTGTGGGAGGAGGTGGGG - Intronic
1038322430 8:26539822-26539844 TGGGTGTGAGGGTGTTGGCTGGG - Intronic
1038503460 8:28064099-28064121 GAGGTCTGAGGAAGCTGGCGTGG - Intronic
1039105339 8:33983619-33983641 GGGGTGGGTGGGGGGTGGTGTGG + Intergenic
1039270382 8:35874246-35874268 GACGGGAGAGGGAGGTGGCGGGG - Intergenic
1039400256 8:37263086-37263108 GTGGTTTGAGGGAGCTGGGGAGG + Intergenic
1039884851 8:41649040-41649062 GTGGTGTGTGGGATGTGGAGAGG + Intronic
1039946232 8:42131216-42131238 GGGGAGTGTGGGAAGTGGGGAGG - Intergenic
1040014492 8:42689759-42689781 GGGGTGGGGGGGAGGCGGGGTGG - Intergenic
1040014502 8:42689775-42689797 GGGGTGGGGGGGAGGCGGGGTGG - Intergenic
1040069086 8:43174895-43174917 GGGGAGGGAAGGAGGGGGCGTGG - Intronic
1040388819 8:46932764-46932786 CAGGTGGGAAGGAGGTGGCGAGG - Intergenic
1040426858 8:47297599-47297621 GTGGGGTGGGGGAGGTGGGGAGG - Intronic
1040552834 8:48451657-48451679 TGTGTGTGTGGGAGGTGGGGCGG + Intergenic
1040661574 8:49582250-49582272 GGGGTGGGGGGGCGGTGGGGTGG - Intergenic
1041514565 8:58686284-58686306 GGGGTGTGGGGGTGGGGGTGTGG - Intergenic
1041769285 8:61455814-61455836 GCAGAGTGTGGGAGGTGGCGGGG - Intronic
1044128709 8:88492322-88492344 GGGGTGGGAGGCAGGGGGAGGGG + Intergenic
1045737847 8:105318236-105318258 GGGGTGGGTGGGAGTTGGAGGGG - Intronic
1046097600 8:109579363-109579385 GGGGTGTGTGAAAGGTGGGGAGG - Intronic
1046148090 8:110188386-110188408 TGGGTTTGAGGGAGGTGGTAGGG + Intergenic
1046696370 8:117344256-117344278 GGGGTAAGAGGGATTTGGCGAGG - Intergenic
1046819909 8:118622614-118622636 GGGGTGTAGGGGAGGAGGAGTGG + Intergenic
1046838285 8:118827511-118827533 GGGGTGTTTGAGAGGTGGCTGGG + Intergenic
1047097653 8:121641487-121641509 GGGGGGTGAGGGAAGTGGAGAGG + Intergenic
1047363939 8:124195300-124195322 GGGATTTGAGGGAAGTGGCGGGG - Intergenic
1047594705 8:126366509-126366531 GTGGGGTGACGGGGGTGGCGGGG - Intergenic
1047749644 8:127870522-127870544 GGGGATTGAGGGAAGTGGAGCGG + Intergenic
1047755185 8:127912988-127913010 GGGGTGTGAAGGGGGTGGGTGGG - Intergenic
1049314615 8:141956935-141956957 GGGGTGTGGAGCAGGTGGAGGGG + Intergenic
1049361197 8:142213205-142213227 GGGGAGAGAGGGAGGCGGAGGGG - Intronic
1049411666 8:142476360-142476382 AGGCAGTGAGGGAGGTGGCGCGG + Intronic
1049468725 8:142765471-142765493 GGGGTGGGGAGGAGGTGGAGGGG + Intronic
1049476088 8:142797556-142797578 GGGGTGTGTGGGAGCTGGTCAGG + Intergenic
1049541396 8:143210761-143210783 GGGGCTTGAGGGAGGCTGCGTGG + Intergenic
1049545386 8:143228391-143228413 GGGGGGAGAGGGAGGCGGGGGGG + Intergenic
1049583952 8:143424460-143424482 GGGCTGGGAGAGAGGTGGCAAGG + Intronic
1049610484 8:143552798-143552820 GGGGGGATAGGGAGGTGGGGTGG + Intergenic
1049718904 8:144106684-144106706 GGGAGGTGGGGGAGGAGGCGGGG - Intronic
1049774176 8:144397060-144397082 GGGCTGTGAGGGAGATGGGGTGG + Intronic
1049826798 8:144674254-144674276 GGAGAGTGAGCGAGGTGGAGAGG + Intergenic
1050302570 9:4274479-4274501 AGGGTATGAGGAAGGTGGAGTGG - Intronic
1050388572 9:5113713-5113735 AGGGCGTGAGGGTGGTGGCTGGG - Intronic
1050901341 9:10952495-10952517 GGGGTGGGGGGAAGGGGGCGGGG + Intergenic
1051647525 9:19283695-19283717 GGGGTGGGGGTGAGGGGGCGCGG - Intronic
1052314845 9:27105704-27105726 GGAGGGTGGGGGAGGTGGTGAGG - Intergenic
1052854063 9:33396103-33396125 GGAGTTTGGGGAAGGTGGCGGGG + Intronic
1052996898 9:34555931-34555953 GGTGGGGGAGGGAGATGGCGGGG - Intronic
1052996912 9:34555963-34555985 GGTGAGGGAGGGAGATGGCGGGG - Intronic
1053142788 9:35691295-35691317 GGGGCGGTGGGGAGGTGGCGTGG + Intergenic
1053203354 9:36167114-36167136 GGGGGGTGAGGGGGGTTGGGGGG + Intergenic
1053423516 9:37996257-37996279 TGGGTGTGAGGGAAGGGGAGGGG - Intronic
1053433537 9:38059723-38059745 GGGGTGGTGTGGAGGTGGCGTGG - Intronic
1053682078 9:40492267-40492289 GGAGTTTGGGGAAGGTGGCGGGG + Intergenic
1053835484 9:42130120-42130142 GAGGTGGGAGGCAGGGGGCGGGG + Intergenic
1053874979 9:42534872-42534894 GGGGTGGGGGGGGCGTGGCGGGG + Intergenic
1053915115 9:42939941-42939963 GTGGTGTGAGGGTGGTGGGTGGG + Intergenic
1053932065 9:43120593-43120615 GGAGTTTGGGGAAGGTGGCGGGG + Intergenic
1054260919 9:62864468-62864490 GGGGGTTGGGGGCGGTGGCGGGG - Intergenic
1054281635 9:63132665-63132687 GGAGTTTGGGGAAGGTGGCGGGG - Intergenic
1054295175 9:63327764-63327786 GGAGTTTGGGGAAGGTGGCGGGG + Intergenic
1054393195 9:64632270-64632292 GGAGTTTGGGGAAGGTGGCGGGG + Intergenic
1054427844 9:65137480-65137502 GGAGTTTGGGGAAGGTGGCGGGG + Intergenic
1054460076 9:65458088-65458110 GGGGTGTGAGGCGGGTGGGAGGG - Intergenic
1054460197 9:65458464-65458486 GGGGTGTGAGGTGGGGGGAGGGG - Intergenic
1054502532 9:65884058-65884080 GGAGTTTGGGGAAGGTGGCGGGG - Intronic
1055497367 9:76868831-76868853 GGGGGGTGGGGGGGGGGGCGGGG + Intronic
1055689636 9:78815918-78815940 GGGGGGTGGGGGGGGTGGGGCGG - Intergenic
1055930165 9:81551959-81551981 GGGGGGTGAGGCTGGTGCCGAGG + Intergenic
1056122644 9:83504488-83504510 GGAATGTGAGGGAGGAGGAGAGG - Intronic
1056233313 9:84568717-84568739 GGCCTGAGAGGGAGGTGGGGAGG + Intergenic
1056305917 9:85289990-85290012 GGGGGGTGGGGGGGGTGGGGGGG + Intergenic
1056802352 9:89701478-89701500 GCGGTGGGTGGGAGGTGGAGGGG - Intergenic
1057117718 9:92541415-92541437 GGGGTGTGGGCGGGGTGGGGAGG - Intronic
1057117722 9:92541423-92541445 GGGGTGTGGGGGTGTGGGCGGGG - Intronic
1057195973 9:93115768-93115790 GAGGGGTGAGGGAGGGGGTGAGG + Intergenic
1057222302 9:93263812-93263834 GGGGTGTGGTGGGGGTGGGGGGG + Intronic
1057297833 9:93859761-93859783 TGGGTGTCAGTCAGGTGGCGGGG - Intergenic
1058270526 9:102967173-102967195 GGTGTGTGAGTGAGGGAGCGTGG + Intergenic
1058495731 9:105557501-105557523 GGGGTGTGGCGGGGGTGGGGGGG - Intergenic
1058512186 9:105731446-105731468 GGGGTGAGAGGGAGGGGGAAGGG - Intronic
1058781394 9:108339529-108339551 GGGGTGGGAGGGAGGGGGTGGGG + Intergenic
1059034423 9:110738681-110738703 GGGGTGGGTGGGAGGTAGGGAGG + Intronic
1059234463 9:112750619-112750641 AGGGAGGGAGGGAGGAGGCGCGG - Intergenic
1059435475 9:114273459-114273481 TGGGTGTGAGGGAGTTGCTGGGG - Intronic
1059647497 9:116281820-116281842 GGGGTGTGAGGCAGTTGGCCTGG - Intronic
1060184962 9:121558643-121558665 GGGGTGGCAGGGAGGTGTGGAGG - Intergenic
1060404666 9:123367422-123367444 GGGGGGTGGGGGGGGTGGGGGGG - Intronic
1060552089 9:124490448-124490470 GGGGAGTGAGGTGGGTGGCCGGG + Intronic
1060667858 9:125443688-125443710 GGGGGCTGGGGGAGCTGGCGGGG - Intronic
1060819938 9:126655375-126655397 TGGGGGTGAGGGAGCTGGCCAGG + Intronic
1060838767 9:126777998-126778020 GGGCTGGGAGGCAGGTGGCAGGG + Intergenic
1060934396 9:127506992-127507014 GAGGGGTGAGGCAGGCGGCGAGG + Exonic
1060947546 9:127579083-127579105 GAGGTGGGAGGGAGGTGGTGGGG - Intergenic
1061156503 9:128865223-128865245 GGTGTGGGAGGGATGTGGGGAGG - Intronic
1061176573 9:129001270-129001292 GAGGTGGGAGGGAAGAGGCGGGG + Intronic
1061218929 9:129237643-129237665 GGGGGGTGGTGGAGGTGGCAGGG + Intergenic
1061248177 9:129412131-129412153 GGGGTGGGAGTGGGGTGGGGTGG + Intergenic
1061771588 9:132927917-132927939 GGGTTGGGAGGCAGGTGGTGAGG - Intronic
1061847185 9:133394415-133394437 GGGGTGTGGGGGAGGGAGGGCGG - Intronic
1062127374 9:134870807-134870829 GGGGTGGGAGGGAGGTGGGAGGG + Intergenic
1062149071 9:135008100-135008122 GGGCTGGGAGGGAGGTGCCTTGG - Intergenic
1062269397 9:135701711-135701733 GGGGTGTGGGGGCGGGGGGGCGG + Intergenic
1062326282 9:136014046-136014068 GGGGAGGGGGGGAGGTGGAGGGG + Intronic
1062342417 9:136099666-136099688 GGCGTGTGTGCGGGGTGGCGGGG + Intergenic
1062384125 9:136302372-136302394 GGGGTGGGAGTGTGGTGGGGGGG - Intronic
1062425869 9:136505932-136505954 GGGCTGGGTGTGAGGTGGCGGGG - Intronic
1062490390 9:136802530-136802552 GGGGAGTGGGGGAGGTGGCTGGG + Intronic
1062495460 9:136829482-136829504 GTGGTAAGAGGGAGCTGGCGGGG + Exonic
1062565129 9:137160933-137160955 GGGGTGTGAGGGGTGCGTCGGGG + Intronic
1062590704 9:137273232-137273254 GGGGCCTGAGGGTGGGGGCGGGG + Exonic
1062598908 9:137311428-137311450 TGGGTGTAGGAGAGGTGGCGAGG + Intronic
1062688149 9:137827019-137827041 GACGTGTGGGGGAGGAGGCGGGG - Intronic
1185440770 X:226589-226611 GGGGTCTGGGGGTGGCGGCGAGG - Intergenic
1185479731 X:437470-437492 GGAGTGGGTGGGGGGTGGCGGGG - Intergenic
1185598885 X:1325447-1325469 GGGGAGAGAGGGAGGTGGGGAGG + Intergenic
1186136071 X:6522479-6522501 GGGGTGGGAGGAAGGTGAGGTGG + Intergenic
1186841045 X:13485001-13485023 GCGGGGTGGGGGAGTTGGCGGGG - Intergenic
1186864091 X:13701935-13701957 GGGCTGTGGGTGAGGTGGGGAGG - Intronic
1187058735 X:15765622-15765644 GGGGAGTGAGGGATATGGAGGGG - Intronic
1187273983 X:17802847-17802869 GAGGTCTGTGGGAGGTGCCGAGG - Intronic
1187337484 X:18393840-18393862 GGGGTGGGAGGGGGGTGGGATGG - Intergenic
1187468128 X:19543889-19543911 GAGCTGGGAGGCAGGTGGCGAGG + Intronic
1188242590 X:27809388-27809410 GGGGTTGGAGGGGGCTGGCGGGG - Intronic
1188269289 X:28118856-28118878 GGGGGCTGAGGGAGGTAGAGAGG - Intergenic
1188584275 X:31753156-31753178 GGGGTGTGAGGGAGGTGGCGAGG + Intronic
1188714743 X:33448017-33448039 GGGGGGCGGGGGAGGTGGCCAGG + Intergenic
1189021982 X:37350053-37350075 GGGGGGAGGGGGAGGCGGCGTGG + Intronic
1189152214 X:38720261-38720283 TGGGTGTGATGGTGGTGGTGGGG + Intergenic
1189240315 X:39519698-39519720 GGGGAGGGAGGGAGGCAGCGTGG - Intergenic
1189308846 X:40006287-40006309 GGAGTGGGAGGGAGGCGGCCAGG + Intergenic
1189465767 X:41276499-41276521 AGGGAGGGAGGAAGGTGGCGGGG + Intergenic
1189834454 X:45005962-45005984 GGGGGGTGGGGGGGGTGGGGGGG - Intronic
1189966360 X:46377872-46377894 GGGGGGTGAGGGACGGGGGGAGG - Intergenic
1190686879 X:52882730-52882752 GGGGTGGGAGGGAGGAGGGAGGG - Intergenic
1190699103 X:52973062-52973084 GGGGTGGGAGGGAGGAGGGAGGG + Intronic
1190913677 X:54794191-54794213 GGGGGGTGAGGGGGGTAGGGTGG + Intronic
1190914651 X:54802152-54802174 GGGGTGGGAGGGAGATGGGGAGG + Intergenic
1192166695 X:68831170-68831192 GGGCTGGGGGGGAGGCGGCGTGG - Intronic
1192234965 X:69289838-69289860 GGAGTGTGAGGGACTTGGCCTGG + Intergenic
1192373373 X:70534336-70534358 TGGGAGTGAGGGAGGTGCTGAGG + Intronic
1192553991 X:72075863-72075885 GCGGTGAGAGGGATGTGGAGGGG + Intergenic
1193356516 X:80525408-80525430 GGGGTTTGAGGGATGAGGGGAGG - Intergenic
1193733253 X:85126843-85126865 GGGGTGGGAGGGGTGTGGTGGGG - Intergenic
1194688997 X:96958720-96958742 GGTGTGTGTGGGAGGTGGGAGGG - Intronic
1194912765 X:99667028-99667050 GGGGGGTGGGGGAAGTGGGGGGG + Intergenic
1195174902 X:102305833-102305855 GGGGTGGGTGGGGGGTGCCGGGG + Intergenic
1195183963 X:102381260-102381282 GGGGTGGGTGGGGGGTGCCGGGG - Intronic
1195389866 X:104350451-104350473 GGGGAGTGGGGGTGGTGGGGGGG - Intergenic
1196185388 X:112739843-112739865 GGGGTATGGGGGAGGGGGCTTGG + Intergenic
1196697830 X:118632975-118632997 GGGGGGTGAGGGGGGTGGGGGGG + Intronic
1197117881 X:122854391-122854413 CGGGTGTGGGGGAAGTGGGGTGG + Intergenic
1197287586 X:124614075-124614097 GGGGGGTTGGGGTGGTGGCGTGG + Intronic
1197745954 X:129932349-129932371 GGGGAGTGAGGGCGGGAGCGAGG - Intergenic
1197749790 X:129956811-129956833 GGGGTGGGGGGGAGGTGGGGAGG - Intergenic
1197753365 X:129980300-129980322 GCGGGAGGAGGGAGGTGGCGGGG - Intergenic
1197962972 X:132025066-132025088 GGGGTGTGGGGCAGGGTGCGTGG - Intergenic
1198026938 X:132716136-132716158 GGGGTGTGAGAGAGGAGATGAGG - Intronic
1198538345 X:137609013-137609035 GGGGGGTGGGGGAGGTGGAAGGG + Intergenic
1198717681 X:139577890-139577912 GGGAAGTGTGGGAGGGGGCGAGG - Intergenic
1198867242 X:141137303-141137325 GGGGTGAGAATGAGGTGGCAAGG + Intergenic
1199325914 X:146497993-146498015 GGGGTTGGGGGGAGGTGGGGGGG + Intergenic
1199438537 X:147841983-147842005 GGGGAATGGGGGAGGTGGTGGGG - Intergenic
1199893225 X:152109089-152109111 GGGGTGTAGGGGAGATGGTGAGG - Intergenic
1199953473 X:152723851-152723873 GGGGCGTGAGGGAGATGGTGAGG + Intergenic
1199956209 X:152744599-152744621 GGGGCGTGAGGGAGATGGTGAGG - Intergenic
1200096272 X:153665421-153665443 GGGGTGTGAGGGAGGAGCTCTGG + Intergenic
1200098024 X:153673292-153673314 GGGGTGCGGGGGAGGGTGCGTGG - Intronic
1200774786 Y:7160525-7160547 TGGGGGGGAGGGAGGTGGCGGGG + Intergenic
1201712463 Y:17007746-17007768 GTGGTGGGATGGAGGTGGGGGGG - Intergenic